ID: 953916704

View in Genome Browser
Species Human (GRCh38)
Location 3:46925094-46925116
Sequence GGGCAGGGTGATGGGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953916704_953916708 -10 Left 953916704 3:46925094-46925116 CCACAGGACCCATCACCCTGCCC 0: 1
1: 0
2: 4
3: 55
4: 504
Right 953916708 3:46925107-46925129 CACCCTGCCCTGCTGCCCAAGGG 0: 1
1: 1
2: 2
3: 58
4: 433
953916704_953916718 20 Left 953916704 3:46925094-46925116 CCACAGGACCCATCACCCTGCCC 0: 1
1: 0
2: 4
3: 55
4: 504
Right 953916718 3:46925137-46925159 ACCACATCCACTTCTCAGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953916704 Original CRISPR GGGCAGGGTGATGGGTCCTG TGG (reversed) Intronic
900116853 1:1032771-1032793 GGGCAGGGTAATGGGTGCGCAGG + Intronic
900326629 1:2111400-2111422 GGGCAGGATGAGGGGGCCAGAGG + Intronic
900330670 1:2133019-2133041 GGGCTGTGTGCTGTGTCCTGTGG + Intronic
900342639 1:2195958-2195980 GGGCAGGGGGAGGGGGCCTGGGG + Intronic
900345737 1:2209527-2209549 GGCCAGGGGGCTGGGCCCTGAGG - Intronic
900775511 1:4581744-4581766 GGGAAGGGTGCTAGATCCTGAGG - Intergenic
901815064 1:11789150-11789172 GGGCAGAGGGAGGGGCCCTGGGG + Exonic
901878703 1:12181524-12181546 GGTCAGGGTAGTGGGTCCGGGGG - Intronic
902188208 1:14741266-14741288 AGGCATGGTGCTGGGTGCTGGGG - Intronic
902642583 1:17776223-17776245 GGGCAGGGTGAAGGCTCCTTGGG - Intronic
902684951 1:18070331-18070353 GGCCAGGGTGGAGGGTCTTGAGG + Intergenic
902866629 1:19284329-19284351 GAGCAGGCTGATGAGTCCTCAGG - Intronic
903176030 1:21581337-21581359 GGGCACGGTGGTGGTGCCTGCGG - Intergenic
903627916 1:24744898-24744920 GGAAAGGGCGATGAGTCCTGGGG + Intergenic
903656896 1:24955016-24955038 TGGAAGGTTTATGGGTCCTGTGG - Intronic
903674522 1:25055609-25055631 GGAGAGGGTGTTGGCTCCTGCGG + Intergenic
903829342 1:26165145-26165167 GGAGAGGCTGATGGGTCATGGGG + Intergenic
904273634 1:29366493-29366515 GGTCAGGATGAAGGGTCCTGGGG + Intergenic
905186884 1:36203445-36203467 GGGCTGAGTCCTGGGTCCTGGGG + Intergenic
905652239 1:39664291-39664313 GGGCATGGTGGTGGGGCCTGTGG - Intronic
905890419 1:41515392-41515414 AGGCAGGGTGATGAGACCAGAGG + Intronic
906675841 1:47693191-47693213 GGGCAGGGTGAATGGGCTTGGGG + Intergenic
907048822 1:51316162-51316184 CGGCAGTGTGCTGGGTGCTGGGG - Intronic
909406133 1:75291664-75291686 TGGGAGTGTGATGGGTACTGAGG + Intronic
909914006 1:81295287-81295309 GGACATGGTGATGGGCCATGAGG - Intergenic
910114053 1:83713091-83713113 GGGTAGGGAGATGGCTCTTGGGG - Intergenic
910176657 1:84438001-84438023 GGGCAGTGTGGGGGGCCCTGAGG + Intergenic
912240111 1:107897621-107897643 GGGCAGGGTGAATGCACCTGAGG - Intronic
912376039 1:109210630-109210652 AGGCAGGGTGCTAGGTCCCGTGG + Intergenic
912436830 1:109668099-109668121 GGGCATGGTGCTGGTTGCTGTGG - Exonic
912452931 1:109778403-109778425 GGGCAGGTTGATGCCCCCTGGGG - Intergenic
913271564 1:117098920-117098942 GAGAAGGGTCCTGGGTCCTGGGG - Intronic
914340984 1:146760276-146760298 TGGGAGGGTGGTGGGTACTGGGG + Intergenic
914810678 1:151025509-151025531 GTCCAGGATGATGGTTCCTGTGG - Exonic
915597178 1:156902357-156902379 GGGAAGTGTGATGGGGCATGCGG + Intronic
918468341 1:184844836-184844858 GGGCAGGGTGATGGGTTTGCAGG - Intronic
920298268 1:204973213-204973235 GGGCAGGGTGAAGGGCACTTGGG - Intronic
922060238 1:222082333-222082355 GAGCAGGGTGAGGGGGCCAGTGG - Intergenic
922613274 1:226945356-226945378 GGGCTGGATGAGGGGTCCTGGGG + Intronic
923315561 1:232776731-232776753 GGGAAATGTGTTGGGTCCTGTGG - Intergenic
923473988 1:234315996-234316018 GGGTAGGGTGGAGGGGCCTGTGG + Intronic
923677877 1:236095943-236095965 GGCTGGGGTGATGGGACCTGGGG - Intergenic
1064007839 10:11712588-11712610 GGGCAGGGAGATGGTGACTGTGG - Intergenic
1064266976 10:13833086-13833108 GGGTAGGGTGATGGGTGCCATGG + Intronic
1065290394 10:24223827-24223849 GGGGTGGGTGGTGGGTGCTGGGG - Intronic
1065787240 10:29228011-29228033 GGGCAGGGGGGTGGGGGCTGAGG - Intergenic
1065920987 10:30392624-30392646 AGGCAGGGTGGTGGGTAGTGGGG + Intergenic
1066292569 10:34027597-34027619 GGGCAAGGTGAGGGGTATTGGGG - Intergenic
