ID: 953916402

View in Genome Browser
Species Human (GRCh38)
Location 3:46923559-46923581
Sequence CAGGACACACAGAAGCAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953916402 Original CRISPR CAGGACACACAGAAGCAGCG AGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
900990058 1:6094495-6094517 CTGGACACACACATGCTGCGCGG - Intronic
902277221 1:15348695-15348717 CAGGGCACCCGGGAGCAGCGGGG - Intronic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904935476 1:34126867-34126889 CAGGACCCACAGAGACAGCCAGG + Intronic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
908153660 1:61329970-61329992 CAGGAATCACAGAAGCGGTGGGG + Intronic
911156417 1:94641902-94641924 CTGGCCACACAGAAGCTGTGAGG - Intergenic
911581487 1:99638727-99638749 GAGCACACACAGAAGCAACCTGG + Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
913040003 1:115012682-115012704 CAGGACACACTGAAGCAAGCAGG - Intergenic
913172233 1:116243405-116243427 CAGGCCAAACAGACCCAGCGGGG - Intergenic
915281113 1:154822761-154822783 CAGGAAGCACAGGAGCAGAGAGG + Intronic
916918767 1:169439567-169439589 CAGGACTCACAGTAGCATCTCGG + Intronic
919474319 1:198016184-198016206 GAGGACACACAGACACAGGGAGG - Intergenic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
920570912 1:207016600-207016622 CAGCACACACAGATGCAGATAGG + Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924446341 1:244135916-244135938 CAGGCCACACAGGAGCACTGTGG + Intergenic
924580903 1:245323771-245323793 GAGGACACACAGTAGGAGCTTGG - Intronic
1063303541 10:4875711-4875733 AGGGACACACAGAGGCAGTGTGG + Intergenic
1065877300 10:30008386-30008408 CGGGACACACACAAGCTGCTTGG + Intergenic
1067294614 10:44968176-44968198 GAAGACCCACAGAAGCAGTGTGG + Intronic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1069034728 10:63634566-63634588 CAGGACACTCGGAAGCAAGGGGG + Intergenic
1069555910 10:69398538-69398560 CAGGACCCACAAGAGCAGCCTGG - Intronic
1069762872 10:70826351-70826373 AATGACAGACAGAAGCAGCCTGG - Intronic
1071199918 10:83209759-83209781 CAGGACAAAGAAAAGCAGCTTGG + Intergenic
1071330273 10:84551992-84552014 CAGGACACGCAGAAGCTCAGAGG + Intergenic
1072681511 10:97510697-97510719 CAGGACACACTGAAGAAGTCAGG - Intronic
1072756347 10:98023751-98023773 CAGGACACACAGAAGATTCATGG + Intronic
1072788249 10:98299337-98299359 CACCACACAGAAAAGCAGCGTGG - Intergenic
1072958364 10:99906818-99906840 CCTGACCTACAGAAGCAGCGAGG + Intronic
1073392870 10:103193420-103193442 CGGGACAGACAGACGCAGCGCGG - Intergenic
1073859058 10:107716015-107716037 AATGAGACACAGAAGCAGTGAGG + Intergenic
1074987433 10:118670485-118670507 CAGGACCCAGTGAAGCAGGGTGG + Intergenic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076440209 10:130476389-130476411 GAGGACACAGGGAAGCAGCAGGG - Intergenic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1077141563 11:1027075-1027097 CAGGACACTCAGAGGAAGCCGGG + Intronic
1077305489 11:1866985-1867007 GAGGAGACACTGAAGCCGCGTGG + Intronic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1081585169 11:44379280-44379302 CCAGACACACACAGGCAGCGAGG + Intergenic
1084347824 11:68567721-68567743 CAGCACACAGAGAAGAAGCATGG - Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1086045442 11:82526519-82526541 CAGGACACAGAGAAGCTTCTGGG + Intergenic
1087249711 11:95883989-95884011 CAGGACACAAATAAGCAATGAGG + Intronic
1087607586 11:100395118-100395140 GAGGACACACACCAGCAGTGAGG - Intergenic
1087785296 11:102347341-102347363 CAGCAAACACGGAAGCTGCGCGG - Intronic
1088028385 11:105215383-105215405 CATGACACACAGACACAGTGGGG + Intergenic
1088401243 11:109423812-109423834 CAGGACAATCAGCACCAGCGTGG - Exonic
