ID: 953914458

View in Genome Browser
Species Human (GRCh38)
Location 3:46909504-46909526
Sequence GACACGGCCCCTGCTGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953914443_953914458 27 Left 953914443 3:46909454-46909476 CCCACCCGGACCTCACACACCCG No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914455_953914458 -10 Left 953914455 3:46909491-46909513 CCTCATCTGCCAGGACACGGCCC No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914453_953914458 -2 Left 953914453 3:46909483-46909505 CCTTGGAACCTCATCTGCCAGGA No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914448_953914458 17 Left 953914448 3:46909464-46909486 CCTCACACACCCGGCAGTGCCTT No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914451_953914458 7 Left 953914451 3:46909474-46909496 CCGGCAGTGCCTTGGAACCTCAT No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914442_953914458 28 Left 953914442 3:46909453-46909475 CCCCACCCGGACCTCACACACCC No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914447_953914458 22 Left 953914447 3:46909459-46909481 CCGGACCTCACACACCCGGCAGT No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914446_953914458 23 Left 953914446 3:46909458-46909480 CCCGGACCTCACACACCCGGCAG No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914444_953914458 26 Left 953914444 3:46909455-46909477 CCACCCGGACCTCACACACCCGG No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data
953914450_953914458 8 Left 953914450 3:46909473-46909495 CCCGGCAGTGCCTTGGAACCTCA No data
Right 953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953914458 Original CRISPR GACACGGCCCCTGCTGTTCT GGG Intergenic
No off target data available for this crispr