ID: 953912179

View in Genome Browser
Species Human (GRCh38)
Location 3:46898788-46898810
Sequence CGCGCAGCTCCTCCTCGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953912179_953912190 20 Left 953912179 3:46898788-46898810 CCTCACCGAGGAGGAGCTGCGCG 0: 1
1: 0
2: 0
3: 13
4: 96
Right 953912190 3:46898831-46898853 CCGCCTGCCACCGCCGCTGCCGG 0: 1
1: 0
2: 1
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953912179 Original CRISPR CGCGCAGCTCCTCCTCGGTG AGG (reversed) Exonic
900191862 1:1355444-1355466 CTCGCTGCTCATCCGCGGTGCGG - Exonic
900522542 1:3112711-3112733 CGGGCAGCTGCTCCCCGGTGAGG + Intronic
901954548 1:12774942-12774964 TGGGCAGCTCCTCCAGGGTGGGG - Exonic
904090542 1:27941906-27941928 CGGGCAGCTCCACCTCCTTGGGG - Intronic
905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG + Intronic
919667045 1:200302321-200302343 CGCGGAGCTGCGCCACGGTGAGG - Intergenic
919770308 1:201154275-201154297 CCCGCAGCTCCTCCCCGCTCGGG + Exonic
920035695 1:203063950-203063972 CCCGCAGGTCCTTCTTGGTGAGG - Exonic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
924774509 1:247106467-247106489 CCTGAAGCTCCTCCTCAGTGTGG - Intergenic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1064622543 10:17229866-17229888 CCCGCATCTCCTCCTCGTAGAGG - Exonic
1065239857 10:23694676-23694698 CGCGCCGCTCCTCCGCGGGGTGG + Intergenic
1067082899 10:43221617-43221639 GGGGCAGCTCCTCCTGGGTCAGG - Intronic
1067456344 10:46421834-46421856 CACGCAGCCCCTCCTGGGAGTGG - Intergenic
1067478347 10:46580261-46580283 CAGGCAGCTCCTCATAGGTGAGG - Exonic
1067616391 10:47761526-47761548 CAGGCAGCTCCTCATAGGTGAGG + Intergenic
1067630855 10:47962805-47962827 CACGCAGCCCCTCCTGGGAGTGG + Intergenic
1072241125 10:93496540-93496562 CGCGCTGCTCCTCCTTCTTGCGG + Intergenic
1073201507 10:101739415-101739437 CGTGCAGCCTCTCCTCTGTGTGG - Intergenic
1075184235 10:120240591-120240613 CACTCAGCTTCTCCTAGGTGAGG - Intergenic
1076374355 10:129973216-129973238 CGCGGGGCTCCTCCGCGGGGAGG + Intergenic
1076680709 10:132169863-132169885 TTCGCACCTCCTCCTCGCTGCGG - Exonic
1076900500 10:133335384-133335406 AGCGCAGCTCCTCCTGGCGGGGG - Intronic
1077311094 11:1889429-1889451 CGGGCACCTCCTGCTCTGTGGGG + Exonic
1084598916 11:70133403-70133425 CGAGCAGCTGCTCCTTGGTCAGG - Intronic
1085295707 11:75430491-75430513 CGCGCAGCACCACGTCGGTGAGG + Exonic
1089213447 11:116821397-116821419 GGCGCAGCTCCTCCACGGTCTGG + Exonic
1090363999 11:126191285-126191307 CACACAGCTTCTCCTCGGTGTGG - Intergenic
1096472412 12:51888028-51888050 CGGGCAGCTCCTCCCCGCCGGGG - Exonic
1103386306 12:120534918-120534940 CGCCCCGCTCCGCCTCGGCGGGG + Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1107412634 13:40172214-40172236 CGCGCAGCTCCCCCTCTGGAGGG - Intergenic
1108356244 13:49630915-49630937 CGGGCAGCCCCTCCCCAGTGAGG - Exonic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1202906012 14_GL000194v1_random:72882-72904 CGCCCCGCTCCTCCTCGGAAGGG - Intergenic
1124658150 15:31524973-31524995 GGCGAAGCTCCTCCTGGATGGGG + Intronic
1125483022 15:40093350-40093372 GGCGCAGCTCCTGCCCGGAGGGG + Intronic
1126467678 15:48975885-48975907 GGCGCAGCGCCCCCTCGGTGCGG + Intergenic
1128676853 15:69615971-69615993 CACCCAGCTCCTCCTAGGTCTGG - Intergenic
1130108093 15:80943943-80943965 CCCACATCGCCTCCTCGGTGAGG + Intronic
1136535397 16:30896464-30896486 AGCTCAGCTCCTCGTCCGTGGGG - Intergenic
1137406363 16:48192597-48192619 CGCCCTGCTCCTCATCTGTGTGG - Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1142382245 16:89739521-89739543 GGGGCGGCTCCTCCTCCGTGTGG - Exonic
1145234586 17:21199763-21199785 CCCCCAGCTCCTCCCCGCTGCGG + Intronic
1151657711 17:75503410-75503432 CCTGCAGCTCCTCCCAGGTGAGG + Exonic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1161013191 19:1969943-1969965 CGGGGAGCTCCGCCTAGGTGAGG + Exonic
1165070914 19:33254408-33254430 TGCGCAGATCCTCCACAGTGGGG - Intergenic
1165328360 19:35126853-35126875 CGGGCAGCTCTTCCTCGGGCCGG + Exonic
