ID: 953908841

View in Genome Browser
Species Human (GRCh38)
Location 3:46882063-46882085
Sequence CGGCGGCGGGATGTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953908841_953908858 23 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908858 3:46882109-46882131 AGCGCAATGTCCCGGGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 63
953908841_953908847 -5 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908847 3:46882081-46882103 CGCCGTAAGACTCCGGGCCTCGG 0: 1
1: 0
2: 0
3: 0
4: 24
953908841_953908856 21 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908856 3:46882107-46882129 CTAGCGCAATGTCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 42
953908841_953908853 17 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908853 3:46882103-46882125 GCCTCTAGCGCAATGTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
953908841_953908860 27 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908860 3:46882113-46882135 CAATGTCCCGGGGCGGGGGGCGG 0: 1
1: 0
2: 2
3: 29
4: 343
953908841_953908857 22 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908857 3:46882108-46882130 TAGCGCAATGTCCCGGGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 26
953908841_953908852 16 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908852 3:46882102-46882124 GGCCTCTAGCGCAATGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 43
953908841_953908859 24 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908859 3:46882110-46882132 GCGCAATGTCCCGGGGCGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
953908841_953908855 20 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908855 3:46882106-46882128 TCTAGCGCAATGTCCCGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 24
953908841_953908851 15 Left 953908841 3:46882063-46882085 CCAGCACTCACATCCCGCCGCCG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 953908851 3:46882101-46882123 CGGCCTCTAGCGCAATGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953908841 Original CRISPR CGGCGGCGGGATGTGAGTGC TGG (reversed) Intronic
901007608 1:6179551-6179573 CGGCGGCGGGACGCGAGCGCGGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
901882062 1:12199741-12199763 CTGCAGCGGGAGGTGAGAGCAGG - Intronic
902429543 1:16352418-16352440 CGGCGGCGGCGTTTGAGTGGAGG - Exonic
903055538 1:20633655-20633677 CGGCGGCGGGCTGTGTCCGCGGG + Exonic
903875803 1:26472426-26472448 CGGCGGCGGGAGGTGAAATCCGG + Intergenic
903875834 1:26472576-26472598 CGGCAGCGGGACGTAGGTGCTGG - Exonic
904207739 1:28865635-28865657 GGCAGGCTGGATGTGAGTGCTGG - Intergenic
904475400 1:30761817-30761839 CGTGGGCGGCATGTGAGTGGTGG + Intergenic
919748681 1:201023685-201023707 CTGCGGCGGGAGGTGGCTGCCGG - Exonic
920822982 1:209398669-209398691 GGGCGGAGGCAGGTGAGTGCAGG - Intergenic
921180831 1:212630082-212630104 CGGCTGCGGGGTTTCAGTGCTGG + Intergenic
1064652968 10:17527907-17527929 TGGCTGCAGGCTGTGAGTGCTGG - Intergenic
