ID: 953912099

View in Genome Browser
Species Human (GRCh38)
Location 3:46898442-46898464
Sequence GGCCAGGATGAGCACAGCTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953912099_953912121 30 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912121 3:46898495-46898517 CGGCGGGACATGGTGGAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 269
953912099_953912102 -10 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912102 3:46898455-46898477 CATCCTGGCCTACTTTAGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 145
953912099_953912119 28 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912119 3:46898493-46898515 GGCGGCGGGACATGGTGGAGGGG 0: 1
1: 0
2: 2
3: 31
4: 280
953912099_953912113 13 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912113 3:46898478-46898500 CGGGGCGGGGCGAGAGGCGGCGG 0: 1
1: 0
2: 18
3: 183
4: 1448
953912099_953912115 20 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912115 3:46898485-46898507 GGGCGAGAGGCGGCGGGACATGG 0: 1
1: 1
2: 2
3: 26
4: 327
953912099_953912110 0 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912110 3:46898465-46898487 TACTTTAGGTGGGCGGGGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 273
953912099_953912104 -7 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912104 3:46898458-46898480 CCTGGCCTACTTTAGGTGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 136
953912099_953912120 29 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912120 3:46898494-46898516 GCGGCGGGACATGGTGGAGGGGG 0: 1
1: 0
2: 2
3: 31
4: 330
953912099_953912117 26 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912117 3:46898491-46898513 GAGGCGGCGGGACATGGTGGAGG 0: 1
1: 1
2: 2
3: 38
4: 331
953912099_953912105 -6 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912105 3:46898459-46898481 CTGGCCTACTTTAGGTGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 101
953912099_953912116 23 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912116 3:46898488-46898510 CGAGAGGCGGCGGGACATGGTGG 0: 1
1: 1
2: 1
3: 18
4: 250
953912099_953912109 -1 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912109 3:46898464-46898486 CTACTTTAGGTGGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 385
953912099_953912114 14 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912114 3:46898479-46898501 GGGGCGGGGCGAGAGGCGGCGGG 0: 1
1: 1
2: 23
3: 167
4: 1475
953912099_953912112 10 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912112 3:46898475-46898497 GGGCGGGGCGGGGCGAGAGGCGG 0: 1
1: 9
2: 62
3: 608
4: 2712
953912099_953912106 -5 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912106 3:46898460-46898482 TGGCCTACTTTAGGTGGGCGGGG 0: 1
1: 0
2: 2
3: 6
4: 83
953912099_953912118 27 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912118 3:46898492-46898514 AGGCGGCGGGACATGGTGGAGGG 0: 1
