ID: 953909596

View in Genome Browser
Species Human (GRCh38)
Location 3:46884953-46884975
Sequence ACCAAAGACAGCCCCATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953909592_953909596 -7 Left 953909592 3:46884937-46884959 CCAGCAAAGGCTCCCCACCAAAG 0: 1
1: 0
2: 0
3: 12
4: 171
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909591_953909596 -6 Left 953909591 3:46884936-46884958 CCCAGCAAAGGCTCCCCACCAAA 0: 1
1: 0
2: 0
3: 13
4: 174
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909588_953909596 9 Left 953909588 3:46884921-46884943 CCTCACAATTCTGGCCCCAGCAA 0: 1
1: 0
2: 1
3: 21
4: 202
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909587_953909596 10 Left 953909587 3:46884920-46884942 CCCTCACAATTCTGGCCCCAGCA 0: 1
1: 0
2: 1
3: 22
4: 223
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909582_953909596 30 Left 953909582 3:46884900-46884922 CCCACTTACCTGTGCCTACACCC 0: 1
1: 0
2: 2
3: 10
4: 166
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909586_953909596 16 Left 953909586 3:46884914-46884936 CCTACACCCTCACAATTCTGGCC 0: 1
1: 0
2: 0
3: 16
4: 152
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909584_953909596 22 Left 953909584 3:46884908-46884930 CCTGTGCCTACACCCTCACAATT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909583_953909596 29 Left 953909583 3:46884901-46884923 CCACTTACCTGTGCCTACACCCT 0: 1
1: 0
2: 3
3: 14
4: 242
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161
953909590_953909596 -5 Left 953909590 3:46884935-46884957 CCCCAGCAAAGGCTCCCCACCAA 0: 1
1: 0
2: 1
3: 25
4: 228
Right 953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG 0: 1
1: 0
2: 1
3: 23
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953909596 Original CRISPR ACCAAAGACAGCCCCATACA AGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
904770444 1:32878314-32878336 ACCAAAGGCTGCCCCATCCCAGG + Intergenic
906802563 1:48750484-48750506 ACAAAAGAGAGCTCCTTACATGG - Intronic
908141876 1:61193373-61193395 ACCTAAGACACCTCTATACATGG - Intronic
909934770 1:81538605-81538627 CACAAATACAGCCTCATACAAGG + Intronic
912369138 1:109159585-109159607 ACCAAACACAGACTCACACAGGG - Intronic
918138990 1:181704227-181704249 AGCAAACACAGCCCCAGAGAAGG - Intronic
920570795 1:207015851-207015873 TCCAAACACAGACCCATGCAGGG + Intronic
1065521668 10:26579686-26579708 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1065522037 10:26582530-26582552 ACCAAAGGCAGCCCCAATCAGGG + Intergenic
1065522263 10:26584404-26584426 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065522503 10:26586251-26586273 ACCAAAGCCAGCTCCAATCAGGG + Intergenic
1065522811 10:26588689-26588711 ACCAAAGCCAGCCCCAATCATGG + Intergenic
1065527491 10:26637950-26637972 ACCAAAGCCAGCCCAAGGCAGGG + Intergenic
1065527836 10:26640709-26640731 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG + Intergenic
1065528530 10:26646152-26646174 ACCAAAGTCAGCCCCAGTCAGGG + Intergenic