1067796340 10:49324811-49324833 AGGAGGAAGGATGTGAGTGCAGG + Exonic
1069581581 10:69570376-69570398 CAGCGGCAGGATTTGAGGGCGGG - Intergenic
1071574397 10:86715174-86715196 CAGAGGCGGGGTGTGGGTGCAGG + Intronic
1074776373 10:116770939-116770961 CTGCTGCGGGCTGTGTGTGCTGG + Intergenic
1075991980 10:126845760-126845782 CGGCTGCAGCATGTGTGTGCAGG - Intergenic
1077059945 11:613662-613684 CGGGGACAGGATGTGAGTGACGG + Intronic
1077059955 11:613692-613714 CGGGGACAGGATGTGAGTGATGG + Intronic
1077640944 11:3880978-3881000 CGGCTGCAGGATGGGAGAGCAGG + Intronic
1078659831 11:13277871-13277893 CCGCCGCGGGATCCGAGTGCGGG + Exonic
1082807140 11:57458599-57458621 CGGCGGCGGGGAGGGAGTGTTGG - Intergenic
1083206036 11:61149980-61150002 AGGGGGCAGGGTGTGAGTGCTGG - Intronic
1083262014 11:61528288-61528310 CGTCCGTGGGATGTGAGTGTGGG - Intronic
1083653997 11:64220315-64220337 CGGTGCCAGGATGTGAGTGAGGG + Exonic
1084215929 11:67646859-67646881 CGGCAGCCGGATGTGGCTGCCGG + Exonic
1084403019 11:68956011-68956033 CGGGGGCAGGATGGGGGTGCTGG + Intergenic
1084916974 11:72435804-72435826 AGGGGGCGGGATGGGAGTGCAGG - Intergenic
1089457661 11:118634824-118634846 CAGCGGCGGGAGGGGAGCGCGGG - Intronic
1094692702 12:32785588-32785610 GGCCGGGGGGATGTGAGTGAAGG - Intergenic
1095089078 12:38087371-38087393 GTGCTGCTGGATGTGAGTGCTGG + Intergenic
1095239130 12:39836246-39836268 CTACTGTGGGATGTGAGTGCTGG + Intronic
1096991045 12:55803591-55803613 AGGCGGAGTGATGTGAGTGAGGG - Intronic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1097232955 12:57523119-57523141 CGGCGGGGGCAGGTGAGGGCGGG - Intronic
1097990087 12:65824998-65825020 CGGCGGCGGTGGGTGGGTGCCGG - Exonic
1102755465 12:115335896-115335918 GGGCAGCGGAATGTGAGAGCTGG + Intergenic
1104849083 12:131862689-131862711 TGGCGGGGGGCTGTGTGTGCGGG - Intergenic
1107548969 13:41457745-41457767 CCGCGGCCGCAGGTGAGTGCGGG + Exonic
1113546354 13:111153980-111154002 CTGCGGCTGGAGGTGAGCGCGGG + Exonic
1113660711 13:112104937-112104959 CGGCAGCGGGACGCGAGGGCGGG + Intergenic
1114496442 14:23136344-23136366 TGGAGGGGGGACGTGAGTGCAGG - Intronic
1114756633 14:25267351-25267373 CGGTGGCGGGATGTAGGTGCTGG + Intergenic
1115463869 14:33692134-33692156 GGGCGGAGGTATGTGAGCGCAGG + Intronic
1116928717 14:50668424-50668446 CGGCGGCGGGACTCGGGTGCCGG + Intergenic
1117449705 14:55838976-55838998 TGGGGGCGGGATGGGAGTGATGG + Intergenic
1117612900 14:57502762-57502784 AGGCGGAGAAATGTGAGTGCTGG + Intergenic
1117941595 14:60972478-60972500 CGGCGGCGGGATGTGGGCACCGG + Exonic
1119286434 14:73458482-73458504 GGGCAGCGGCAGGTGAGTGCCGG - Exonic
1120953049 14:90060503-90060525 CGGGGGCGGGATGTGTCTGGAGG + Intergenic
1121339836 14:93098813-93098835 AGGCGGCTGCATGGGAGTGCTGG - Intronic
1122736540 14:103847102-103847124 CGGCGCCGGGCTGTCAGCGCGGG - Intronic
1122772091 14:104102032-104102054 AGGAGGCGGGAGGTCAGTGCGGG + Intronic
1124034164 15:26038856-26038878 CAGAGGTGGGAAGTGAGTGCAGG - Intergenic
1132462420 16:62063-62085 CTGGGGCGGGAGGTGAATGCCGG - Intronic