1: 0
2: 0
3: 36
4: 285
953912099_953912108 -2 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912108 3:46898463-46898485 CCTACTTTAGGTGGGCGGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 200
953912099_953912111 7 Left 953912099 3:46898442-46898464 CCGTAGCTGTGCTCATCCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 953912111 3:46898472-46898494 GGTGGGCGGGGCGGGGCGAGAGG 0: 1
1: 2
2: 33
3: 327
4: 1985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953912099 Original CRISPR GGCCAGGATGAGCACAGCTA CGG (reversed) Exonic
900639349 1:3681384-3681406 GTCCAGGCAGAGCACAGCTGGGG - Intronic
900908381 1:5576721-5576743 GGCCAACATGAGCACAGATTGGG + Intergenic
901761871 1:11477117-11477139 GGCCAAGGTGGCCACAGCTATGG + Intergenic
902793991 1:18788327-18788349 GGGCAGGGTGAGCAGAGTTAAGG - Intergenic
903213550 1:21831338-21831360 GGGCAGGATGAGCACAGGGCAGG + Intronic
904036374 1:27561255-27561277 GGCCAAGATGAGCCGAGCTGTGG - Intronic
904267690 1:29326999-29327021 GGCCTGGATGGGGACAGCAATGG - Intergenic
904311231 1:29630917-29630939 GGAGAGGATGGGCACAGCTGCGG - Intergenic
904590526 1:31612795-31612817 GGACAGCATGAGCACAGGCATGG - Intergenic
904624861 1:31796732-31796754 GGCCAAGCTGAGCCCAGTTAGGG + Intronic
904843868 1:33393341-33393363 GGCCAGCATGGGCACAGATGAGG - Intronic
906960724 1:50418302-50418324 GAGCCGGATGAGCACAGCTAAGG + Exonic
907460406 1:54602176-54602198 GGCCAGGATCAGCACCCCAATGG - Intronic
912470874 1:109905904-109905926 GGCCAGGATGGGCAGAGATGGGG - Intergenic
912517117 1:110223451-110223473 GGCAAAGATGAGCACACCCAGGG - Exonic
915900194 1:159841183-159841205 GCCCAGGATGTGCACAGCTGTGG + Exonic
918087969 1:181261499-181261521 GGCCATGATGAGCTCAGCTGGGG + Intergenic
920651131 1:207838303-207838325 TGCCAGCCTGAGCACAGCTGTGG + Intergenic
922248778 1:223827183-223827205 AGCCTGGATGAGAGCAGCTAGGG + Intronic
923516908 1:234705459-234705481 GTCCAGGAAGAGCAGAGCTGAGG - Intergenic
1062843468 10:688596-688618 GACCAGGATGAGCCCAGAGACGG + Intronic
1063002987 10:1942078-1942100 TGCCAAGATGAGCCCAGCAATGG - Intergenic
1063565702 10:7171068-7171090 GGGCAGGAGGAGCTCAGCTGCGG + Intronic
1063709816 10:8466377-8466399 GGGCAGAAGCAGCACAGCTATGG + Intergenic
1069772496 10:70908451-70908473 GGCCAGGGTGAGCCCAGCCTAGG + Intergenic
1070580866 10:77718372-77718394 GGTCAGATTGAACACAGCTAAGG + Intergenic
1070768386 10:79069179-79069201 GGCCGGGAGGAGCGCAGCGAGGG - Exonic
1070890157 10:79937062-79937084 GGACAGGATGAGCTCATCTCTGG + Intergenic
1071525403 10:86355320-86355342 GGCCAGGCTGAGCACAGTGGGGG + Intronic
1072914872 10:99531511-99531533 GGGCCGGATGAGGACAGCCACGG + Intergenic
1074007554 10:109443549-109443571 GGCTGGGATGATCACAGCTTTGG - Intergenic
1075083496 10:119399059-119399081 GGCAAGGCTGAGCAGAGCTAGGG - Intronic
1076065383 10:127444092-127444114 GGACAGAAAGAGCACAGTTACGG - Intronic