1089456701 11:118629952-118629974 CAGGACCCAGATAAGCAGCCTGG - Intronic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1090227211 11:125078937-125078959 CAGGTGTCACAGAAGCAGTGGGG + Intronic
1091329159 11:134717067-134717089 CAGCACACACAGTGGCAGAGAGG - Intergenic
1091853785 12:3722634-3722656 CAGGACACACAGTACCAACAGGG + Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093414533 12:18905194-18905216 CAGGCCCCACTGAAGCAGCTAGG + Intergenic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1093791482 12:23255412-23255434 GAGGACACACAGAATCAGCCTGG - Intergenic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1096121375 12:49091492-49091514 CAGGACACTCAAAAGCTGGGAGG - Intronic
1096309253 12:50505482-50505504 CAGGAAGCGCAGAAGCAGTGTGG - Intronic
1096504890 12:52086563-52086585 CAGGACTCACAGAAGCCTCGTGG - Intergenic
1096841380 12:54381515-54381537 GAGGAAACACAGACGCAGAGAGG - Intronic
1096983710 12:55743330-55743352 CAGGAAGCCCAGCAGCAGCGGGG - Exonic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1103791748 12:123477017-123477039 CAGGAGAGACTGAAGCAGAGGGG + Intronic
1104158171 12:126153260-126153282 CAGGAGAGAGAGAAGCGGCGAGG + Intergenic
1104343795 12:127977460-127977482 CAGGACACTAAGAAGAAGCAAGG + Intergenic
1104835864 12:131789950-131789972 GAGGTGACACTGAAGCAGCGCGG + Intronic
1104970422 12:132528349-132528371 CAGGACCCCAAGAAGCAGCCCGG - Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106340206 13:28820130-28820152 CTGGACAAAGAGAAGCCGCGGGG - Intergenic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1107560224 13:41551481-41551503 GAGGACACAGAGAAGGAGCCAGG - Intergenic
1112076243 13:95916250-95916272 CAGGAAAAACAGAAGCAACTAGG + Intronic
1113189121 13:107723202-107723224 CAGGAACCACAAAAGCAGCAAGG - Intronic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1114297735 14:21345121-21345143 CTGGACCCACAGGAGCAGCAAGG + Exonic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1116119639 14:40705971-40705993 CAGGACACACTGAAGCAAGGGGG + Intergenic
1118105115 14:62649985-62650007 CAGGGCACACATATGCAGAGTGG + Intergenic
1118204832 14:63713055-63713077 GAGTACACACAGAAGAAGAGAGG - Intronic
1120732648 14:88020905-88020927 AAGGAAACCCAGAAGCAGAGCGG + Intergenic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123450694 15:20357542-20357564 GAGGACCCAGAGAGGCAGCGGGG + Intergenic
1124223124 15:27866713-27866735 CAGGAAGCACAGAAGCATCGAGG + Intronic
1124669415 15:31624817-31624839 CAGGACCCATAGGAGCAGCATGG - Intronic
1124693018 15:31841405-31841427 CAGGACACAAGGAAGCCTCGAGG + Intronic
1125185125 15:36921274-36921296 CAGGACCAAAAGAAGCAGCATGG + Intronic
1127814204 15:62592211-62592233 CAGGACTCTCAGAAGCAGCTAGG - Intronic
1128184201 15:65630485-65630507 CAGGACCCACAGAGGCAGGGGGG - Intronic
1128459948 15:67859574-67859596 CATGACACACAGTAGCAGGGGGG - Intergenic
1129476407 15:75786885-75786907 CAGGACACCCAGGAGCACCCAGG + Intergenic
1132781030 16:1625809-1625831 CAGGACCCACGGCACCAGCGAGG - Intronic
1132897047 16:2234042-2234064 CTGGACACCCAGAAGCACCCCGG - Intronic
1133859097 16:9577098-9577120 GAGAACACACAGATGCAGAGAGG - Intergenic
1134215999 16:12317335-12317357 AAGGACACACAGAAGCCAGGGGG - Intronic
1136064421 16:27749310-27749332 CAGGACAGTCAGAAGCTGTGTGG + Intronic
1136417815 16:30114200-30114222 CACCACACACAGAAGCAGCGAGG + Exonic
1137370831 16:47904304-47904326 CTGGACACACTGAAGCAGAAAGG - Intergenic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139386530 16:66576067-66576089 CAGCACACAAAGAAGCAGGTTGG + Intronic
1139458200 16:67100781-67100803 TAAGACAGACAGAAGCAGCATGG - Exonic
1139505718 16:67397217-67397239 CAGCACCCACTGAAGCAGGGCGG - Intronic