1065528742 10:26647962-26647984 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065558482 10:26939585-26939607 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065558708 10:26941415-26941437 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065559063 10:26944232-26944254 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065559349 10:26946438-26946460 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065987953 10:30975249-30975271 AACTAGGAAAGCCCCATACAAGG + Intronic
1067160273 10:43819562-43819584 GCCCCAGACAGCCCCATTCAGGG - Intergenic
1067397441 10:45935314-45935336 ACAAATCACAGCCTCATACAAGG + Intergenic
1067518291 10:46974017-46974039 ACCAAAGAGAGCCCCTACCAAGG - Intronic
1067643958 10:48077811-48077833 ACCAAAGAGAGCCCCTACCAAGG + Intergenic
1067865760 10:49904400-49904422 ACAAATCACAGCCTCATACAAGG + Intronic
1071889146 10:89983506-89983528 ACCAAAGCCAGACTGATACAAGG + Intergenic
1072442188 10:95467005-95467027 ATCAAAGACAGCCTCTAACATGG + Intronic
1076441820 10:130485559-130485581 ACGAAAGACAGTCCCATCGATGG + Intergenic
1076601509 10:131659716-131659738 ACCAGAAACAGCCCCAGAAAAGG - Intergenic
1078027219 11:7708410-7708432 ACCAAAGTCTGCACCAAACATGG + Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079604380 11:22346337-22346359 AGCAAAGACAGCCCCACTCTTGG + Intronic
1080783984 11:35457987-35458009 GCCAAAGAAAGCCTCAGACAGGG + Intronic
1084021737 11:66421783-66421805 ACCATGGACAGAGCCATACACGG - Intronic
1086595401 11:88564910-88564932 AACAAAGACAGCACTATAAACGG - Intronic
1092896947 12:13021245-13021267 ACAAAAAACAGCTCCTTACATGG + Intergenic
1096198126 12:49662183-49662205 ACCCATGACAGACCCATCCACGG + Intronic
1099298195 12:80857373-80857395 ACCAAAGGAAGCCAGATACAAGG - Intronic
1100126833 12:91437044-91437066 ACCAAAGACAGACAGACACATGG - Intergenic
1100614952 12:96223786-96223808 CCCCAAGACGGCCCCATGCAAGG - Intronic
1104915008 12:132260080-132260102 CCCAAAGCCAGCCCCACAGAGGG - Intronic
1107368236 13:39709930-39709952 ACCAAACAAATCCACATACATGG - Intronic
1108417496 13:50213353-50213375 AATAAAGACAGCCCCATAAGTGG - Intronic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1112491207 13:99865883-99865905 TCCAAAGACAGCACCACAAAGGG - Intronic
1119258509 14:73221020-73221042 ACCAAAGACAGCCCCAAACCAGG - Exonic
1119721516 14:76894493-76894515 ACCAATGACAGCCCTCTCCAGGG + Intergenic
1122179457 14:99944623-99944645 AGCAAAGACAGCCCCTGCCAGGG - Intergenic
1122275778 14:100590082-100590104 CCCGCAGACAGCCACATACAGGG + Intergenic
1122826238 14:104372181-104372203 ATGAAAGATAGACCCATACAAGG - Intergenic
1124497684 15:30196304-30196326 CCCCAAGACAGCCCCATGCGAGG - Intergenic
1124745902 15:32342387-32342409 CCCCAAGACAGCCCCATGCGAGG + Intergenic
1125905516 15:43388182-43388204 ACCAAAGACAAACCTCTACAGGG + Intronic
1126367549 15:47911434-47911456 ACTAAAGACACCCCGCTACAGGG + Intergenic
1129530277 15:76259690-76259712 TCCAAAGTCAGCCACACACACGG + Intronic