1066370664 10:34815607-34815629 GGGCGGGGTGAAGGGGGCTGGGG - Intergenic
1066665802 10:37781452-37781474 GGGCAGAGTTGTGGGTCATGGGG - Intronic
1067055400 10:43046898-43046920 GGGCAGGGCACTGTGTCCTGAGG - Intergenic
1067211947 10:44266705-44266727 GCCCTGGGTGTTGGGTCCTGGGG - Intergenic
1067716535 10:48694905-48694927 GGGCAGGGTGGTGGTGGCTGTGG - Intronic
1068292078 10:55016396-55016418 GGGGAAGGTGATGGGTTCTAGGG - Intronic
1069090390 10:64193420-64193442 GGGAAAAGTGATGGGTCATGGGG - Intergenic
1069559056 10:69416850-69416872 GGGCTGGGTGCTGGGTGCTCAGG + Exonic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1070777864 10:79120524-79120546 GGGGAGGGTGTTGGGGCTTGAGG + Intronic
1072755622 10:98019017-98019039 GTACAGGGTGAGGGGTGCTGCGG + Intronic
1073065929 10:100759206-100759228 GTACAGGCTGATGGGCCCTGAGG + Intronic
1073144989 10:101274590-101274612 GGGCAGGGAGTTCGGGCCTGAGG + Intergenic
1073531680 10:104238185-104238207 GGGCAGTGTGATTGGTGCAGAGG + Intronic
1074650010 10:115510417-115510439 GATCAGGGTAATGGTTCCTGAGG - Intronic
1074891099 10:117737192-117737214 GGGCACAGTGGTGGGTGCTGGGG + Intergenic
1075464989 10:122644580-122644602 GGGCAGGGCGAAGGTGCCTGTGG + Intergenic
1075585295 10:123652975-123652997 GGGGAGGGAGATGGGGTCTGTGG - Intergenic
1075655407 10:124157694-124157716 GGACAGGGTCAGGGATCCTGTGG + Intergenic
1076168494 10:128301267-128301289 GGCCAGGGTGATGTGTCATGAGG + Intergenic
1076675718 10:132146556-132146578 GGGCAGGGACAGGTGTCCTGAGG + Intronic
1076698180 10:132257053-132257075 GGGCAGGGCCCTGTGTCCTGGGG + Intronic
1076908847 10:133377596-133377618 GGGCAGTGAGCTGGGCCCTGCGG + Intergenic
1076946674 10:133656435-133656457 GGGCTGGATCATGGATCCTGGGG - Intergenic
1077111781 11:865276-865298 GGGGAGGACCATGGGTCCTGGGG - Intronic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1077321948 11:1946702-1946724 GGGCGAGGTGAGGGGCCCTGGGG + Intergenic
1077377202 11:2210662-2210684 GTGCAGGGTGATGGGTCTGTGGG - Intergenic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1078478568 11:11656465-11656487 GGGCACGGGGATGGGTTCAGAGG - Intergenic
1078699595 11:13668397-13668419 GGGCCGGGAGGTGGGCCCTGCGG - Intergenic
1080102607 11:28476683-28476705 GGGTAGGATCCTGGGTCCTGTGG - Intergenic
1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG + Intergenic
1081568990 11:44278134-44278156 GGGCTGTGAGATGGGGCCTGGGG - Intronic
1081572436 11:44300162-44300184 GGGAAGAGTGTGGGGTCCTGAGG + Intronic
1081686173 11:45044646-45044668 GGGCAGAGTGAGGGGTCAAGAGG - Intergenic
1082029523 11:47594322-47594344 GGACAGGGTGCTGGGGCCAGGGG + Exonic
1083684899 11:64370138-64370160 GGGGAGGGTGAGTGGTTCTGTGG + Intronic
1083812145 11:65112074-65112096 GGGCAGAGAGATGGGACCTGGGG + Intronic
1083931817 11:65850378-65850400 AGGCAGGATGATGGGGGCTGAGG + Intronic
1084185076 11:67467296-67467318 GGGCTGGGTGAGTGGCCCTGAGG - Exonic
1084641539 11:70429441-70429463 GGGCAGGTTGGCGGGTCCTGGGG - Intronic
1084833536 11:71787258-71787280 GTTCAGGTTGGTGGGTCCTGGGG - Intergenic
1084939581 11:72605307-72605329 GGGCAAGGTCATGGAACCTGTGG + Intronic
1085027081 11:73242644-73242666 GGGGAGGGTGATGGGGAGTGGGG - Intergenic
1085083135 11:73649752-73649774 GGGCAGGGGTATGGGGCATGGGG - Intronic
1087234827 11:95706287-95706309 GGGCTGGGTGTTGGGAGCTGAGG + Intergenic
1087334843 11:96830570-96830592 GGGCAGTGTGATAGGTGCTGGGG + Intergenic
1087397910 11:97625890-97625912 GGTCAAGGTGATGAGACCTGTGG - Intergenic
1087685076 11:101253366-101253388 GGGCAGCGTGAGGGCACCTGGGG + Intergenic
1088595100 11:111435404-111435426 GGGCAGGGTGCAGCCTCCTGGGG - Intronic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1088688413 11:112304424-112304446 GGGCAGGCTGCTAGGTACTGGGG + Intergenic
1089134994 11:116241901-116241923 GGGCAAGGGTATGGGTCCTGGGG - Intergenic
1089170107 11:116505918-116505940 GGTCAGGGAGATGTGCCCTGTGG + Intergenic
1089182178 11:116590620-116590642 GGGGGGGGTGAGGGGTCATGGGG - Intergenic