1141699098 16:85634324-85634346 CAGGAGAGACAGAAGCACAGAGG - Intronic
1141879128 16:86846288-86846310 TAGGAAGCACAGAAACAGCGAGG - Intergenic
1142103878 16:88291766-88291788 CAGGACACCCAGACGCAGGGAGG - Intergenic
1143171468 17:4932990-4933012 CAGGGCACCAAGAGGCAGCGAGG - Exonic
1143388862 17:6548352-6548374 AAGGAAACACAGAGGCTGCGAGG + Intronic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144043224 17:11431231-11431253 CTGGACAGTCAGCAGCAGCGAGG - Intronic
1145211227 17:21014816-21014838 CAGGAAACTCACAAGCAGCCAGG + Intronic
1145714836 17:27009524-27009546 CCAGACACACAGACGCAGCCTGG - Intergenic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147529496 17:41262120-41262142 CAGAACACACAGACACAGGGAGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1150193705 17:63271649-63271671 CAGAACACACAGACACAGGGAGG - Intronic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1150976785 17:70096218-70096240 CAGGACACTCACAAGCAGTGAGG - Intronic
1151890692 17:76949063-76949085 GGGGACTCACAGAAGCATCGTGG + Exonic
1152584450 17:81182764-81182786 CAGGACAAACAGCTCCAGCGTGG + Intergenic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1152900367 17:82937653-82937675 CAGGGCACACAGGAGAATCGGGG - Intronic
1152963339 18:94165-94187 AAGCACACACTGAAGCAGCTGGG + Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1158544783 18:58386782-58386804 CAGCACACTCAGAAACAGCTCGG + Intronic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1161504868 19:4638591-4638613 CAGGACACACAGGAGCCTCCCGG - Intergenic
1162675510 19:12295212-12295234 CAGGCCACACTGTAGCAGCGGGG + Intergenic
1163023188 19:14494906-14494928 ACGGCCACACAGAAGCAGTGTGG + Intronic
1163098409 19:15078143-15078165 CAGTAAAGACAGAAGTAGCGGGG - Intergenic
1163152272 19:15422525-15422547 CAGGCCCCACAGAGGGAGCGTGG + Exonic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165017207 19:32889877-32889899 CAGCACACACAGCAGCAGAAGGG + Intronic
1165245372 19:34495553-34495575 CCCGCCCCACAGAAGCAGCGTGG + Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167358147 19:49016482-49016504 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167359642 19:49023372-49023394 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167361489 19:49032713-49032735 CCAGACCCACAGAGGCAGCGGGG + Intronic
1167362165 19:49036072-49036094 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167363919 19:49044786-49044808 CCAGACCCACAGAGGCAGCGGGG + Intronic
1167364579 19:49048141-49048163 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167365864 19:49054777-49054799 CCAGACCCACAGAGGCAGCGGGG - Intronic
1168179954 19:54655167-54655189 CAGGAGACATAGGAGCAGCTGGG - Intronic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
925278064 2:2664404-2664426 CGGGACACACACACGCAGAGAGG + Intergenic
925910972 2:8573531-8573553 CAGGACACACAGCTTCTGCGGGG - Intergenic
925991145 2:9255553-9255575 AAGGACACACAGAACCAGAGAGG - Intronic
926320017 2:11743185-11743207 CTGGACACACAGGAGCATCTTGG - Intronic
927522220 2:23706001-23706023 CAGGTCACACAGAAGCACCTTGG + Intronic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
935076431 2:99748919-99748941 ATCGACACACAGAAGCAGTGAGG - Intronic
935319890 2:101876192-101876214 CAGGAGGCAAAGTAGCAGCGTGG + Intronic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938969017 2:136415214-136415236 CAGGACACCCAGGACCAGCGGGG - Intergenic
939211272 2:139177957-139177979 CAGCCCACTCAGAAGCAGAGGGG - Intergenic
939547332 2:143569564-143569586 CAGGACACACAGAAGGCCAGAGG + Intronic
942547646 2:177081246-177081268 CTTGACACAGAGCAGCAGCGTGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