1132887163 16:2187342-2187364 CTGCTGCTGGATGTGAGTGTGGG - Exonic
1132950736 16:2560850-2560872 CGGAGGTGGGGTTTGAGTGCAGG + Intronic
1132963614 16:2639320-2639342 CGGAGGTGGGGTTTGAGTGCAGG - Intergenic
1133097709 16:3458369-3458391 CGGCGGCGGGGAGTGGGCGCTGG + Intronic
1134209324 16:12262565-12262587 CACCGGCGGGATGAGAGCGCAGG + Intronic
1135662547 16:24309090-24309112 TGGCGGCTGGCTCTGAGTGCAGG + Intronic
1135828988 16:25756363-25756385 TTGCGGTGGGAGGTGAGTGCAGG + Intronic
1136453986 16:30370193-30370215 CGGCGGGGGGATGTGAGGGGCGG - Exonic
1140927566 16:79599146-79599168 CGGCGGCGTGGTGCGGGTGCAGG + Exonic
1141859533 16:86706963-86706985 CGGAGGTGGGATGTGAATCCAGG - Intergenic
1141891675 16:86930397-86930419 CAGAGGCGGGTTGTGAGTGCAGG - Intergenic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1145252969 17:21306380-21306402 CGGGGGAGGGGTGTGAGTGTGGG + Intronic
1145323607 17:21781536-21781558 CGGGGGAGGGGTGTGAGTGTGGG - Intergenic
1149642750 17:58214730-58214752 CAGGCGAGGGATGTGAGTGCGGG - Exonic
1150002662 17:61451651-61451673 CGGCGGCGGCAGGGAAGTGCTGG - Intergenic
1152114871 17:78379191-78379213 CGGCCCCAGGATGTGAGTGTCGG + Intronic
1152197281 17:78925147-78925169 CGGCGGCGGGCTGGGGGCGCGGG + Exonic
1152407482 17:80105883-80105905 CGGCCGCGTGCTGTGAGTTCTGG + Intergenic
1152716369 17:81902559-81902581 CGGCGGCAGGACGTGGGTGGGGG + Intronic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1156178200 18:34572543-34572565 CAGAGGCGGAATGTGAGTTCAGG + Intronic
1160774488 19:848718-848740 CAGGGGAGGGATGTGGGTGCAGG + Intergenic
1160868189 19:1265439-1265461 CTGTGGCGGGGTGTGTGTGCCGG + Intronic
1160923893 19:1533837-1533859 CGGCTGCGGGAGGTGAGAGCTGG + Intronic
1161170899 19:2812048-2812070 AGGCCTCGGGCTGTGAGTGCTGG + Intronic
1162770929 19:12948950-12948972 AGGAGGCTGGATGTGAGTGATGG + Intronic
1163000395 19:14363372-14363394 CGGGGGCGGGGTGAGGGTGCTGG - Intergenic
1163638945 19:18450781-18450803 CCGCGGGGGCAGGTGAGTGCTGG + Exonic
1164037597 19:21467992-21468014 GTGCTGCTGGATGTGAGTGCTGG + Intronic
1164245032 19:23421243-23421265 GCGCTGCTGGATGTGAGTGCTGG + Intergenic
1165960792 19:39532673-39532695 CGGCGGCGGGGTTCGGGTGCAGG - Exonic
1166105677 19:40597070-40597092 CGGCGCCGGGCTGTGATTGGCGG + Intronic
1167706263 19:51082937-51082959 GGGCGGCGGGAGGTGGGGGCAGG - Intronic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
927606595 2:24491591-24491613 CGGCGGCGGCAGGTGAGTGGCGG + Intergenic
941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG + Intronic
943782266 2:191837569-191837591 CGGCAGCTGGAGGAGAGTGCTGG - Intronic
945225860 2:207530425-207530447 CGGCGGCCGGGGGTGTGTGCGGG + Intronic
1169087836 20:2838435-2838457 CTGCGGCGGGATGTGGTTGAAGG - Exonic
1171982498 20:31637880-31637902 CTGCGGAGGGACCTGAGTGCGGG - Exonic
1172023997 20:31935648-31935670 CTGCAGCAGGATGTGACTGCTGG + Intronic
1174806583 20:53608756-53608778 CGGCGGCAGGATTTGAATCCAGG - Intronic
1175831025 20:61965676-61965698 GGGCAACGGGATGTGAGTGGGGG - Intronic