1076539552 10:131205630-131205652 GGCCAGGATGTGCCCTGCCAAGG - Intronic
1076632002 10:131856977-131856999 GGGTAGGCAGAGCACAGCTATGG + Intergenic
1076723024 10:132400999-132401021 GGCCGGGAGGAGCACAGCCCTGG - Intronic
1076822290 10:132945506-132945528 GGCCAGGTGGAGCCCAGCTCTGG + Intergenic
1076942221 10:133617556-133617578 GGCCTCGATGAGGACTGCTATGG - Intergenic
1077662364 11:4081078-4081100 GGCCAGGAGGGCCTCAGCTAGGG - Intronic
1080297928 11:30751609-30751631 AGCCAAGATGAGCAGACCTAAGG + Intergenic
1082726290 11:56740794-56740816 GGCAAGGATGAGCACAGTAGGGG - Intergenic
1083319841 11:61838857-61838879 GGGCAGGACGAGCAGAGCTGGGG - Intronic
1091693159 12:2610705-2610727 TCCCAGGAGGAGCACAGCCATGG + Intronic
1093312242 12:17603576-17603598 AGCCAGGATGAGCCCAGAAAGGG - Intergenic
1094069498 12:26397310-26397332 GGCCAGGATAAGCAAAGTCATGG - Intronic
1094771730 12:33670675-33670697 TGCCAGGATGATGACTGCTAGGG + Intergenic
1096052372 12:48622368-48622390 GGCCAGGAGGAGGACAGCACAGG - Intergenic
1096449090 12:51722066-51722088 GGCCAGGAAGAACACAGAAATGG - Intronic
1096680779 12:53253782-53253804 GACGACGATGAGCACAGCAAGGG - Exonic
1096966695 12:55633537-55633559 GGCCTGGATGAGGACAGGGAGGG + Intergenic
1097033336 12:56105037-56105059 GACCAGGATGAGCGCAGAGAGGG + Intronic
1097505791 12:60468141-60468163 GGCCATGATGTCCCCAGCTATGG + Intergenic
1100790101 12:98120815-98120837 GGACAGGAAGAACACTGCTATGG + Intergenic
1101754267 12:107608513-107608535 GGCCAGTATGAGCAAAAGTATGG - Intronic
1103880174 12:124159961-124159983 GGTCAGGAAGAGCAGAGCTGTGG - Intronic
1104429546 12:128705471-128705493 GGCCAAGATGGGCACCTCTATGG + Exonic
1104819493 12:131666674-131666696 GGGAAGGGTGAGCACAGCCAGGG + Intergenic
1105327431 13:19382944-19382966 GGCCAGGTAGAGCACCGCCACGG - Intergenic
1105406231 13:20134810-20134832 CGCCAGGATGAGGACAGCCGAGG + Intergenic
1106001287 13:25725686-25725708 GGTCAGAATGTCCACAGCTAAGG - Intronic
1106412046 13:29517294-29517316 GGTGATGATGAGAACAGCTAAGG + Exonic
1109665708 13:65533165-65533187 AGCCAGGATGAGAATAGCTGGGG - Intergenic
1113343661 13:109451917-109451939 GGCCTGGAAAAGCACAGCTCTGG - Intergenic
1113900152 13:113792386-113792408 GGCCACGATGTGCAGGGCTAGGG - Intronic
1120454920 14:84718609-84718631 GGGCAGGAAGAGAACTGCTAAGG + Intergenic
1121456902 14:94044131-94044153 AGCCAGGAGGAGCAGAGCTGTGG - Intronic
1202935815 14_KI270725v1_random:86594-86616 GGGCAGGCTGAGCACAGCTGCGG + Intergenic
1126676306 15:51161783-51161805 GGAAAGGAGGTGCACAGCTAGGG - Intergenic
1127465878 15:59244240-59244262 GGCCAAGATGAGCATTGCCATGG - Intronic
1128616232 15:69112343-69112365 GGTCAGTATGAGCAAAGCCAAGG - Intergenic
1129034464 15:72641097-72641119 GCCCAGGATGAGGAGAGCCATGG + Intergenic
1129215418 15:74096119-74096141 GCCCAGGATGAGGAGAGCCATGG - Intergenic
1129392197 15:75226088-75226110 GCCCAGGATGAGGAGAGCCACGG + Intergenic