945161420 2:206895479-206895501 CATGACACACACAAGCAATGGGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
946734792 2:222743505-222743527 CAAGACACACACAATCAGGGCGG + Intergenic
947529643 2:230900713-230900735 CAGGACACAGAGACCCAGAGTGG + Intergenic
947991429 2:234490756-234490778 CAGGACACAAAGCAGAAGAGAGG + Intergenic
948055475 2:235006913-235006935 AAGGACACACAGATGCGGCGTGG - Intronic
1170052339 20:12159575-12159597 TGGGACACACAGAAACAGCTGGG - Intergenic
1171779079 20:29402402-29402424 CAGAACACACATAAGCACCATGG + Intergenic
1172106296 20:32519084-32519106 CAGGACACACAGCAGCTGAATGG + Intronic
1172751060 20:37251599-37251621 CATAACACACCGAAGCAGCAAGG - Intronic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1174453939 20:50636620-50636642 CAGGCCAGAGAGAGGCAGCGAGG - Intronic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1175326257 20:58130382-58130404 CAGGACACTCAGACTCAGAGAGG - Intergenic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175736518 20:61391062-61391084 CAGGACAAAAAGAAGCAGACAGG - Intronic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1176205551 20:63886200-63886222 CAGGGAACAAAGCAGCAGCGTGG + Intronic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1179000998 21:37458037-37458059 CAGAACACACAGAGGCGGCCAGG - Intronic
1179249801 21:39663389-39663411 AAGAACACACAGAAGCAGTAGGG - Exonic
1179601866 21:42484525-42484547 CATGACACACAGAAATAGTGTGG + Intronic
1180098966 21:45575464-45575486 CAGGACACACAGGGCCAGCCGGG - Intergenic
1180704993 22:17803967-17803989 CAAGAAACACAGACACAGCGAGG + Intronic
1181163286 22:20969988-20970010 CAGGACACACAGGAGCACAGAGG - Intronic
1181435673 22:22909228-22909250 CAGGAAACGCAGAAGCAGAGAGG - Intergenic
1181488478 22:23246591-23246613 CAGGTCACACAGGTGCAGCTGGG + Intronic
1181925023 22:26351231-26351253 CAGGACTCACAAACGCAGTGGGG - Exonic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183160969 22:36112907-36112929 CAGGACACAGAGGAGAAGAGGGG - Intergenic
1183291061 22:37002309-37002331 CAGGACAAAGAGAAACAGAGGGG + Intronic
1183537044 22:38408869-38408891 TTGGACTCACAGAAGCAGAGAGG + Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184343994 22:43901849-43901871 CAGGTCACACAAATGCAGCGTGG + Intergenic
1184477040 22:44727583-44727605 CAGGCCACACAGCTGCACCGTGG + Intronic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185269889 22:49924612-49924634 CGTGAGACACAGAAGCAGTGGGG + Intronic
1185318949 22:50191401-50191423 CAGGACTCACAGACCCAGCTGGG - Intronic
949181305 3:1134862-1134884 CAGGAAGCACACAAGCAGTGTGG + Intronic
950225096 3:11226961-11226983 CAGGATATACAGAAGCACCCTGG - Intronic
950542814 3:13622268-13622290 CAGGACCCCCAGAAGCTCCGTGG + Intronic
951449659 3:22822312-22822334 CATGACACACAGAAATAGTGTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953395891 3:42569454-42569476 CACCAGACACTGAAGCAGCGAGG + Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
954746649 3:52791213-52791235 AAGGCCACACAGGAGCAGTGTGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955842376 3:63125872-63125894 AAGGTCACACAGAAGCAAAGTGG - Intergenic
957232315 3:77536220-77536242 CAGGCCACAAAGAAGCAGGTGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958710955 3:97716606-97716628 GAGGAAACACAGAAGCACCTGGG - Intronic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
959584031 3:108009234-108009256 CAGTAGACACAGAAGCACCCAGG + Intergenic
960849050 3:122032954-122032976 CCTGACACACAGAAACAGTGAGG + Intergenic
961016963 3:123475899-123475921 CAGGATACAAAGAACCAGAGAGG + Intergenic
961427446 3:126859166-126859188 CAGGAAACAGTGACGCAGCGGGG + Intronic