1131428832 15:92369557-92369579 AGCAAAGACTGGCCCATAGAAGG + Intergenic
1136185805 16:28588259-28588281 CCCAAAGACAGACCCCTGCATGG - Intronic
1136468942 16:30465517-30465539 AAAAAAGAAAGCCTCATACATGG - Intergenic
1136468992 16:30465826-30465848 TCCCAAGAAAGCCTCATACATGG - Intergenic
1138558403 16:57786194-57786216 CACAAAGCCAGCCCCACACATGG + Intronic
1139463552 16:67141801-67141823 ACCACACAGAGCCCCAAACAGGG + Intronic
1145814122 17:27783222-27783244 ACCAGAGACAGCTCCCTCCAGGG + Intronic
1146815196 17:35936866-35936888 ACAGAAGACAGCCCCAAAGATGG + Intronic
1151022191 17:70630379-70630401 ACCTGACACAGGCCCATACATGG - Intergenic
1153762781 18:8347891-8347913 ACTAAAGTCAGGCCCATCCAAGG - Intronic
1154256975 18:12790497-12790519 TTCAAAGACAGCACCATAAAAGG + Intronic
1157112119 18:44831036-44831058 AGAAAAGACAGCTCTATACAAGG - Intronic
1158715577 18:59876407-59876429 ACAAAAGACAGCCTCAAAAAAGG + Intergenic
1159328424 18:66954653-66954675 ACTAAAGACAGCCCTATGAATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163612888 19:18310179-18310201 ACCAGAGAGAGCCCCATCCCAGG - Intronic
1168356655 19:55704327-55704349 TCCAAATACAGCCCCATTCTGGG - Intronic
926834392 2:17001571-17001593 ACCAATGACAGCCTTATAAAAGG + Intergenic
928466576 2:31528195-31528217 TCCTAAGATTGCCCCATACATGG + Intronic
928727216 2:34188591-34188613 ACCAAGGAGAGTCCTATACATGG + Intergenic
932502980 2:72200659-72200681 TCCAACCACAGCCCCATTCATGG - Intronic
932824896 2:74930223-74930245 ACAAATGGCAGCCCCATACAGGG + Intergenic
933840834 2:86284464-86284486 GCCAAAGCCAGCACCATCCAGGG + Intronic
937671974 2:124547675-124547697 GCCAAAGAGAGCCCCTTGCAGGG + Intronic
937953297 2:127404861-127404883 AACAAAGACAGCCCCAGAAGAGG - Intergenic
937974324 2:127572720-127572742 TCCAGAAACAGCCCCATACATGG - Intronic
948171106 2:235903953-235903975 TCCAAAGGCAGCCCCACAGAAGG + Intronic
948766296 2:240222886-240222908 GCCAAAGACAGCACTATGCAGGG - Intergenic
948875347 2:240824011-240824033 ACAGAAGCCAGGCCCATACAGGG + Intergenic
1170009075 20:11701139-11701161 AACCAAGACAGCCCAATGCAGGG + Intergenic
1171725842 20:28620402-28620424 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1171790046 20:29514898-29514920 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1172475158 20:35231610-35231632 ACCAAATAGGGCCACATACATGG - Intronic
1172968484 20:38856292-38856314 ACAGAAGACAGCCCCAGACCTGG + Intronic
1176208990 20:63908206-63908228 ACCAGGGACAGCCCCACGCATGG + Intronic
1176697047 21:9990537-9990559 GCCCAAGACAGCCCCATATCTGG - Intergenic
1180107917 21:45631950-45631972 ACAAAAGAGGGCCCCACACATGG - Intergenic
1180390745 22:12280008-12280030 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1180408997 22:12584749-12584771 ACCAAAGCCAGCCCCCGGCAGGG - Intergenic
1180618375 22:17143623-17143645 CTCAGAGACAGCCCCACACAGGG - Intronic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
1182416354 22:30223698-30223720 CACAAAGACAGCCCCACAAAGGG - Intergenic
1182537944 22:31019915-31019937 ACCACAGACAGCCCCAACCAGGG - Intergenic
1183632687 22:39042847-39042869 ACTAAACACAGCCCCCTGCATGG - Intronic
1184561290 22:45264338-45264360 ACCAAAGAAAAACCCATTCATGG - Intergenic
1185013063 22:48326857-48326879 ACCAGAGGCAGCCCCATTCTTGG - Intergenic
949097928 3:108653-108675 ACCGAAAAGACCCCCATACATGG + Intergenic
953341634 3:42139489-42139511 ATCAAAGGCAGCCTCATACCAGG + Intronic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
955343191 3:58141561-58141583 ACCACAGACAGCACCAGTCAAGG + Intronic
956316672 3:67945516-67945538 GCCCAATACAGCCCCATACTAGG - Intergenic
958414152 3:93854282-93854304 ACCATAGAGAACCCCATACTAGG - Intergenic
961516865 3:127443576-127443598 CCCAAAGCCAGCCCTAGACAAGG + Intergenic
962600747 3:136989396-136989418 GTCAAAGCCAGCCCCAGACAGGG - Intronic
963121245 3:141778585-141778607 ACCAAAGACAGCGCGCTGCAGGG + Exonic
963250556 3:143099232-143099254 TCCAAAGAAAGCCTCATCCAGGG - Intergenic
963843157 3:150128686-150128708 ACCAATCACATCCCAATACAGGG + Intergenic
965864654 3:173191290-173191312 ACCAGAGGCAGCCTCTTACATGG - Intergenic
966283330 3:178262002-178262024 ACAAAAAAAAGCCCCAAACAAGG - Intergenic
968883329 4:3312937-3312959 ACCAAGCACACCCCCATACTCGG - Intronic
969090192 4:4688316-4688338 AACATAGACAGCCCCATTTATGG + Intergenic
969104128 4:4792016-4792038 GCCAAAGCCAGCTCCACACAGGG - Intergenic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
969524435 4:7696986-7697008 CCCAAAGACAGCCACATTCAGGG - Intronic
969859751 4:10026392-10026414 AGCAAAGACAATCCTATACAAGG - Intronic
972370782 4:38421221-38421243 ACCCAACACAGCCTCATTCAAGG - Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
980608630 4:135126538-135126560 ACCACAGGCATCCCCATACCCGG - Intergenic
980818095 4:137975086-137975108 ACCAAAGAAAGCCACTTACATGG + Intergenic
981178991 4:141716601-141716623 ACCACAGAGAGCCCCCAACAGGG + Intronic
982951514 4:161702907-161702929 TCCAAATACAGCCTCATTCATGG - Intronic
982986360 4:162212501-162212523 ATCTAAGAGAGCCCCAAACACGG + Intergenic
983074562 4:163309897-163309919 ACCTAAGTCAGCCAAATACAGGG - Intergenic
983650331 4:170030746-170030768 GCCAAAGAAAACCCAATACAGGG - Intronic
985434714 4:189917393-189917415 ACCAAAGCCAGCCCCCGGCAGGG - Intergenic
985843360 5:2326201-2326223 CCCAAACACAGTCCCAGACATGG + Intergenic
986268592 5:6211797-6211819 ACCACAGACAGCCCCGTATTAGG + Intergenic
988635147 5:32975618-32975640 ATAAAAGACAGCCACATCCAGGG + Intergenic
990642706 5:57805675-57805697 ACTAAATAAAGCCCCAAACATGG - Intergenic
990987272 5:61652317-61652339 AGCAATGACAGACCCATTCATGG - Intronic
992446446 5:76838425-76838447 AGCAAAGACAACCACATCCAAGG - Intergenic
998381651 5:141730159-141730181 GCCAAAGACAGCCTCATAAAGGG - Intergenic
998682874 5:144489615-144489637 ACCAAAGACAAAAACATACAAGG + Intergenic
998936618 5:147235781-147235803 TCCAAAGACAGCCACAATCACGG - Intronic
1000520324 5:162286953-162286975 AGCAAAGACAAACACATACAAGG - Intergenic