1166043808 19:40217997-40218019 GGCGCCGCTGCTCCTCGCTGAGG + Exonic
1166817243 19:45553705-45553727 CACGCTGCTCCTCCTCCTTGTGG + Intronic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
927486182 2:23489825-23489847 TGGGCACCTCCTCCTTGGTGTGG - Intronic
927497970 2:23563374-23563396 TGCACAGCCCCTGCTCGGTGAGG - Intronic
946133889 2:217629514-217629536 AGCCCAGCTCCTGCTCTGTGGGG - Intronic
948402152 2:237692127-237692149 CACGCAGTTCCGCCTCGGAGGGG - Intronic
948944693 2:241213602-241213624 CGCACAGCCCCTCCTGGGTGAGG + Intronic
1172013830 20:31861612-31861634 CGCGCAACTCCTCCTCGTCGCGG + Exonic
1172272769 20:33663813-33663835 TGCGCGGCTGCTCCTCGGCGGGG - Exonic
1172347636 20:34216291-34216313 CGCGCGGCACCTACTCGGAGAGG - Intronic
1172914704 20:38434940-38434962 CGCGCAGCTACTCTGCGGGGAGG - Intergenic
1174274764 20:49395749-49395771 CACGCATCACCTCCTCAGTGAGG - Intronic
1175173394 20:57094740-57094762 CGGGCAGCTCCTGATGGGTGAGG + Intergenic
1176110467 20:63408457-63408479 CGGGCAGCTCCGCCTCGGCCGGG + Exonic
1179552618 21:42153185-42153207 CGAGCTGCTCATCCTCTGTGAGG - Intergenic
1180950368 22:19718144-19718166 CGCGCAGCACCTCTTGGGGGCGG + Intronic
1181345754 22:22219566-22219588 TGACCAGCTCCTCCTCGCTGAGG + Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185276290 22:49951431-49951453 CACGCAGCTCCTCCTGGCCGCGG - Intergenic
949667440 3:6356502-6356524 CCCGCAGCTTCTCCTCGGAGTGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954152016 3:48662529-48662551 CCCCCAGCTCCTCCTGGCTGAGG + Exonic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
962318150 3:134371370-134371392 AGCGCAGCTGCTCCTGGATGAGG + Exonic
968736395 4:2298951-2298973 CGCGCTGCTCCTCTGTGGTGGGG - Intronic
969365109 4:6689778-6689800 CGGGCAGCTCTGCCTGGGTGCGG + Intergenic
969658125 4:8509676-8509698 AGCGCCGCCCCTCCTGGGTGTGG - Intergenic
973820353 4:54657631-54657653 CGGGCAGCACCTCCTTGGTCCGG + Intergenic
975661089 4:76689604-76689626 CGCGCGCCGCCTCCTCGGAGCGG + Intronic
977906524 4:102483439-102483461 GGCGGTGCTCCTCCTCGGGGAGG - Intergenic
985129297 4:186724682-186724704 CGCGGAGCCCATCCCCGGTGCGG + Intronic
1009320773 6:62286035-62286057 CGCGCTGCTCCTCCTCCGCGCGG + Exonic
1013429081 6:110040019-110040041 GGCGCAGCTGCTCTTCGGAGAGG - Intergenic
1018023837 6:159789203-159789225 GGCGGGGCTCCTCCTCGCTGTGG + Intronic
1019916064 7:4133496-4133518 CACACAGCTCCTTCTGGGTGGGG + Intronic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1031993136 7:128210840-128210862 CTGGCAGCTGCTCCTCGCTGTGG - Intergenic
1039484271 8:37899105-37899127 CCCGCAGGTCCACCTCGGCGCGG + Exonic
1042215829 8:66429140-66429162 CGAGCAGCTCCTCCACGCTCTGG - Exonic
1042589504 8:70383268-70383290 GGTCCAGCTCCTCCTTGGTGAGG - Intronic
1047381982 8:124372457-124372479 CGCGCCGCTCCTCCTCAGCCGGG - Exonic
1047731959 8:127735691-127735713 CGCGCAGTGCGTTCTCGGTGTGG + Intronic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049807728 8:144548474-144548496 CACGCAGGACCTCCTCGCTGCGG - Exonic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1054357002 9:64071360-64071382 CGCCCCGCTCCTCCTCGGAAGGG - Intergenic
1054368687 9:64369135-64369157 CGCCCCGCTCCTCCTCGGAAGGG - Intergenic
1054528032 9:66153372-66153394 CGCCCCGCTCCTCCTCGGAAGGG + Intergenic
1056754844 9:89375172-89375194 CAGGAAGCTCCTCCTCGGTGGGG - Intronic
1058012999 9:99999020-99999042 GGCGCAGCTGCTCCTTGGTGAGG + Intronic
1058835370 9:108855117-108855139 GGCCCAGCTCCTCCTCGGGCAGG + Exonic
1061178306 9:129010191-129010213 CGCGGAGCTCCTGCTCGGCCTGG + Exonic
1061727439 9:132589502-132589524 CGCGCCGCGCAGCCTCGGTGAGG + Exonic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1062368106 9:136221560-136221582 CGCCAGGCTCCTCCTAGGTGCGG + Intronic
1203748541 Un_GL000218v1:58099-58121 CGCCCCGCTCCTCCTCGGAAGGG - Intergenic
1203561179 Un_KI270744v1:59921-59943 CGCCCCGCTCCTCCTCGGAAGGG + Intergenic
1189268088 X:39731512-39731534 CACCCAGCTCCTCCCTGGTGGGG - Intergenic