ID: 953910169

View in Genome Browser
Species Human (GRCh38)
Location 3:46888844-46888866
Sequence TGCCCCGAAGGCGGCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953910162_953910169 -2 Left 953910162 3:46888823-46888845 CCCAGGCTGCATCCCACTGCCTG 0: 1
1: 0
2: 0
3: 34
4: 530
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910157_953910169 28 Left 953910157 3:46888793-46888815 CCACCAGGTCGTAGCAGCCAACT 0: 1
1: 0
2: 0
3: 1
4: 58
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910158_953910169 25 Left 953910158 3:46888796-46888818 CCAGGTCGTAGCAGCCAACTCCG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910160_953910169 11 Left 953910160 3:46888810-46888832 CCAACTCCGCTATCCCAGGCTGC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910161_953910169 5 Left 953910161 3:46888816-46888838 CCGCTATCCCAGGCTGCATCCCA 0: 1
1: 0
2: 5
3: 32
4: 302
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107
953910163_953910169 -3 Left 953910163 3:46888824-46888846 CCAGGCTGCATCCCACTGCCTGC 0: 1
1: 0
2: 3
3: 40
4: 425
Right 953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953910169 Original CRISPR TGCCCCGAAGGCGGCCACGC TGG Intronic
900014174 1:137391-137413 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
900044037 1:492593-492615 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
900065447 1:727499-727521 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
901012451 1:6209422-6209444 GGCCCTGCAGACGGCCACGCGGG + Exonic
902933891 1:19750588-19750610 TGTCCTGAAGGCAGCCAGGCAGG - Intronic
905177915 1:36149498-36149520 TGCCCCGCGGGAGGCCGCGCAGG - Intronic
905819527 1:40979224-40979246 TGCCCCGAAGGCGGCTGCTTTGG - Intergenic
907251511 1:53142598-53142620 TCCCTCTAAGGCGGCCACACGGG - Intronic
915247605 1:154567754-154567776 CGCCCCGGAGGCGGAAACGCTGG - Intergenic
920686220 1:208110810-208110832 TGCCCCAAAAGCGGCCACCGGGG + Intronic
922734415 1:227971691-227971713 TGCCCCCATGGCGGCCTCCCGGG + Intergenic
922734704 1:227972823-227972845 TGCCCCCATGGCGGCCTCCCGGG + Intergenic
923550349 1:234958551-234958573 TGCCCCAGAGGCTGCCACCCTGG - Intergenic
1066732615 10:38449138-38449160 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1069605623 10:69737116-69737138 TGTCCCGAAGGAGGCAACGGAGG + Intergenic
1073135063 10:101215829-101215851 TTCCCAGACGGCGGCCAGGCAGG - Intergenic
1076970372 11:129068-129090 TGCCCCCACGGCGGCCTCTCGGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1081555557 11:44157602-44157624 TGCCCCGAAGGGAGCGACCCAGG - Intronic
1081783921 11:45733102-45733124 TGCACCGAAGGCAGCCAGGTGGG + Intergenic
1087141541 11:94769360-94769382 TGCCCCATAGGCGGCCGGGCTGG + Intronic
1089682826 11:120128987-120129009 TGCCCAGACGGAGTCCACGCCGG - Intronic
1091121904 11:133064334-133064356 AGCCGGGAAGGCGGCCAGGCGGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1109915933 13:68984938-68984960 TGCCTCGAAGGCGGGGAAGCTGG + Intergenic
1113369337 13:109708216-109708238 TGGCCCGAAGCTGGCCCCGCTGG - Intergenic
1113839558 13:113351038-113351060 TGCCCCGAGGGTGGCCACCTGGG + Intronic
1118647949 14:67858207-67858229 TACCCAGAAGGCTGTCACGCTGG - Intronic
1121035227 14:90697790-90697812 CGCCCCGAAGGAGGCCAGGCAGG + Intronic
1121045116 14:90782115-90782137 TGCCTGGAAGCCGACCACGCTGG - Intronic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1132055795 15:98649415-98649437 TACTCCGAAGGCGGCGCCGCCGG - Exonic
1132633621 16:932004-932026 GCCCCCGACGGCGGCCACACAGG + Intronic
1136899023 16:34015578-34015600 AGCCTCCAAGGGGGCCACGCGGG - Intergenic
1138591068 16:58000184-58000206 AGCCCCGAGGGCGGCCGGGCTGG + Intronic
1140753710 16:78048802-78048824 TGCCCCACAGCCGGCCAAGCGGG - Intronic
1141168882 16:81678641-81678663 GGCCCCGGGGGCGGGCACGCGGG - Intronic
1142431261 16:90029137-90029159 TGCCCCGTAGGCTGCCCCGTAGG - Exonic
1142449877 16:90168414-90168436 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1142457209 17:63432-63454 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
1146059310 17:29596209-29596231 TGCTCTGAAGGTGGCCATGCTGG - Intronic
1148031964 17:44627932-44627954 TGCCCAGAAGGCAGGCAGGCCGG + Intergenic
1150645166 17:66973369-66973391 TGCCCAGAAGGCGTCCACCATGG + Intronic
1152222196 17:79075016-79075038 GGCCCCGGAGGCGGGGACGCAGG + Exonic
1152617707 17:81345623-81345645 CGCTCCGAGGGCGGCCTCGCGGG + Intergenic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1157867117 18:51197002-51197024 GGCCCCGGAGGCGGCCGAGCTGG - Exonic
1160647568 19:200537-200559 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
1162058956 19:8083191-8083213 TGCACAGAAGGTGGCCAGGCTGG + Intronic
1163012338 19:14433714-14433736 TGCCGAGAAGGGGGCCTCGCTGG - Intronic
1163537247 19:17883841-17883863 TGCCCCCAGGGCGTCCTCGCGGG + Exonic
1163679243 19:18671222-18671244 AGCCCCGATGGCTGCCACACAGG - Exonic
1166364706 19:42272610-42272632 TTCCCGGTAGGCAGCCACGCCGG - Intronic
1166587265 19:43960653-43960675 TGCCCTGAATCCGGCCACTCTGG + Intronic
926321190 2:11749366-11749388 TGCCCCCTAGGAGGCCACACTGG + Intronic
928093812 2:28392340-28392362 GGCCCCGAGAGCGGCCGCGCGGG - Intergenic
929175499 2:38971413-38971435 TGCCCTGCAGTCGGCCACGGTGG + Intronic
929460932 2:42101622-42101644 TGGGCCGGGGGCGGCCACGCGGG - Intergenic
935904518 2:107827916-107827938 TGGCCCGGAGGCGGCCTCGATGG + Intronic
938408255 2:131044597-131044619 TGACCGGCAGGCGGCCAGGCAGG - Intronic
938583698 2:132669792-132669814 TGCCCCCAAGGCGCCCACCTCGG - Intronic
945119619 2:206443936-206443958 GGCCCCCAACGCGGCCCCGCCGG + Exonic
948426036 2:237887052-237887074 AGCCCCGAAGGCGGCCTCCTGGG + Intronic
1175871018 20:62209532-62209554 AGCCTCGAAGGCGGCCAGGACGG + Intergenic
1178263868 21:31124537-31124559 TGCACTGAAGGGGGCCAGGCCGG - Exonic
1183095438 22:35549162-35549184 TGCCCCGGAGGTGGCCACCCTGG + Intronic
1185340712 22:50289730-50289752 AGCCACGGAGGCGGCCAGGCAGG + Exonic
950546139 3:13639152-13639174 CGCCCAGAAGGCGGCCTTGCTGG - Intergenic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
961595277 3:128011177-128011199 TGACCCGAGGCCGGCCACCCTGG + Intergenic
963741584 3:149086702-149086724 CGCCCCCAAGGCGGGCGCGCGGG + Intergenic
968730926 4:2268858-2268880 AGCCCGGAAGGCGGCCACCGTGG + Intergenic
968761021 4:2442852-2442874 TGCCCCCAAGGCCACCGCGCAGG - Intronic
970332817 4:15002986-15003008 GCCCCCGAAAGCGGCCGCGCCGG - Exonic
973888447 4:55346312-55346334 AGCGCGGAAGGCGGGCACGCGGG + Exonic
979468619 4:121070849-121070871 CGCCCCGAAGGGGGCCAGGAGGG + Intronic
985064294 4:186105452-186105474 GGGCCCGAGGGCGGCCGCGCTGG - Intronic
985575027 5:669996-670018 TGCCCCAAAGCCGGCCCAGCAGG + Intronic
985778491 5:1857459-1857481 TCCCCCGAAGGCGGGGACGTCGG + Intergenic
989480465 5:41925177-41925199 TGCCCTGGAGGCGGACTCGCGGG + Intergenic
991377754 5:65984217-65984239 TGCCTGCAAGGAGGCCACGCTGG - Intronic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
1000318860 5:160118595-160118617 TGCCCCGCAGGCGCCCACCTGGG + Intronic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1002569332 5:180131112-180131134 TGCCCCCAATGCATCCACGCCGG + Intronic
1002729806 5:181326336-181326358 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004110444 6:12713037-12713059 TGCCCTGGAGACAGCCACGCTGG - Intergenic
1006727589 6:36211078-36211100 TGCCCAGAAGGCAGCCACAGGGG - Intronic
1013282919 6:108655710-108655732 TACACCGAAGGCGCCCACCCGGG + Intronic
1014256177 6:119161728-119161750 TGCCCAGAAAGCAGCCACCCTGG - Intergenic
1017793584 6:157822932-157822954 TTCCCCTGGGGCGGCCACGCAGG + Intronic
1019153444 6:170023787-170023809 CGCCCGGAAGGCGGCCCCACAGG - Intergenic
1019256441 7:55378-55400 TTCCCTGGAGGAGGCCACGCTGG + Intergenic
1022100293 7:27165322-27165344 TCCCCGGCAGGCGGCGACGCTGG - Exonic
1030215944 7:107044444-107044466 GGACACGAAGGCGGCCTCGCTGG + Intergenic
1032051522 7:128653457-128653479 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1035062215 7:156078006-156078028 TGCCCCGAAGGAGGTGATGCGGG - Intergenic
1041107869 8:54459230-54459252 TGAGCCGCAGGCGGCCGCGCTGG + Exonic
1041690056 8:60679281-60679303 GGCCCCGCGGGCGGCGACGCCGG - Intronic
1049223704 8:141439760-141439782 TCCCCCAAAGGCGGCATCGCAGG + Intergenic
1055632253 9:78236329-78236351 TGGCCCGAGGGCGGCCTCGGGGG - Exonic
1057140311 9:92722766-92722788 CATCCCGCAGGCGGCCACGCTGG + Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1062754218 9:138278848-138278870 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1203577778 Un_KI270745v1:21605-21627 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1185734495 X:2486649-2486671 TGCCCCGAGGCCGGGGACGCAGG - Exonic
1187900945 X:24025863-24025885 AGCCCCGACGGCGGCGCCGCGGG - Intronic
1192221222 X:69198603-69198625 TGCTCCAAAGGAGGCCATGCAGG + Intergenic