1176046895 20:63097436-63097458 CGGCGGGCGGATGTGCGTCCAGG - Intergenic
1176156951 20:63626830-63626852 CGGCGGGGGGAGGGGAGGGCCGG - Intronic
1179170800 21:38971307-38971329 CTGCGGAGGGACATGAGTGCAGG - Intergenic
1181442656 22:22944747-22944769 CGGAGCCGGGATGGGATTGCAGG + Intergenic
1183586450 22:38755752-38755774 CCGCGGCAGCAGGTGAGTGCGGG - Exonic
1184059678 22:42074330-42074352 CGGCGGCGGGAGGTGAGAGTGGG + Exonic
1184099730 22:42335828-42335850 TGGGGGCGTGATCTGAGTGCTGG - Intronic
1184743385 22:46442274-46442296 GGGAGGCGGAATCTGAGTGCAGG - Intronic
950779094 3:15375666-15375688 CGGCGGCGGGACGTAGGTGCTGG + Intergenic
953908841 3:46882063-46882085 CGGCGGCGGGATGTGAGTGCTGG - Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
965588879 3:170343583-170343605 GGGGGGCGGGGTGTGAGGGCGGG + Intergenic
966183044 3:177204140-177204162 CGGCGGACGGCTCTGAGTGCGGG + Intergenic
972794002 4:42398378-42398400 CGGCGGCTGCATGTGTGCGCGGG + Intronic
985472254 5:53541-53563 CGGCGGCGGGAGGAGGGGGCGGG + Intergenic
985510144 5:308920-308942 CGGTGCCGGGTGGTGAGTGCTGG - Intronic
997485273 5:134225925-134225947 CGGCGGCGGCGTGTGCGTGTAGG - Exonic
997622374 5:135307205-135307227 AGGAGGCAGGATGTGAGGGCGGG + Intronic
999322664 5:150624896-150624918 CAGCGGCTGGAGGTGAGTGAGGG + Intronic
1002099008 5:176848185-176848207 GGGCGGAGGGATCTGGGTGCGGG - Intronic
1002186595 5:177457595-177457617 CGGGGGCTGGATTTGAGTGTGGG - Intronic
1002636542 5:180611599-180611621 CGGGGGCGAGAGCTGAGTGCGGG - Intronic
1006813800 6:36837836-36837858 AGGCGCAGGGATGTGCGTGCAGG + Intronic
1007444510 6:41895010-41895032 GGGCGGCGGGAGGCGAGAGCCGG - Intronic
1014434686 6:121408505-121408527 CGGCGGCGGGATGTAGGCGCTGG - Intergenic
1018435083 6:163752113-163752135 GGGCGGCGCGTTGGGAGTGCAGG - Intergenic
1019279158 7:191858-191880 CGACGGGGGTGTGTGAGTGCAGG - Intergenic
1021808096 7:24376667-24376689 AGGCGGGGAGATGTGAGAGCTGG - Intergenic
1022410378 7:30135108-30135130 CGGCGGCGGGAGGCGGGCGCGGG + Exonic
1022446915 7:30478507-30478529 GGGAGGCGGGATTTGCGTGCGGG - Intronic
1032683363 7:134208060-134208082 AGGCCTGGGGATGTGAGTGCGGG + Intronic
1035585602 8:770679-770701 TGGCTGTGGGATGTGATTGCTGG + Intergenic
1038450030 8:27633934-27633956 CGGCGGCGGGATGCGCGCTCTGG + Intronic
1042916176 8:73878370-73878392 CGGCGGGGGGCTGAGTGTGCGGG - Intronic
1046708844 8:117487051-117487073 CGGTGGGGGGATGTTGGTGCGGG + Intergenic
1051418626 9:16870160-16870182 CGGCGGCTGGGCGTGGGTGCCGG - Intronic
1052893131 9:33721854-33721876 CGGCCTCGGCAGGTGAGTGCTGG - Intergenic
1058683260 9:107458318-107458340 TGGCAGCAGGATGTGGGTGCTGG + Intergenic
1060967511 9:127720205-127720227 GGGCGGCAGGAAGTGGGTGCTGG - Intronic
1062314729 9:135961150-135961172 CGGCGGCGGGATGTTCGTGCAGG - Exonic
1203363500 Un_KI270442v1:237862-237884 GGGCGGCGGGATGTGAAGGGGGG + Intergenic
1188451232 X:30309471-30309493 CGGAGGCGGGCGGTGTGTGCGGG + Exonic
1199772502 X:150983759-150983781 CGGCTGCGGGCTGTGGGCGCTGG + Intronic