ID: 953910169

View in Genome Browser
Species Human (GRCh38)
Location 3:46888844-46888866
Sequence TGCCCCGAAGGCGGCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953910161_953910169 5 Left 953910161 3:46888816-46888838 CCGCTATCCCAGGCTGCATCCCA 0: 1
1: 0
2: 5
3: 32
4: 302
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910157_953910169 28 Left 953910157 3:46888793-46888815 CCACCAGGTCGTAGCAGCCAACT 0: 1
1: 0
2: 0
3: 1
4: 58
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910160_953910169 11 Left 953910160 3:46888810-46888832 CCAACTCCGCTATCCCAGGCTGC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910158_953910169 25 Left 953910158 3:46888796-46888818 CCAGGTCGTAGCAGCCAACTCCG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910163_953910169 -3 Left 953910163 3:46888824-46888846 CCAGGCTGCATCCCACTGCCTGC 0: 1
1: 0
2: 3
3: 40
4: 425
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910162_953910169 -2 Left 953910162 3:46888823-46888845 CCCAGGCTGCATCCCACTGCCTG 0: 1
1: 0
2: 0
3: 34
4: 530
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953910169 Original CRISPR TGCCCCGAAGGCGGCCACGC TGG Intronic