1129551264 15:76452256-76452278 GGCCAGGATCAGCAATGCAAGGG - Intronic
1132806616 16:1777960-1777982 GGCAGGGATGAGGACAGCTGGGG - Exonic
1133328828 16:4958549-4958571 GGCGAGGGTGAGCAAAGCTGCGG + Intronic
1133496908 16:6327153-6327175 GCCCATGATGACCACAGCTTTGG - Intronic
1135548502 16:23381044-23381066 GACCAGGATCAGGACAGGTAGGG - Exonic
1135569107 16:23534826-23534848 GGCCAGGAGGAGCAGGGCTTTGG - Intronic
1136079744 16:27844098-27844120 GGAAAGGAAAAGCACAGCTATGG - Intronic
1137491664 16:48938075-48938097 GGCCAGCAGGAGCACAGGTGGGG + Intergenic
1138582239 16:57949171-57949193 GGTCATGATGAGCACAGCAGGGG + Intronic
1139465514 16:67151824-67151846 GGCAAGGATGGGGACAGCTTGGG + Intergenic
1139672480 16:68501145-68501167 GGCCAAGATGAGAAAAGCAATGG + Intergenic
1140760349 16:78103587-78103609 GGCCAGGATGCTCACAGATCAGG - Intronic
1140865613 16:79058718-79058740 TGCCAGGATGCACACAGATACGG - Intronic
1143266436 17:5641569-5641591 GGGCAGGGGGAGGACAGCTAGGG - Intergenic
1144669763 17:17126418-17126440 GGACAGGATGGGGACAGCTGCGG - Intronic
1144804319 17:17954184-17954206 GGCCATGCTGAGCACAGAAAAGG + Intronic
1158376361 18:56873733-56873755 TGCTTGGATGAGCACAGCTCTGG - Intronic
1160663869 19:313781-313803 GCCCAGGAGGAGCACAGGGATGG - Intronic
1161219554 19:3112241-3112263 GGCTGGGATAAGCACACCTAGGG - Intronic
1162432378 19:10636682-10636704 GGCCAGGATGAGCGCGCCAAAGG - Exonic
1164501807 19:28826702-28826724 GCCCAGGATGAGAACAGACAGGG + Intergenic
1166365355 19:42275468-42275490 GGCCAGAAGGAGCACAGCCTAGG + Intronic
1167797593 19:51719806-51719828 GCCCAGGATGAGCAGGGCGAAGG + Exonic
1168094779 19:54108228-54108250 TGCCAGGATGAGGGCAGCCAGGG - Exonic
932049406 2:68383815-68383837 GGTCAGGATCAGCAAGGCTAAGG + Intronic
933023692 2:77226277-77226299 GGGTAAGATGAGCACAGGTACGG + Intronic
934041114 2:88128197-88128219 GAACAGGATGGGCACAGCAAAGG + Intergenic
934166384 2:89297846-89297868 GGGCAGGCTGGGCACAGCTGCGG + Intergenic
934200892 2:89884610-89884632 GGGCAGGCTGGGCACAGCTGCGG - Intergenic
934790967 2:97059810-97059832 GGGCAGGCTGGGCACAGCCACGG - Intergenic
934815482 2:97322720-97322742 GGGCAGGCTGGGCACAGCCACGG + Intergenic
934822213 2:97385763-97385785 GGGCAGGCTGGGCACAGCCACGG - Intergenic
934847249 2:97669782-97669804 GGCAAAGATGAGCAGAGCCATGG + Intergenic
935727951 2:106040100-106040122 AGACTGGATGAGCACAGCTGTGG + Intergenic
935934496 2:108166965-108166987 GACCAGGTTGAGACCAGCTAGGG + Intergenic
940711241 2:157165456-157165478 GGCAATGATGAGCTCAGCGAGGG - Intergenic
947868282 2:233416903-233416925 GCCCAGGAGGAGCACAGCCCTGG + Intronic
949014800 2:241702855-241702877 GCCCGGGATGGGCACAGCTTTGG + Intronic
1170211116 20:13847086-13847108 GACCAGGATGAGAACAGAGAGGG - Intergenic
1170810675 20:19671832-19671854 GGTCAGGATGAGGTCACCTAGGG + Intronic
1170930543 20:20766508-20766530 GGCCAGGAAGAGCCAAGCTCAGG + Intergenic
1171978546 20:31610800-31610822 GGCCAGGAGGAGCACAGGGAGGG + Intergenic