966058827 3:175731024-175731046 CAGGAAACACAGTAGTAGAGTGG + Intronic
966429985 3:179821087-179821109 CATGACAGCCAGAAGCGGCGGGG + Intronic
967083623 3:186073457-186073479 GAGGTCACACAGCAGCAGAGCGG + Intronic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
967886953 3:194339951-194339973 CAGGACAACTCGAAGCAGCGGGG + Exonic
967997950 3:195180690-195180712 CTGGACACACACAAGCAGACGGG + Intronic
968282549 3:197488064-197488086 CATGACAAACAGAAGCAGATGGG + Intergenic
968893950 4:3388036-3388058 AGGGACACACAGAGCCAGCGTGG - Intronic
968903455 4:3441540-3441562 CAGCACAGACAGTAGCAGTGGGG - Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969317025 4:6388542-6388564 CAGCACACACAGATACAGGGAGG + Intronic
972336046 4:38107871-38107893 CAAGAAACACAGAAGCAACATGG - Intronic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976144371 4:82027071-82027093 GAGGACACACAGAATCTGCCTGG + Intronic
977586867 4:98783808-98783830 CAGGACACACAGCAGCAGAGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
979184407 4:117770746-117770768 CAGGCCCCACAGAAGCATCAAGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
982250070 4:153396302-153396324 CAGCACGCTCAGAAGCAGCACGG - Intronic
983176722 4:164596855-164596877 CAGAACTCACAGAAGCAGAGTGG + Intergenic
984982032 4:185291594-185291616 CAGCGCATTCAGAAGCAGCGTGG - Intronic
985659689 5:1150883-1150905 GAGGGCACGCAGAAGCAGCCTGG + Intergenic
985914256 5:2905596-2905618 CAGGACACAGAGCAGCACAGAGG + Intergenic
986326932 5:6682512-6682534 CAGGACAGACAGAAGTGACGGGG + Intergenic
986496827 5:8350867-8350889 CAGCCCACAGAGAAGCAGGGAGG + Intergenic
988519291 5:31931500-31931522 CAGGACACCCAGCTGCAGCTGGG + Intronic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
993733944 5:91453394-91453416 CAGGCCACACAGAGACAGGGAGG - Intergenic
993969288 5:94397270-94397292 TAGGACACAAAGAAGCAAAGAGG - Intronic
995336930 5:111010264-111010286 CAGACCACATAGAAGCAGCTTGG + Intergenic
996323650 5:122248077-122248099 CCTGACACACAGAAGCAATGTGG - Intergenic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999730844 5:154475917-154475939 AAGGACACACAGAAGAAAAGAGG + Intronic
1001257666 5:170196782-170196804 CACGGCACACACAGGCAGCGAGG + Intergenic
1001912810 5:175534857-175534879 CAGTGCCCACAGAAGCAGCATGG + Intergenic
1002059349 5:176617183-176617205 GGGGACACACAGACACAGCGAGG + Intergenic
1002254979 5:177951921-177951943 CAGGACACTTAGAAGAAGCATGG + Intergenic
1003257771 6:4489255-4489277 CCGGACACACAGAGACACCGGGG - Intergenic
1003911351 6:10747084-10747106 CAGGAAACACAGAAGAGGAGCGG + Intergenic
1004058804 6:12170382-12170404 CAGAACAGACAGAAGCACTGTGG + Intergenic
1005997501 6:30940308-30940330 CAGGCCACCCAGAAGGACCGAGG - Intergenic
1006880146 6:37332142-37332164 CAGGACACCCAGAACCAACCTGG - Exonic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1012100766 6:95083740-95083762 CAGGTCACACAGCAGCACCTGGG - Intergenic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1014079084 6:117267878-117267900 CAGGAGACACCTAAGCAGCTAGG - Intronic
1017103142 6:150865886-150865908 CAGGGCACACGGAGGCGGCGCGG - Exonic
1017709967 6:157158655-157158677 GAGGAGCCACAGAAGCAGAGTGG - Intronic
1017781852 6:157721574-157721596 CGGGCCACACAAAGGCAGCGAGG - Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1019106404 6:169671116-169671138 CAGGACACCCACAAGCAGCCAGG + Intronic
1019575564 7:1735990-1736012 CAGGGGACACAGAACCATCGTGG - Intronic
1019714711 7:2533277-2533299 CAGGACACACAGGAGCAGGTGGG + Intergenic
1019741608 7:2677776-2677798 CAGGACACACAGGAGCAGGTGGG - Intergenic
1019851186 7:3559492-3559514 CAGGATACTTAGAAGCAGCCTGG + Intronic