1002325829 5:178405000-178405022 ACCAATGACATCCCCATACCAGG + Intronic
1003755829 6:9118782-9118804 AACAAAGCCAGCCTCATACTTGG - Intergenic
1004703092 6:18097595-18097617 ATAAAAGACAGCACCATACTTGG + Intergenic
1004755959 6:18610400-18610422 ACCAAAGACAACACCATAATAGG - Intergenic
1005962428 6:30703693-30703715 ATCAAAAACAGCCCCAAAGAGGG - Exonic
1007515494 6:42407340-42407362 GACAAACACAGCCCCAAACAGGG - Intronic
1011251292 6:85375077-85375099 ACCTAAGACAGCCTGATAGATGG - Intergenic
1014721826 6:124926279-124926301 ACAAAAGACAGCTCCTTAAATGG - Intergenic
1020578793 7:9968783-9968805 TCCAAATACAGCCACATACAAGG - Intergenic
1020791609 7:12634682-12634704 ACAAAACAAAGCCCCAAACATGG - Intronic
1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG + Intergenic
1022201768 7:28124019-28124041 ACACAAGTCAGCCCCAAACAGGG - Intronic
1023493124 7:40765704-40765726 ACCAAGGGAAGGCCCATACAGGG + Intronic
1026483327 7:70797284-70797306 CCCTAAGACAGCCCCAAAGAGGG - Intergenic
1034821314 7:154218997-154219019 CCCAAAGACAGGCCCATTCTGGG - Intronic
1035522982 8:290371-290393 TCCAAAGACAGCCACATTAAGGG - Intergenic
1038901207 8:31846019-31846041 TCCAAAGACATCCCCATGAAAGG + Intronic
1039574765 8:38614137-38614159 TCCAAATACAGCCCCATTGAGGG - Intergenic
1040019964 8:42732034-42732056 AGGAAAGACAGCCCCAGGCAGGG - Exonic
1044773325 8:95660810-95660832 ATCACAGACAGAGCCATACAGGG + Intergenic
1046445530 8:114312674-114312696 ACCAAAGACAGCTGGATACATGG - Intergenic
1046937441 8:119898431-119898453 ACCACACCCAGCCCAATACAAGG - Intronic
1050565536 9:6878197-6878219 TCCAATCACAGCCCCGTACACGG - Intronic
1051124841 9:13792121-13792143 ACAAAAGGCAGCCCCAGTCAGGG + Intergenic
1053634032 9:39976389-39976411 GCCCAAGACAGCCCCATATCTGG - Intergenic
1053723769 9:40975466-40975488 ACCAAAGCCAGCCCCCAGCAGGG - Intergenic
1053771715 9:41487115-41487137 GCCCAAGACAGCCCCATATCTGG + Intergenic
1054209855 9:62274308-62274330 GCCCAAGACAGCCCCATATCTGG + Intergenic
1054315140 9:63574646-63574668 GCCCAAGACAGCCCCATATCTGG - Intergenic
1054342190 9:63876533-63876555 ACCAAAGCCAGCCCCCAGCAGGG + Intergenic
1055549923 9:77423876-77423898 ACCAGAGCCAGCCCCATGCCAGG - Exonic
1056756908 9:89387405-89387427 ATCATAGACAGTCCCATCCAGGG + Exonic
1057318173 9:93985341-93985363 ACCAAAGACAGACGCATAGAAGG + Intergenic
1058681966 9:107447876-107447898 ACGAAAGACAGGCCCAAGCAGGG - Intergenic
1058816557 9:108688401-108688423 ACCACACACAGCCCCTTGCATGG + Intergenic
1059686264 9:116639629-116639651 ATCAAAGACTGCCCCAGCCAGGG - Intronic
1061100197 9:128486347-128486369 ACCTAAGACAGAAGCATACATGG + Intronic
1061876176 9:133545257-133545279 ACCCAAGCCCGCCCCATAAAGGG - Intronic
1203451392 Un_GL000219v1:120532-120554 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1186966643 X:14794149-14794171 GTCAAAGACAGCCCCAGCCAAGG + Intergenic
1192895697 X:75440830-75440852 ACCATAGCAAGCCCCACACAAGG - Intronic
1197355398 X:125432814-125432836 ACTAAAGACAGAACCACACATGG - Intergenic