1172057560 20:32165024-32165046 GACCAGGAAGGGCACAGCTGTGG + Intronic
1172606243 20:36216157-36216179 GGCCACCAGGAGGACAGCTATGG + Intronic
1175527605 20:59646233-59646255 GGCCAGAGTGAGCCCAGCTCTGG - Intronic
1176044838 20:63087178-63087200 GGCCGGGGTGAGCCCAGCTGTGG + Intergenic
1176168859 20:63688196-63688218 ATCCAGGATGGGCACAGCTGGGG - Intronic
1178728354 21:35075831-35075853 TGTCAGGATGAGCAAAGCTGGGG + Intronic
1179731594 21:43370996-43371018 GGCCAGGATGGGAAGAGGTAGGG + Intergenic
1181403836 22:22667993-22668015 GGCCAGGCTCAGCAGAGCTGTGG - Intergenic
1181406161 22:22686430-22686452 GGCCAGGCTCAGCAGAGCTGTGG - Intergenic
1181414112 22:22747090-22747112 GGCCAGGCTCAGCAGAGCTGTGG - Intronic
1181431121 22:22882477-22882499 AGCCAGGGTGAGCACAGGGAGGG - Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182071028 22:27463819-27463841 GGCCAGGAGCAGCAGAGCCAGGG + Intergenic
1182302141 22:29342895-29342917 GGCCAGGATGAGGGCAGCTTTGG - Intronic
1182311575 22:29412435-29412457 GGGCAGGGTGAGCTCAGCAAAGG + Intronic
1182369369 22:29800135-29800157 GGCCATAGTGAGCACAGCAAAGG - Intronic
1183434119 22:37783449-37783471 GGCCAGGATGGCCAGAGCTAGGG - Intergenic
1183441372 22:37824950-37824972 GGCCAGGCTCACCACAGCCACGG - Exonic
1183706640 22:39478534-39478556 GGCCAGGGTGAGGCCAGCCAAGG + Intronic
1184257903 22:43297407-43297429 ACCCAGCATGAGCACAGCTCTGG + Intronic
1184478011 22:44731857-44731879 GGCCAGGGTGGGCACAGCAGGGG - Intronic
1184546557 22:45173577-45173599 GGCAAGGATGGGCACAGCTCCGG + Intronic
1185312142 22:50162083-50162105 GGCCAGGAGGAGCAGAGCAGTGG + Intergenic
950096298 3:10332753-10332775 GGCCAGGGTGACCACAGCAAGGG - Intronic
950756702 3:15179096-15179118 GGCCAGGATGGGCCCAGATGGGG - Intergenic
951017403 3:17745474-17745496 GGCCAGTAGGAGCACAGCTAGGG - Intronic
951757079 3:26102829-26102851 GGCCAGGTTGAGGACAGGGAAGG - Intergenic
953005213 3:38971526-38971548 GTCCAGCAGGAGCACAGATATGG - Intergenic
953109559 3:39920799-39920821 TGCTAGGATGAGCACTGCTTTGG - Intronic
953500753 3:43431652-43431674 GGCAAACATGAGCACAGCTATGG + Intronic
953912099 3:46898442-46898464 GGCCAGGATGAGCACAGCTACGG - Exonic
953923524 3:46968298-46968320 GGCTAGGATGAGTAAAGCCAGGG + Intronic
954698945 3:52441782-52441804 GGCCAGGGTGAGAACAGGGAGGG - Intronic
954807124 3:53227036-53227058 GGCAAGCATGAGCTCAGCCATGG - Intronic
955878490 3:63519488-63519510 GGCAACAAGGAGCACAGCTATGG - Intronic
957781493 3:84823153-84823175 GGACAGGATAAGCAAAGGTAAGG - Intergenic
958864371 3:99483958-99483980 GGACTGTATGAGCACAGCTGAGG + Intergenic
960087972 3:113611107-113611129 GACCATGATGACCACAGCAAAGG - Exonic
961685238 3:128625400-128625422 GGCAAGGATGAGCACAGGCAGGG + Intronic
964554156 3:157917444-157917466 AGCCAGGAAGAGCAAAGGTAGGG + Intergenic
967441310 3:189512391-189512413 TTCCAGGTTGAGAACAGCTATGG + Intergenic
968449824 4:669836-669858 GGCCAGGATGAGCATAATCAGGG + Intronic
968453920 4:687787-687809 GGCCAGGCGGAGCAGAGCTTGGG - Intronic
968943092 4:3649324-3649346 CGCCAGGATGAACACAGGGAAGG - Intergenic
969212940 4:5701600-5701622 GGCCTGGATGAGCTCACCTCAGG - Intronic
969217828 4:5736134-5736156 GGCCAGGATGAGAACAGATTGGG + Intronic
969292548 4:6249302-6249324 GGCCAGGATGGGAACTGCCAGGG + Intergenic
969599418 4:8167119-8167141 GGACAGGCTGAGCTCAGCCAGGG - Intergenic
972686831 4:41360532-41360554 GGGGAGGGGGAGCACAGCTACGG - Intronic
972850739 4:43047290-43047312 GGAGAGCATGTGCACAGCTAGGG - Intergenic
979716434 4:123844397-123844419 GGCCAGGATGAGCACTTGTGGGG + Intergenic
985759356 5:1737233-1737255 GACCAGGATGTGCAAAGCTGAGG + Intergenic
985977341 5:3430555-3430577 TGCCAGCATGGGCACAGCTGGGG - Intergenic
986168789 5:5298542-5298564 GGCCAGGATCAGCAGAACTTGGG - Intronic
986575798 5:9211573-9211595 GAACAGCCTGAGCACAGCTAGGG - Intronic
987103861 5:14617601-14617623 GGCCTGGATTAGCAGAGCCATGG + Intergenic
989544167 5:42653420-42653442 GGCCCGGATGAGCAAACCTGGGG - Intronic
990476416 5:56165375-56165397 GGCCAGGATGAGCACCAGTGGGG + Intronic
991665019 5:68990879-68990901 GGACTGGATGAGCTCATCTAGGG - Intergenic
994368818 5:98946499-98946521 ATACAGGATGAGGACAGCTAGGG - Intergenic
998349364 5:141490977-141490999 AGCCAGGAGGAGCAGAGCGAGGG - Exonic
998715001 5:144873062-144873084 GGACTGGATGAGAACAGCCAGGG + Intergenic
999980656 5:156954678-156954700 GACCAGGATGAGTACAGACAGGG + Exonic
1001985600 5:176072630-176072652 GGCCTCGATGAGGACGGCTAGGG - Intronic
1001985979 5:176074747-176074769 GGCCTTGATGAGGACGGCTAGGG - Intronic
1002230891 5:177763377-177763399 GGCCTTGATGAGGACGGCTAGGG + Intronic
1002231272 5:177765494-177765516 GGCCTCGATGAGGACGGCTAGGG + Intronic
1002264066 5:178018254-178018276 GGCCTCGATGAGGACGGCTAGGG - Intronic
1002264446 5:178020371-178020393 GGCCTTGATGAGGACGGCTAGGG - Intronic
1002349144 5:178570736-178570758 GGCCAGGCTGAGCACATGGAGGG + Intronic
1002695622 5:181086427-181086449 AGCCAGGGTGGGCACAGCTTGGG + Intergenic
1004294492 6:14397810-14397832 GCCCAGGATGAGCCCAGGTCGGG - Intergenic
1005375810 6:25181243-25181265 GGCCAGGACGAGGACAGGGAAGG - Intergenic
1006670606 6:35727841-35727863 CGCCTGGATTAGCACAGCTGGGG - Intronic
1006730113 6:36230329-36230351 GGCCAGGACCAGCAAAGCCAGGG - Intronic
1006923190 6:37639472-37639494 GGCCAGGAGAAGGACAGCGATGG - Intronic
1007839067 6:44700936-44700958 GCCAAGGATGATCAGAGCTATGG - Intergenic
1008698990 6:54076220-54076242 GGTCAGGATGAGGAAACCTAAGG + Intronic
1008836012 6:55831114-55831136 TGCCAGGATGTCGACAGCTAGGG + Intronic
1015920583 6:138262789-138262811 GCCCTGGATGAGCTCAGCCAGGG + Exonic
1016536204 6:145109545-145109567 GTCCAAGATGACCACAGCTCAGG - Intergenic
1018632548 6:165833657-165833679 AACCAGGCTGAGCACAGCCAGGG + Intronic
1019714584 7:2532630-2532652 GTCCAGGATGGCCTCAGCTAGGG - Intergenic