1020429070 7:8101003-8101025 CCTGACACACACAAGCAACGGGG + Intergenic
1020870866 7:13627332-13627354 AAGGACACACCTAATCAGCGAGG - Intergenic
1022629464 7:32071269-32071291 CAGGGCACGCAGAAGCCGCGAGG + Intronic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1023611187 7:41972509-41972531 CATGTCACCAAGAAGCAGCGAGG - Exonic
1024018606 7:45344014-45344036 CAGCACACACTTAAGGAGCGGGG - Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024858578 7:53811698-53811720 CAGGCCGCACAGAAGCTGCAGGG + Intergenic
1026100215 7:67378291-67378313 CTGGGCACACAGGAGCAGCTGGG + Intergenic
1026420621 7:70233283-70233305 CAGGACACAGAGAGCCTGCGAGG - Intronic
1029358748 7:100072635-100072657 GAGGAGAGACAGCAGCAGCGCGG + Intronic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035576776 8:713104-713126 CAGGACACACATACGTAGAGAGG - Intronic
1036752062 8:11449654-11449676 CAGGCCACCCAGCAGCAGTGGGG + Intronic
1039030498 8:33304028-33304050 GAGAACACACAGACGCAGAGAGG + Intergenic
1040384499 8:46905101-46905123 CTGGAGACAGAGAACCAGCGAGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041375703 8:57207905-57207927 CTGGTCAGACAGGAGCAGCGCGG - Intergenic
1041778879 8:61555768-61555790 CATGACATTCATAAGCAGCGTGG - Intronic
1043128997 8:76437686-76437708 CATGACACACACAAGCAATGGGG - Intergenic
1045987211 8:108262461-108262483 TAAGACACACAGAAGCACTGAGG - Intronic
1046785276 8:118259120-118259142 CAGGACCTACAGAAGCATAGTGG + Intronic
1046887298 8:119381534-119381556 CTGGACACAAACAAGCAACGGGG + Intergenic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1051149424 9:14064263-14064285 CAGGACACACAAAAAGAGAGGGG - Intergenic
1051822477 9:21183640-21183662 CGGGACACAGAAAAGCAGGGAGG + Intergenic
1051825536 9:21214229-21214251 CGGGACACAGAAAAGCAGGGAGG + Intronic
1052417065 9:28189825-28189847 CAGTACACACAGAACCAGAGTGG - Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1056144307 9:83714365-83714387 CATAACACACAGAAGCAAAGGGG + Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1057334344 9:94144082-94144104 TAGGACACACAGCAGCAGGTGGG - Intergenic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1059153219 9:111967500-111967522 CAGCCGACACAGAAGCAGCCAGG - Intergenic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1059852720 9:118362484-118362506 AAGGACCCAAAGAAGCAGGGAGG + Intergenic
1060016201 9:120088423-120088445 CAGGACACAGAGCAGTAGGGAGG + Intergenic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062196915 9:135279525-135279547 CTGGACCCAGGGAAGCAGCGAGG - Intergenic
1062635958 9:137491948-137491970 CAGGACACGCGGGAGCAGCCAGG + Intronic
1062734751 9:138129538-138129560 AAGCACACACTGAAGCAGCTGGG - Intergenic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1185798372 X:2986325-2986347 CGGGACACACAGAAACACTGAGG + Intergenic
1185822912 X:3221846-3221868 CAGGACACTCTGAGGCAGGGGGG + Intergenic
1185873359 X:3682613-3682635 AAGGAGACACAGACGCAGAGGGG + Intronic
1188024165 X:25191411-25191433 TGGGAGACAGAGAAGCAGCGGGG - Intergenic
1188168457 X:26892226-26892248 CAGGACACGCAGTAGCATGGTGG - Intergenic
1188262779 X:28038632-28038654 AAGGACACACAGAACCATAGTGG + Intergenic
1189235583 X:39484440-39484462 CAGGAGACAGGGAAGAAGCGGGG + Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190917875 X:54823693-54823715 AGGGACACACAGCAGCAGCGGGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1196624126 X:117858676-117858698 CAGGCCACAGAGAAGCAGCTGGG - Intergenic
1197339859 X:125253960-125253982 CATGACACATCGAAGCAGTGGGG - Intergenic
1197346160 X:125327288-125327310 CAGGACACACTGGAGAAGTGCGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic