ID: 953912411

View in Genome Browser
Species Human (GRCh38)
Location 3:46899674-46899696
Sequence CCTGAATTGAGGCTCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953912405_953912411 9 Left 953912405 3:46899642-46899664 CCAGGGATCAGGTTCACCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 178
Right 953912411 3:46899674-46899696 CCTGAATTGAGGCTCGGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 127
953912407_953912411 -7 Left 953912407 3:46899658-46899680 CCTGAGGTTAGATTCACCTGAAT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 953912411 3:46899674-46899696 CCTGAATTGAGGCTCGGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953912411 Original CRISPR CCTGAATTGAGGCTCGGCCC AGG Intronic
903367763 1:22815495-22815517 CCTGAGGTGGGGCTGGGCCCAGG + Intronic
904384858 1:30134593-30134615 CCTGAATCCTGGCCCGGCCCTGG + Intergenic
904921146 1:34009334-34009356 CCTGAATTGAGGGTCGGGGGTGG + Intronic
905440830 1:37995970-37995992 CCTGCAGCGAGGCCCGGCCCTGG - Intergenic
906157536 1:43622544-43622566 CCTGAGCGGAGGCTCGGCCGTGG + Exonic
906627239 1:47334713-47334735 CCAGCCCTGAGGCTCGGCCCGGG + Intronic
907479791 1:54737511-54737533 CCTTAGTTGAGGCTAAGCCCAGG - Intronic
911409828 1:97489041-97489063 CCCAAATTGGGGCTCAGCCCGGG - Intronic
911960967 1:104301812-104301834 CCTGAACTGAGTCCCAGCCCTGG + Intergenic
914343223 1:146777266-146777288 CCAGGATTGAGGATCTGCCCAGG - Intergenic
915427081 1:155835840-155835862 CCCAAATTGGGGCTCAGCCCAGG - Intronic
915428667 1:155848224-155848246 CCAAAATTGGGGCTCAGCCCAGG - Intronic
915815524 1:158961762-158961784 CCTGAGTGGTGGCTCTGCCCAGG - Intronic
916069079 1:161159624-161159646 CCTGAACTGGGGCCTGGCCCTGG + Exonic
916408878 1:164525228-164525250 CCAAAATTGGGGCTCAGCCCAGG - Intergenic
919270466 1:195336779-195336801 CCCAAATTGAGGCTCATCCCAGG + Intergenic
919742278 1:200988394-200988416 CCCAAATTCAGGCTCAGCCCTGG + Intronic
920059336 1:203216845-203216867 CCAGCTTTGAGGCTGGGCCCAGG - Exonic
922517050 1:226215359-226215381 CCTCCTTTCAGGCTCGGCCCTGG + Intergenic
922602011 1:226863574-226863596 CCTGAACTGAGGCCAGGCCCAGG + Intergenic
924864501 1:247963005-247963027 GCAAAATTGAGGCTCAGCCCGGG + Intronic
1067859894 10:49835070-49835092 CCTGATTCAAGGCTCTGCCCTGG - Intronic
1071092458 10:81934912-81934934 AGTTAATTGAGGCTTGGCCCTGG - Intronic
1083982402 11:66183609-66183631 CCAGAATTGGGGCTTAGCCCAGG + Intronic
1089597807 11:119592818-119592840 CCAAAATTGGGGCTCAGCCCGGG - Intergenic
1096510941 12:52127958-52127980 CCTTGATTGAGGGTGGGCCCAGG + Intergenic
1097267742 12:57755599-57755621 CCGGGGTTGCGGCTCGGCCCGGG - Exonic
1097530817 12:60797797-60797819 CCTGAATTACTGCTCAGCCCTGG + Intergenic
1098898933 12:76092853-76092875 CCAGAATTGAGGCTTAGTCCTGG - Intergenic
1103982591 12:124746207-124746229 TCTGAATGCAGGCTCAGCCCAGG - Intergenic
1104437018 12:128764681-128764703 CCTGGCTTGAGGCTCAGCCAGGG + Intergenic
1104754662 12:131261669-131261691 CCCTAATTCAGGCTCGGCCCTGG + Intergenic
1104754668 12:131261692-131261714 CCCTAATTCAGGCTCAGCCCTGG + Intergenic
1107306889 13:39031584-39031606 CTTCAACTGGGGCTCGGCCCAGG + Exonic
1110603146 13:77399581-77399603 TCAAAATTGAGGCTCAGCCCAGG - Intergenic
1113766760 13:112886280-112886302 CCTGAGTTGAGCCTTGGCCAGGG + Exonic
1122286189 14:100654201-100654223 CCTGAGTCTCGGCTCGGCCCAGG + Intergenic
1122790262 14:104181400-104181422 CCTGGATGGAGGCTCTTCCCTGG + Intergenic
1123155331 14:106219221-106219243 CATGGATGGAGGCTCTGCCCTGG + Intergenic
1123206757 14:106720913-106720935 CGTGGATGGAGGCTCTGCCCTGG + Intergenic
1123211779 14:106767918-106767940 CGTGGATGGAGGCTCTGCCCTGG + Intergenic
1123401992 15:19996348-19996370 CATGGATGGAGGCTCTGCCCCGG + Intergenic
1123578166 15:21693783-21693805 CATGGATGGAGGCTCTGCCCCGG + Intergenic
1123614791 15:22136265-22136287 CATGGATGGAGGCTCTGCCCCGG + Intergenic
1125275087 15:37980354-37980376 CCTGAGTGGTGGCTCTGCCCAGG + Intergenic
1129054494 15:72809247-72809269 CCTGAAGTGAGGCTCTGTCTGGG + Intergenic
1131515278 15:93072857-93072879 CCAGCATTGAGGGGCGGCCCAGG + Intronic
1202987036 15_KI270727v1_random:428028-428050 CATGGATGGAGGCTCTGCCCCGG + Intergenic
1134275401 16:12771568-12771590 CCAGGATTGAGGCTCTGGCCAGG - Intronic
1137772782 16:51030403-51030425 CCTAAATTGAGGCTTAGCCCAGG + Intergenic
1139205353 16:65023427-65023449 CCAAAATTGAGGTTCAGCCCGGG + Intronic
1139990768 16:70938061-70938083 CCAGGATTGAGGATCTGCCCAGG + Intronic
1140024840 16:71277190-71277212 CCAAAATTGGGGCTCAGCCCAGG - Intergenic
1141886916 16:86898632-86898654 CCTGCGCTGAGGTTCGGCCCAGG + Intergenic
1145393016 17:22470579-22470601 CCTGCATTGAGGTGCGGCTCTGG + Intergenic
1146650942 17:34605949-34605971 CCTGATTTGAGGCTCAGTCATGG - Intronic
1151463705 17:74271156-74271178 CCCAAATTGAGGCTTAGCCCGGG + Intergenic
1152512202 17:80798078-80798100 CCTGAGTTGACGCTGGGACCAGG + Intronic
1161102977 19:2430439-2430461 CCAGAATGCAGGCTTGGCCCCGG + Exonic
1161861749 19:6803069-6803091 CCTAAATTGGGGCTCAGCCTGGG + Intronic
1164303550 19:23983135-23983157 CCTGTATTTGGGCTGGGCCCCGG + Intergenic
1165280554 19:34793632-34793654 CCAGAATTGGGGCTTGGCCCAGG + Intergenic
1167181066 19:47903785-47903807 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167181734 19:47909144-47909166 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167182384 19:47914534-47914556 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167183051 19:47919886-47919908 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167184349 19:47930286-47930308 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167185021 19:47935637-47935659 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167185673 19:47941026-47941048 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167186340 19:47946384-47946406 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167186991 19:47951772-47951794 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167187641 19:47957155-47957177 CCAAAATTGAGGCTTAGCCCGGG - Intergenic
1167542200 19:50096477-50096499 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167542636 19:50099542-50099564 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167543072 19:50102607-50102629 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167543508 19:50105670-50105692 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167544181 19:50111014-50111036 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167544856 19:50116367-50116389 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167545531 19:50121719-50121741 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167546207 19:50127047-50127069 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167546884 19:50132382-50132404 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1167547542 19:50137755-50137777 CCAAAATTGAGGCTTAGCCCGGG + Intergenic
1168266762 19:55227672-55227694 CCTGCAAGGAGGCTCGGCCAGGG - Intronic
1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG + Intronic
931731622 2:65158735-65158757 TCTTAATTGAGGCTTGGCTCCGG + Intergenic
932812336 2:74835239-74835261 CCGGAACTGAGGCTCGGCGAGGG + Intronic
933970291 2:87464419-87464441 GCTGAGCTGAGGCTCAGCCCTGG - Intergenic
937363357 2:121244177-121244199 CCTGCATGCAGGCTCGGCCATGG - Intronic
938248696 2:129797640-129797662 CCTGAATTCTGGCTGGGCCCTGG - Intergenic
938265778 2:129927212-129927234 CCTGAATTGATGGGAGGCCCTGG + Intergenic
938341709 2:130540396-130540418 CCAGGATGGAGGCTCTGCCCAGG - Intronic
938348120 2:130580313-130580335 CCAGGATGGAGGCTCTGCCCAGG + Intronic
940123869 2:150300267-150300289 CCTAAATTGGGGCTTAGCCCAGG - Intergenic
940901269 2:159128613-159128635 CCTGAGTTGAGGCACGGCTCGGG - Intronic
941863286 2:170307597-170307619 CCAAAATTGAGGCTCTGCCCAGG + Intronic
943967806 2:194360400-194360422 CTTGAATTGAAACTCTGCCCTGG - Intergenic
946385496 2:219381901-219381923 CCTGCCTTGAGGCTCTGCCTTGG - Intronic
1175780735 20:61680404-61680426 CCTGAATGGAGGCCCTGGCCAGG - Intronic
1179987248 21:44928653-44928675 CCCTAACTGAGGCTCTGCCCTGG + Exonic
1181921015 22:26320573-26320595 CAGGCATTGAGGCTGGGCCCTGG + Intronic
1183421362 22:37713493-37713515 CCTGGTGTGAGGCTCAGCCCTGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953912411 3:46899674-46899696 CCTGAATTGAGGCTCGGCCCAGG + Intronic
961081584 3:124033107-124033129 GCTGAATTGAAGCTCCGGCCGGG - Intergenic
966503364 3:180671517-180671539 CCAGAATTGGGGCTTAGCCCTGG - Intronic
967843587 3:194027063-194027085 CCAAAATTGAGGCTTAGCCCAGG + Intergenic
968872447 4:3248708-3248730 TCTGAACTGGGGCTGGGCCCTGG - Exonic
969698987 4:8755417-8755439 CCGAAATTGGGGTTCGGCCCAGG - Intergenic
979304961 4:119131825-119131847 CCATTATTGAGGCTCGGCTCTGG - Intergenic
980155418 4:129098565-129098587 CCAGATTTGGGGCTCAGCCCAGG + Intronic
981616452 4:146648650-146648672 CCTGGATTGCTGCTCGGCCTCGG - Intergenic
985896698 5:2753072-2753094 CCTGAGCTGAGGCCCGCCCCAGG - Intronic
986879535 5:12153451-12153473 CCTGACTTGATGTCCGGCCCAGG + Intergenic
987197750 5:15544256-15544278 CCAGAATTGGGGCTTAGCCCAGG - Intronic
998374697 5:141682691-141682713 CCAGAATTGAGACTTGGCCTGGG + Intergenic
999873289 5:155774291-155774313 CCTGAATTGGAGCTCTGCCGGGG + Intergenic
1001200022 5:169707621-169707643 CCTGAACTGAGCCTCCTCCCCGG + Intronic
1001954112 5:175836638-175836660 CCAGAATTGAGGTTCAGCCAGGG + Intronic
1004840374 6:19577221-19577243 CCCAAATTGAGGCTTAGCCCAGG + Intergenic
1010162079 6:72868483-72868505 CCAGAATTGAGGCTCAGGTCTGG - Intronic
1015143171 6:129958326-129958348 CCTGAGGTGAAGCTGGGCCCAGG + Intergenic
1017835474 6:158173651-158173673 CCAAAATTGAGGCTCAGCCCTGG + Intronic
1017998672 6:159558265-159558287 CCAAAATTGAGGCTTAGCCCAGG + Intergenic
1019149418 6:169994205-169994227 CCTGAGTGGTGGCTCAGCCCAGG + Intergenic
1021399993 7:20198599-20198621 CCAGAATGGAGGCTTGGACCAGG - Intronic
1021743290 7:23710419-23710441 CCTGAAATGGGCCTCGTCCCAGG - Intronic
1022828829 7:34044549-34044571 CCTGAATCGTGGCCAGGCCCTGG - Intronic
1022921131 7:35015831-35015853 CCAGAATTGGGGCTCAGCCCAGG - Intronic
1023499116 7:40829424-40829446 CCAAAATTGGGGCTCAGCCCAGG - Intronic
1029817908 7:103115611-103115633 CCAAAATTGAGGCTTAGCCCAGG + Intronic
1034973980 7:155437239-155437261 CCAGAATTGGGGCTTGGCCCAGG + Intergenic
1035125922 7:156607694-156607716 CAGGAACTGCGGCTCGGCCCAGG + Intergenic
1043837279 8:85062321-85062343 CCAAAATTGAGGCTCAGCCCAGG + Intergenic
1047707515 8:127514590-127514612 CCTAAATTGACCCCCGGCCCTGG + Intergenic
1049345947 8:142138759-142138781 CCCGAATTGAGGCTGAGCCCGGG - Intergenic
1050266738 9:3898690-3898712 CCTGAATAGAGGTCAGGCCCGGG + Exonic
1062565819 9:137163515-137163537 CCTGCAGTGAGGCGGGGCCCAGG - Intronic
1185482876 X:460653-460675 CCTGAAGCGTGGCTCAGCCCTGG - Intergenic
1192189123 X:68980022-68980044 GCTGAAGTAAAGCTCGGCCCAGG + Intergenic
1195092063 X:101470127-101470149 CCAAAATTGAGGCTTAGCCCAGG - Intronic