1019741735 7:2678423-2678445 GTCCAGGATGGCCTCAGCTAGGG + Intergenic
1019804440 7:3112968-3112990 GACCAGGGTGACCACAGCTTTGG + Intergenic
1026629045 7:72021721-72021743 GGCAAGGATGAGCTCACCGAGGG - Intronic
1026875526 7:73877112-73877134 GGCCAGGCTGAGCCCAACTGGGG - Intergenic
1032097805 7:128948130-128948152 AGCCAGGAGGATCACAGCTTTGG - Intronic
1033030015 7:137817145-137817167 GGTCAGCATAAGCACAGGTATGG - Intronic
1034692082 7:153021901-153021923 GGCCAGGTTGAACACAGCTTGGG + Intergenic
1035588589 8:796178-796200 GTCCAGTGTGAGCACAGCTTTGG + Intergenic
1035956110 8:4081543-4081565 GGTCAACATGAGCACAGCTTCGG - Intronic
1037587049 8:20284330-20284352 TAACAGGATGAGCACAGCCAAGG + Intronic
1037824880 8:22155186-22155208 GGGCAGCAGGAGGACAGCTAGGG - Intronic
1040665516 8:49627005-49627027 TGCCAGGATTAGCAGATCTACGG + Intergenic
1040867980 8:52070168-52070190 GGCCAGGATGAGTAAGGCCAGGG + Intergenic
1041399690 8:57428881-57428903 GGCCCTGATGTGCACAGATAAGG + Intergenic
1041429386 8:57761864-57761886 GCCCAGGATGAGAACAGCATGGG - Intergenic
1042892716 8:73630908-73630930 TGCCAGCATAACCACAGCTAAGG - Intronic
1044714507 8:95088227-95088249 CGCCAGGATGGGCATAGCTGTGG - Intronic
1045220788 8:100197921-100197943 GGCCAGGATGATTACACCTGGGG + Intronic
1048302240 8:133260246-133260268 GGCCAGGAGGAGCCCAGCCAGGG + Intronic
1049253953 8:141604142-141604164 GGACAGGATGAGCCCAGGTGAGG + Intergenic
1049400384 8:142424104-142424126 GCCCAGGGTGAGGACAGCCAGGG + Intergenic
1050153675 9:2643234-2643256 GGCCAGGATGACTGCAGCGATGG + Exonic
1050160833 9:2717604-2717626 AGCCCGGACCAGCACAGCTAGGG - Exonic
1054807794 9:69410126-69410148 AGCCAGGATGAGCCCAGAGAAGG + Intergenic
1057057042 9:91971329-91971351 GGCCAGTATCAGCACAGCTGCGG - Intergenic
1059287015 9:113182715-113182737 GGTCAGGATGGGTAGAGCTAAGG - Intronic
1060825970 9:126688365-126688387 GGCCAGGGTCAGCACACCTTGGG - Intronic
1061368869 9:130186861-130186883 AGCCAGGCTGAGCACAGCACGGG - Intronic
1062173485 9:135148238-135148260 GCCCAGGATGAGGACAGCAGGGG + Intergenic
1062265230 9:135683825-135683847 GGCCAAGGTGAGCACAGCATGGG + Intergenic
1062715922 9:138010034-138010056 GGCCAGGTTGTCCACAGCGATGG - Exonic
1186780070 X:12903423-12903445 GCCCAGGATTTGCAAAGCTAAGG + Intergenic
1187477797 X:19627242-19627264 GGGCAGAATGAGCCCAGCTGTGG - Intronic
1189280983 X:39820180-39820202 GACCAGGATGGGCACAGAAATGG + Intergenic
1190328675 X:49222557-49222579 GGCCAGGTTGTCCACAGCAATGG + Exonic
1190588793 X:51975914-51975936 GGTGAGAATGAGCACTGCTAGGG - Intergenic
1195688476 X:107605314-107605336 GCCCAGGATGAGCACACAAAGGG - Intergenic
1196373359 X:115002699-115002721 GGCAATGATGAGCACAGCTGTGG + Intergenic
1200083727 X:153592566-153592588 GGCCAGGTAGAGCACCGCCACGG + Exonic
1201355957 Y:13097301-13097323 AGCCAGGATGAGCCCAGAGAAGG - Intergenic
1202604396 Y:26626665-26626687 GGCCAGGTAGAGCACTGCCACGG + Intergenic