ID: 953910174

View in Genome Browser
Species Human (GRCh38)
Location 3:46888853-46888875
Sequence GGCGGCCACGCTGGCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 299}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953910167_953910174 -6 Left 953910167 3:46888836-46888858 CCACTGCCTGCCCCGAAGGCGGC 0: 1
1: 0
2: 1
3: 26
4: 203
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
953910162_953910174 7 Left 953910162 3:46888823-46888845 CCCAGGCTGCATCCCACTGCCTG 0: 1
1: 0
2: 0
3: 34
4: 530
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
953910165_953910174 -5 Left 953910165 3:46888835-46888857 CCCACTGCCTGCCCCGAAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
953910161_953910174 14 Left 953910161 3:46888816-46888838 CCGCTATCCCAGGCTGCATCCCA 0: 1
1: 0
2: 5
3: 32
4: 302
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
953910160_953910174 20 Left 953910160 3:46888810-46888832 CCAACTCCGCTATCCCAGGCTGC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
953910163_953910174 6 Left 953910163 3:46888824-46888846 CCAGGCTGCATCCCACTGCCTGC 0: 1
1: 0
2: 3
3: 40
4: 425
Right 953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953910174 Original CRISPR GGCGGCCACGCTGGCTGGCC AGG Intronic