1089414908 11:118280159-118280181 GGGCTGGGTGATAGGACATGGGG - Intergenic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089995168 11:122899917-122899939 GGGCAGGGATATGGGACATGGGG - Intronic
1090648923 11:128789464-128789486 AAGCAGGGTGATGGGGCCTCAGG + Intronic
1090965291 11:131592807-131592829 GGCCAGGGAGAGGGGACCTGGGG - Intronic
1091192926 11:133709226-133709248 GGGCAGGGAGCTTGGTACTGTGG - Intergenic
1091261540 11:134238467-134238489 GGGCAGTGTGATGGTTACTGAGG + Intronic
1202804964 11_KI270721v1_random:2015-2037 GGGCGAGGTGAGGGGCCCTGGGG + Intergenic
1091463837 12:666560-666582 GGGCTGGGGGTTGGGGCCTGAGG - Intergenic
1092063745 12:5572312-5572334 GGGGAGGGTGGTAGGTCATGGGG - Intronic
1092097984 12:5860071-5860093 GGGCTGGGTGCTGGAGCCTGGGG - Intronic
1092276907 12:7068372-7068394 GGGCAGGGTGTTGGGGTCGGAGG + Intronic
1092629628 12:10363951-10363973 AGGCAGGGTGCTGGGACGTGGGG - Intergenic
1094394782 12:29994149-29994171 TGGCAGGGTGAGGGGTGCAGTGG - Intergenic
1095040401 12:37434626-37434648 GATCAGGGTGATGGTTGCTGAGG - Intergenic
1095141690 12:38671677-38671699 GGCCAGGGAGATGGGTGATGAGG - Intronic
1096487921 12:51996153-51996175 GGGGCGGGTGATGAGACCTGGGG + Intronic
1096984911 12:55749919-55749941 GGGCAGGGCTAGGGGTCTTGGGG - Exonic
1097185132 12:57192676-57192698 GGGCATGGGGATGGCTGCTGTGG - Intronic
1097401667 12:59134962-59134984 AGGCAGGGTGCTGTGTACTGAGG + Intergenic
1097500252 12:60392501-60392523 GGGCTGGGTTATGGGTCCTGTGG + Intergenic
1098412007 12:70196181-70196203 GGGAGGGGTGATAGGTCGTGAGG + Intergenic
1099769787 12:87036457-87036479 GAGCAGGGTGATAAATCCTGGGG + Intergenic
1102162596 12:110781750-110781772 AGGCATGGTGACGGGACCTGCGG + Intergenic
1102394179 12:112573988-112574010 GGGCAGGGAGAGGGGTAATGGGG + Intronic
1102951571 12:117034889-117034911 GGGCAGGCTGATGCGTCTTGTGG - Intergenic
1103221880 12:119253084-119253106 GTCCAGGGTGCTGGGTCCTGTGG - Intergenic
1103322865 12:120101961-120101983 GGGCAGGGCAGTGGGGCCTGGGG - Intronic
1103744658 12:123114345-123114367 GGGCAGGGAACTGGGTGCTGGGG - Intronic
1103772058 12:123335049-123335071 GGGCATGGTGGTGGGACCTGTGG + Intronic
1103900942 12:124303389-124303411 CTGGAGGGTGTTGGGTCCTGTGG - Intronic
1104767867 12:131341910-131341932 GGACTGGGTGATGGGTTCCGGGG + Intergenic
1104883013 12:132084900-132084922 GGACTGGGTGAAGGGTCATGAGG - Intronic
1104932155 12:132345531-132345553 GGGGAGGGCGGTGGGTGCTGCGG - Intergenic
1104943927 12:132407312-132407334 GGGGCGGGCGATGGCTCCTGGGG - Intergenic
1104953537 12:132453191-132453213 GGGCAGTGTGATGGGGCCAGCGG - Intergenic
1105016013 12:132787372-132787394 GGGAGGGGTCCTGGGTCCTGAGG - Intronic
1105278562 13:18950118-18950140 GGGCATGGTGATGGGGACAGAGG - Intergenic
1105910790 13:24864184-24864206 GTGCAGGGAGATGAGTGCTGAGG + Intronic
1107651969 13:42553731-42553753 GGGGAGGGAGATGGGTGATGAGG + Intergenic
1108597403 13:51961272-51961294 GGGCAGTGTGCTAGGTGCTGGGG - Intronic
1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG + Exonic
1109775349 13:67033578-67033600 GGTCATGATGATGGGTGCTGTGG + Intronic
1112782981 13:102922232-102922254 GGGGAGGATGATGAGTCCGGGGG + Intergenic
1113307070 13:109090368-109090390 GGGCGGGGTCATGGGAACTGAGG + Intronic
1113459649 13:110472986-110473008 TGGCAGGCCGATGGGACCTGGGG - Exonic
1113513664 13:110874639-110874661 GGGGCGGGTGAGGGGTCCCGGGG - Intergenic
1113854815 13:113437356-113437378 CGCCTGGGTGCTGGGTCCTGGGG - Intronic
1113933740 13:113982243-113982265 GGGCTGGCTCATGGGCCCTGGGG + Intronic
1113966161 13:114155139-114155161 GGGCATGATGGTGGGGCCTGGGG + Intergenic
1115197784 14:30820333-30820355 GGTCAGAGAGAGGGGTCCTGGGG - Intergenic
1115471338 14:33771669-33771691 GGGCATGGTGGCGGGGCCTGTGG + Intronic
1116631243 14:47336875-47336897 GGGCACTGTGCTGGGTACTGTGG - Intronic
1117606430 14:57433472-57433494 GGGAAAGGTGAGGGGTCCGGGGG - Intergenic
1118181400 14:63497004-63497026 GGGCAGGGGGAGGGGTACTGGGG - Intronic
1118458226 14:65964126-65964148 GGGATGGGTGATTGGTCCAGGGG + Intronic
1118603103 14:67483911-67483933 GGGCAGGGTGAGTGGGCTTGGGG + Intronic
1118736644 14:68705882-68705904 CGGCAGGATGATGGGTACTCAGG - Intronic
1118875708 14:69783238-69783260 GGGCACTGTGATAGGTGCTGTGG + Intronic
1119179171 14:72593135-72593157 GGGCATGGTTGTGGGTCCTTAGG - Intergenic
1119816235 14:77570896-77570918 GGGCGGGGGGATGGGAACTGAGG + Intronic
1119824388 14:77645042-77645064 GGGCATGGTGATGTGCACTGCGG + Intergenic
1121570723 14:94944780-94944802 TGGCAGGGTTATGGCTTCTGTGG + Intergenic
1122235852 14:100330275-100330297 AGGCAGAGTGAGGGCTCCTGAGG - Exonic
1122491099 14:102116745-102116767 GCCCAGGGTGGTGGGTTCTGTGG - Intronic
1122689053 14:103522956-103522978 GGCCAGGGTGTTGGGGGCTGCGG - Exonic
1122790114 14:104180692-104180714 GGGCAGGGTGGGGGGGCCTTGGG + Intronic
1122822548 14:104354811-104354833 GGGCAGGGGGCTGGGGGCTGGGG + Intergenic
1122822560 14:104354832-104354854 GGGCAGGGGGCTGGGGGCTGGGG + Intergenic
1122822576 14:104354860-104354882 GGGCAGGGGGCTGGGGGCTGGGG + Intergenic
1122822611 14:104354923-104354945 GGGCAGGGGGCTGGGGGCTGGGG + Intergenic
1122822636 14:104354965-104354987 GGGCAGGGGGCTGGGGGCTGGGG + Intergenic
1122898938 14:104774163-104774185 GGGCAGTGTGATGGGGTGTGTGG - Intronic
1122980666 14:105191160-105191182 GGGCAGGGTCTTGGAGCCTGGGG - Intergenic
1122980830 14:105191735-105191757 GGGCTGGGTGGTGGGTACTTGGG + Intergenic
1123039214 14:105483541-105483563 GGGCAGGGAGGTGGGCCCTGGGG + Intergenic
1202924159 14_KI270724v1_random:8592-8614 GGGCTGGATCATGGATCCTGGGG + Intergenic
1123988816 15:25668214-25668236 GGGCAGGGTGAGGAGACTTGGGG + Intergenic
1124019380 15:25905249-25905271 GGGGAGGGAGCTGGGTGCTGTGG - Intergenic
1125922796 15:43535640-43535662 GGCCAGGGTGACAGTTCCTGAGG - Intronic
1127392067 15:58513815-58513837 GTGCATGGTGAGGAGTCCTGGGG - Intronic
1127667669 15:61164970-61164992 GTGCAGGGTGAAGGGTGCTTTGG - Intronic
1128794583 15:70456000-70456022 GGACATGGTGGTGGGCCCTGTGG - Intergenic
1129671677 15:77611123-77611145 GGACAGGGGGAGGGGTCCTTGGG - Intergenic
1130026102 15:80271776-80271798 GGGCTTGGTTGTGGGTCCTGTGG - Intergenic
1132525310 16:411305-411327 GGGGAGGGTGCTGGGTCTTGGGG + Intronic
1132598765 16:764773-764795 GGGCAGGGGGTTGGGGGCTGAGG - Intronic
1132630831 16:916543-916565 GGGCTGGATGATGGGGGCTGGGG + Intronic
1132951028 16:2562576-2562598 GTGCAGGTTGATGGGTGATGGGG + Intronic
1132963321 16:2637594-2637616 GTGCAGGTTGATGGGTGATGGGG - Intergenic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1133168386 16:3964839-3964861 GGGAGGGGTGCTGGGTCCTCAGG - Exonic
1133230127 16:4362460-4362482 TGGCAGGGTCATTTGTCCTGGGG - Intronic
1134066935 16:11234238-11234260 GGGCGGGGTGGTGGGCCCAGGGG + Intergenic
1135247164 16:20866918-20866940 GGGCACTGTGATGGAGCCTGGGG - Intronic
1135550834 16:23397047-23397069 AGGCATGGTGGTGTGTCCTGTGG - Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1135988334 16:27201278-27201300 TGGCAGGGGGTGGGGTCCTGGGG + Intergenic
1136277398 16:29187055-29187077 GGGCAGGTTGGTGGGGCCGGGGG + Intergenic
1136469949 16:30473484-30473506 GAGGAGGGTGCTGGGTTCTGGGG + Intronic
1137868833 16:51929864-51929886 GGGAAGGTTGATGGGTGCTATGG - Intergenic
1138387169 16:56643603-56643625 GGGCAGGGTGCTGGGTGCAGTGG - Intronic
1138444314 16:57053920-57053942 CAGCAGGGTGAAGGGTGCTGGGG + Intronic
1139486196 16:67257885-67257907 GGGGAGCATGGTGGGTCCTGAGG - Intronic
1139508391 16:67411282-67411304 GGGCAGGGTGATGGGGTCAGAGG + Intronic
1139993301 16:70957130-70957152 TGGGAGGGTGGTGGGTACTGGGG - Intronic
1141280582 16:82627201-82627223 GGGCAGGGTGAGGGGGCTTTCGG + Intronic
1141368522 16:83466123-83466145 AGGACGGGTGATGGGTCTTGGGG - Intronic
1141833085 16:86520587-86520609 GTGCAGGGAGATGTCTCCTGTGG - Intergenic
1142033521 16:87850192-87850214 GTGCTGGGTGCTGGGTGCTGCGG + Intronic
1142111274 16:88332962-88332984 GGGCAGGGACGTGGCTCCTGGGG - Intergenic
1142134238 16:88444310-88444332 GGGCAGGGTCAGGGGTTCCGCGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143171379 17:4932524-4932546 GGGAAGGGGGCTGGGGCCTGGGG + Intronic
1143626658 17:8114251-8114273 GGGCAGGGAGAGGGGAACTGGGG + Intronic
1144354184 17:14428459-14428481 GGGCAGGGTGTTGGCAGCTGAGG + Intergenic
1144738940 17:17570523-17570545 GGGCAGGGTGAGGAGGCATGAGG + Intronic
1144770311 17:17755877-17755899 GGGAAGGGTGATGTGTGCAGAGG - Intronic
1146522491 17:33536893-33536915 GGGCAGGGGGAGGGGTGCTGAGG + Intronic
1146602997 17:34234798-34234820 GGGTAGAGTGCTGGGTGCTGGGG - Intergenic
1147166496 17:38596248-38596270 GGGCAGGGCCATGGGCCATGGGG + Intronic
1147767280 17:42845358-42845380 GGGCAGGGTCCAGGGCCCTGTGG - Exonic
1147768469 17:42852093-42852115 GGGCAGGGTCAAGGGCCTTGTGG - Exonic
1147771057 17:42868025-42868047 GGGCAGGGTCAAGGGCCTTGTGG - Intergenic
1147980189 17:44269340-44269362 GGGGAGGGACACGGGTCCTGAGG + Intergenic
1148089202 17:45012814-45012836 GGGCTGGGGGCTTGGTCCTGGGG + Intergenic
1148105215 17:45115166-45115188 GGGCAGGGTGCAGGGTCCGCAGG + Exonic
1148204393 17:45770884-45770906 GGGCAGGGTGGGGGGTGCTGGGG - Intergenic
1148209455 17:45799575-45799597 GGCCAAGGTCCTGGGTCCTGGGG - Intronic
1148216796 17:45837721-45837743 GGGCAGGCAGATGGAGCCTGGGG + Intergenic
1148901641 17:50883125-50883147 GGTCAGGCGGATGGGTCCAGTGG - Intergenic
1149620347 17:58040091-58040113 GGGCAGGGAGAAGGGACCTGGGG + Intergenic
1149648055 17:58254747-58254769 GTGCAGGTTACTGGGTCCTGGGG + Intronic
1150226199 17:63525867-63525889 GGGGAGTGAGAAGGGTCCTGGGG + Intronic
1150656824 17:67044863-67044885 GGGCAGGGTGATGGGCCCGCAGG - Exonic
1150833178 17:68541547-68541569 AGGGAGGGTGCTAGGTCCTGGGG + Intronic
1151158267 17:72142598-72142620 GGGCAGGGGGATGGGGCAGGGGG + Intergenic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1151557617 17:74854575-74854597 GGGCAGGGAGGTGGGGGCTGAGG - Intronic
1151986338 17:77546541-77546563 GGGCACGGTGGTGGGCGCTGTGG - Intergenic
1152212934 17:79012648-79012670 GTGCAGGATCATGGGACCTGGGG + Intergenic
1152290401 17:79436929-79436951 GGGCAGGAGGAGGGGTGCTGTGG + Intronic
1152567924 17:81108427-81108449 AGGCCGGGTGACGGGGCCTGTGG - Intronic
1153834178 18:8949496-8949518 GGACAGCGCGATGGGTCCTCTGG + Intergenic
1153864615 18:9252675-9252697 GGGCTGGGTGCTGGGTACAGTGG + Intronic
1154980640 18:21499951-21499973 TGGGAGGGTCCTGGGTCCTGAGG - Exonic
1158602253 18:58864589-58864611 GGGAGGGGGGATGGGCCCTGAGG + Intronic
1159813719 18:73047282-73047304 GGGGGGGGTGGTGGGTCATGAGG + Intergenic
1160090123 18:75819063-75819085 GGGCAGGGTGGCGAGTCCTAGGG - Intergenic
1160510040 18:79448282-79448304 AGGAAGGGTGCTGGGGCCTGGGG + Intronic
1160798588 19:956824-956846 CTGCAGGGTGATGGGGCCTTTGG + Intronic
1160843554 19:1156967-1156989 AGGCAGGGCTGTGGGTCCTGAGG - Intronic
1160995578 19:1880686-1880708 GGGCAGGGTGGTGGGCCAGGAGG - Intronic
1162901124 19:13795928-13795950 AGGCAGGGTTAAGGGTCCTGGGG - Intronic
1162937761 19:13990060-13990082 GGGCTGGATGTGGGGTCCTGCGG + Intronic
1163672673 19:18637688-18637710 GGGGAGGCTGAGGGGGCCTGGGG + Intronic
1163834275 19:19563590-19563612 GGGCAGCGGGAAGGGTCCAGAGG + Exonic
1165015322 19:32876248-32876270 GGGCATGGTGATGGCGCCTATGG - Intergenic
1166144826 19:40826566-40826588 GGGCAGGGTGTGGGGTCCGCAGG - Intronic
1166182916 19:41121641-41121663 GGGCAGGGTGTGGGGTCCGCAGG + Intronic
1166658186 19:44627414-44627436 GGGCTGCATGATGGGTTCTGGGG - Exonic
1167439260 19:49499105-49499127 GAGCAAGGTGAGGAGTCCTGTGG + Intronic
1167461144 19:49625380-49625402 GGGCTGGGGCATGGGGCCTGGGG - Intronic
1167777678 19:51571518-51571540 GGGGTGGGTGATGGGTGCTGTGG + Intronic
1168062214 19:53899181-53899203 GGCCAGGTGAATGGGTCCTGCGG + Intronic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
1168405538 19:56108403-56108425 GGGCAGGGTGGAGGGAGCTGGGG - Intronic
1168522143 19:57060894-57060916 GGGGAGGGTGGTGGGGCCAGTGG - Intergenic
1168641562 19:58034592-58034614 AGGGAGGGAGATGGGTCCGGGGG - Intronic
925034822 2:677072-677094 GGGCGGGGTCCTGGGCCCTGTGG - Intronic
925034843 2:677131-677153 GGGCAGGGTCCTGAGACCTGTGG - Intronic
925122091 2:1427336-1427358 GGGGAGGGTTCTGGGGCCTGCGG + Intronic
925162064 2:1692502-1692524 GAGCAGGGTCATGGGGACTGTGG - Intronic
925526610 2:4809700-4809722 GGGTAGGGGAGTGGGTCCTGTGG + Intergenic
926166069 2:10522690-10522712 GAGCAGGCTGAAGGGTGCTGAGG - Intergenic
926687804 2:15711416-15711438 GCGGAGGCTGATGGGTACTGGGG + Intronic
927475505 2:23411443-23411465 GGGCGAGGTAATGGGTCATGGGG + Intronic
927547971 2:23971627-23971649 GGGCATGGTGGTGTGTGCTGAGG - Intronic
928086771 2:28350869-28350891 GGGGAGGGAGATGGGTCAGGAGG + Intergenic
930199149 2:48535945-48535967 GGGCATGGTGGTGTGCCCTGTGG + Intronic
930541377 2:52711268-52711290 GGCCAGTGTGAGGGGCCCTGAGG - Intergenic
930717235 2:54604504-54604526 GGGCTGGGTGATCCCTCCTGGGG - Intronic
932029847 2:68172233-68172255 AGGCAGGGTGGTGGGTGATGTGG + Intronic
933685409 2:85137313-85137335 GGCAAGGGTGATGGCTCATGGGG - Intronic
933778473 2:85785995-85786017 GGGCAAGGTCATGGGGCCTGTGG - Intronic
935096399 2:99948379-99948401 GGGCAGGGAGATGGAACCCGAGG - Intronic
935629826 2:105204292-105204314 GGGATGGGTGATGGGTGTTGTGG - Intergenic
936487507 2:112938958-112938980 GGTCTGGGTGATGCTTCCTGTGG + Intergenic
937111287 2:119368421-119368443 GGGTATGGTGATGGTTCCTGAGG + Intronic
937305724 2:120869254-120869276 GGTCAGGGGGCTGGGCCCTGGGG + Intronic
937335151 2:121058135-121058157 GTACAGGGTGCTGGGACCTGGGG + Intergenic
938173135 2:129100814-129100836 GGGCAGGGACAAGGGTCATGGGG - Intergenic
939014474 2:136886128-136886150 GGGGAGGGTGATGGGAGCTCAGG + Intronic
939712235 2:145536672-145536694 GGCCAGGAGGATGGTTCCTGTGG - Intergenic
941811134 2:169756995-169757017 GGGCACACTGGTGGGTCCTGAGG - Intronic
941888986 2:170558408-170558430 GGGCATGCTGATGGCTTCTGTGG - Intronic
941932312 2:170954419-170954441 GGGCAGGGTGTTGTTTTCTGTGG + Intronic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
943618123 2:190116856-190116878 GAGTAGGGTGATGGGTCTTGGGG - Intronic
945291281 2:208129817-208129839 GTTCAGTGTGATGGGGCCTGCGG + Exonic
945619174 2:212111759-212111781 AGGCAGGGTGCTAGGTACTGGGG + Intronic
945705962 2:213232092-213232114 GGACATGGTGATGGGCCCTCAGG - Intergenic
946145217 2:217725506-217725528 GGGCAGGCTGATGGGCTTTGCGG - Intronic
946225428 2:218261799-218261821 GGGAGGGGTCCTGGGTCCTGTGG - Intronic
946399801 2:219462240-219462262 GGGCAGAGCCTTGGGTCCTGGGG - Intronic
947989212 2:234473654-234473676 GGGCAGAGAAATGGCTCCTGAGG + Intergenic
948257939 2:236581595-236581617 GAACAGGGTGATGGGCCCTATGG + Exonic
948262336 2:236613500-236613522 GGGCAGTGTTCTGGGTCCTGTGG - Intergenic
948386440 2:237583856-237583878 CGGCAGGGGGATGGCCCCTGCGG + Intronic
948395837 2:237644348-237644370 GGGCAGGGGGATTGGGCCAGAGG + Intronic
948403090 2:237698523-237698545 GGACAGTGTGCTGGCTCCTGGGG + Intronic
948428211 2:237901940-237901962 GGGCACAGTGATGGGGCCTCAGG + Intronic
948432660 2:237929900-237929922 GGGCTAGTTGCTGGGTCCTGGGG + Intergenic
948468355 2:238162779-238162801 GGGTGGGATGATGGGGCCTGGGG - Exonic
948479952 2:238243001-238243023 GGGCAGGGTGGTGGTTGCTGCGG + Intergenic
948530565 2:238600965-238600987 GTGCTGGGTGCTGGGTGCTGGGG - Intergenic
948696885 2:239737285-239737307 GGGAGGGGTGATGAGTCCTGGGG - Intergenic
948753350 2:240144887-240144909 GGACAGGGTGATGGGGGCGGGGG - Intergenic
1169038267 20:2471041-2471063 GGGGAGGGTGATGGGAAATGAGG - Intronic
1169120605 20:3093345-3093367 GGGCCGGCGGAGGGGTCCTGGGG + Intergenic
1169217092 20:3800230-3800252 GGGGTGGGTGATGGGTGCGGAGG + Intronic
1169321215 20:4634709-4634731 GAGGAGGGTAATGAGTCCTGGGG - Intergenic
1169340891 20:4795442-4795464 GGGGAGGGTGCTGGGGCATGGGG + Intronic
1170572621 20:17641058-17641080 GGGCAGGGTGAGGGGCCCCCTGG - Intronic
1170651971 20:18251223-18251245 AGGCTGGGCGATGGGTACTGTGG + Intergenic
1170802854 20:19604485-19604507 GGGCTGGGTGGGGGGTCCTGGGG + Intronic
1170809155 20:19660049-19660071 GGGGAGGGTGATGGGTCAGAGGG - Intronic
1171134074 20:22680907-22680929 TGGCAGTGTCATGGGTCATGGGG - Intergenic
1171307679 20:24120074-24120096 GAGCAGGCTGAAGGATCCTGGGG + Intergenic
1171406380 20:24914862-24914884 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1171406393 20:24914903-24914925 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1171806102 20:29681634-29681656 GATCAGGGTGATGGTTGCTGAGG + Intergenic
1171837957 20:30174787-30174809 GATCAGGGTGATGGTTGCTGAGG - Intergenic
1172094901 20:32455821-32455843 GGGGAGGGGGATGGGTTGTGGGG + Intronic
1172241015 20:33412483-33412505 GGGCAGGGTGAGGTGGCCAGGGG + Intronic
1173101378 20:40091855-40091877 GTGCAGGGTGACAGGTCCTTGGG + Intergenic
1173725811 20:45296969-45296991 GGGCAAGGTGGTGGGCACTGAGG - Intronic
1173906372 20:46632506-46632528 GGACAGGGAGCTGGGACCTGGGG + Intronic
1173991910 20:47310108-47310130 GGGCTTGTTGATGTGTCCTGCGG + Exonic
1174039346 20:47688037-47688059 GGGGAGGGTGCAGGGCCCTGGGG + Intronic
1174181754 20:48679507-48679529 GGGCAGGGTAATGGGGGCAGGGG + Intronic
1174284845 20:49465204-49465226 GGGGAGTGTGATGGGGCCTGGGG + Intronic
1174668659 20:52284784-52284806 GGGCATTGTCATGGGTCCTTTGG + Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175691186 20:61067120-61067142 GAGCAGGGTGCTGGGAGCTGGGG + Intergenic
1175991036 20:62789222-62789244 AGGCCAGGTGATGGGCCCTGGGG + Intergenic
1176623707 21:9074580-9074602 GGGGATGCTGATGTGTCCTGGGG - Intergenic
1178687564 21:34723436-34723458 GGGCAAGGTTCTGGATCCTGAGG + Intergenic
1178961766 21:37072743-37072765 GGGCAGGGAGGGGGGTTCTGGGG + Exonic
1179504334 21:41830934-41830956 GGGCAGGGCGAGGGGACCTGGGG - Intronic
1179938992 21:44626347-44626369 GGGGTGTGTGATGGGGCCTGTGG + Intronic
1180054342 21:45349341-45349363 GGGCTGGGGGAGGGGACCTGGGG + Intergenic
1180882861 22:19218837-19218859 GGGCAGAGTGCTGGGGCCAGGGG - Intronic
1181433646 22:22897759-22897781 GGGCTGGGTGATGGGAACTTGGG - Intergenic
1181821871 22:25482573-25482595 GGGCTCAGTGATTGGTCCTGAGG + Intergenic
1182059225 22:27385137-27385159 AGGCAGAGTGCTGGGTGCTGAGG + Intergenic
1182430085 22:30294175-30294197 GTGCTGGGTGCTGGGTGCTGGGG - Intronic
1182446467 22:30392597-30392619 GGGCAGGGAGCTGGGACCTCAGG - Intronic
1183228741 22:36567760-36567782 GGACACGGAGCTGGGTCCTGAGG - Intronic
1183282516 22:36939273-36939295 GGGCAGGCTGGCGGGACCTGGGG + Exonic
1183478845 22:38051835-38051857 GGGAAAGGTGATGGGTGCAGTGG - Intergenic
1183788120 22:40043684-40043706 GGGGAGAGGAATGGGTCCTGGGG + Intergenic
1183830693 22:40417154-40417176 GGGCACGCCCATGGGTCCTGTGG - Intronic
1184110177 22:42389653-42389675 GGGCTGGGTGTTGGGGGCTGGGG + Intronic
1184152401 22:42646582-42646604 GGGCAGGGAGCTGGCACCTGGGG - Intronic
1184477325 22:44728812-44728834 GGGCAGGGGGCAAGGTCCTGGGG - Intronic
1184522102 22:45000812-45000834 GGGCAGGGGGGTGGTTCCTGTGG + Intronic
1184803667 22:46777667-46777689 GCTCAGTGTGATGAGTCCTGAGG + Intronic
1185182650 22:49372174-49372196 GGGCTGGCAGATGGGTGCTGTGG + Intergenic
949397335 3:3629011-3629033 TGGGAGGGTGATGCATCCTGAGG - Intergenic
949441178 3:4082327-4082349 GGGCATGGTGATGCACCCTGTGG + Intronic
950098952 3:10345755-10345777 GGCCAGGGTGAGGCTTCCTGAGG - Intronic
952845257 3:37682859-37682881 GGCCAGGGTGATGGCAGCTGAGG - Intronic
953738291 3:45514809-45514831 GGGCAGGGTAAAGGGGCCAGTGG + Intronic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
953916993 3:46926631-46926653 CGGCAGGGCGAGAGGTCCTGGGG + Intronic
954092608 3:48297066-48297088 GGTCTGAGTGGTGGGTCCTGTGG - Intronic
954211460 3:49099903-49099925 GAGCAGGGCGATGGGCCATGGGG - Intronic
954689092 3:52386416-52386438 GGGCAGGCTGCTGGGTCCCAGGG - Intronic
956154959 3:66285842-66285864 GGGCAGGGTGCTTGTTTCTGTGG - Intronic
958050575 3:88339203-88339225 GGGAAGGGTAATGGGAACTGGGG - Intergenic
960325974 3:116296540-116296562 GGGCATGGTGGTGGGTGCCGTGG + Intronic
960936974 3:122910469-122910491 GGGCAGGGTGAAGAGTGCAGGGG - Intronic
966002365 3:174965884-174965906 AGGCAAGGAGAGGGGTCCTGGGG + Intronic
967460833 3:189744216-189744238 GGGCAGTGAGATTTGTCCTGAGG - Intronic
968225661 3:196970415-196970437 GGGCATGGTGGCGGGGCCTGTGG - Intergenic
968487751 4:872074-872096 GGGCAGGGAGACGGGCCCGGCGG + Intronic
968540645 4:1166594-1166616 GGGCAGAGTGAGGGCTTCTGGGG + Intergenic
968584360 4:1409246-1409268 GGGCCGGGTGGTGGAGCCTGAGG + Intergenic
968608040 4:1544857-1544879 GGGCAGGGTGGTAGGTGCTGGGG + Intergenic
968695875 4:2026223-2026245 ACGCAGGGTGCTGTGTCCTGAGG + Intronic
968815551 4:2819881-2819903 GGGCATGATGTTGGGTCCTGTGG + Intronic
969287064 4:6209451-6209473 GGGCAGGGAGATGGGACCAGGGG + Intergenic
969426536 4:7127761-7127783 GGGGAGGGTGCCGGGACCTGCGG + Intergenic
969495441 4:7523648-7523670 GGTCAGTGTGATGGATGCTGTGG - Intronic
971060135 4:22958719-22958741 GGGCAGTGAAATGGGACCTGGGG + Intergenic
972390721 4:38610444-38610466 GGGCTGAGTGTGGGGTCCTGAGG + Intergenic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
972648479 4:40992760-40992782 GAGGAAGGTGATGGGTCCTGAGG - Intronic
974080016 4:57202514-57202536 GGGCATGGTGGTGTGTGCTGTGG + Intergenic
975629290 4:76383357-76383379 GGGCATGGTGAGGGGGTCTGTGG - Intronic
975646996 4:76555403-76555425 AGGCAGGGTGCTGGTTCTTGAGG + Intronic
978339558 4:107707533-107707555 GGGCCTGGTGTTGGGTTCTGAGG + Intronic
979888911 4:126065192-126065214 GGTCCTGGGGATGGGTCCTGAGG + Intergenic
980981794 4:139660617-139660639 GGGCAGGGTGGTGACACCTGTGG + Intergenic
984497352 4:180515470-180515492 GGGCACTGTGCTGGGTACTGAGG + Intergenic
984715198 4:182917966-182917988 GGGCAGGGAACTGGGTCCGGCGG + Intergenic
984951876 4:185014135-185014157 CGGCAGTGAGAGGGGTCCTGGGG - Intergenic
985493678 5:193142-193164 GTGCCCAGTGATGGGTCCTGGGG + Intronic
985589012 5:755248-755270 GGGGAGGGTGTTGAGGCCTGTGG + Intronic
985603692 5:847764-847786 GGGGAGGGTGTTGAGGCCTGTGG + Intronic
985895712 5:2749145-2749167 GGGCGAGGTGAGGGGTCCCGTGG - Intronic
987031621 5:13981350-13981372 AGGCACGGTGCTGGGTGCTGGGG - Intergenic
988032243 5:25777917-25777939 GGGCATGGTGACGGGCGCTGTGG + Intergenic
988895493 5:35668539-35668561 GGGCAACATGATGGGTTCTGTGG + Intronic
990541026 5:56772343-56772365 GGGTAGGGTGATGGGAGTTGAGG - Intergenic
991532725 5:67633792-67633814 GGGCAAGGAGTTGAGTCCTGAGG + Intergenic
991550614 5:67831828-67831850 GGGGACGGTTAGGGGTCCTGGGG + Intergenic
994992477 5:107014951-107014973 TTGCAGGGTGATGGGGTCTGAGG - Intergenic
996213593 5:120840839-120840861 GGTTAGGGGGTTGGGTCCTGTGG + Intergenic
997361236 5:133296488-133296510 GGGCAGGGTCAAAGGTCCTGGGG - Intronic
999133869 5:149304691-149304713 GGGAAGGGTGAGGGGGCGTGGGG - Intronic
999804273 5:155067399-155067421 TGGCAGAGTGCAGGGTCCTGAGG + Intergenic
999972217 5:156876178-156876200 CAGGAGGGTGATGTGTCCTGAGG - Intergenic
1000015647 5:157273363-157273385 GGGTGGGGTGATAGGTTCTGAGG - Intronic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1000154033 5:158533260-158533282 GTCCAGGGTGATGGGACCTGAGG - Intergenic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1002052804 5:176581201-176581223 GGGCTGGGAGATGGGCCCAGGGG + Intronic
1002095978 5:176831331-176831353 GGACAGGGAGAGGGGCCCTGGGG - Intronic
1002692647 5:181060922-181060944 GGGCATGGTGTTGTGTGCTGAGG - Exonic
1003128519 6:3375542-3375564 GGGCAGGGATATGAGTTCTGGGG + Intronic
1004427616 6:15517020-15517042 GGCCCGGGTGGTGGGTGCTGGGG + Intronic
1005972225 6:30770373-30770395 GGGCACTGTGATGGGTGCTAGGG - Intergenic
1006982090 6:38154950-38154972 GGGGTGGGTGCTGGGTCCTGAGG + Intergenic
1007341695 6:41194682-41194704 AGGCAAGGTGATGAGTCCTGGGG + Exonic
1007607955 6:43129946-43129968 GGGCAGGGTGAAGAGCACTGTGG - Intronic
1011627699 6:89296737-89296759 GAGCAGCGTGATGGGGACTGTGG + Intronic
1011814427 6:91171764-91171786 GGGCAGGGGGTGGGGTCCGGGGG + Intergenic
1012208450 6:96490406-96490428 GAGCAGAGTAATGGGTCCTTTGG - Intergenic
1013051244 6:106537753-106537775 AGTCAGGATGATGGTTCCTGGGG - Intronic
1014247746 6:119084923-119084945 GAGCAGGGAGCAGGGTCCTGAGG + Intronic
1016002194 6:139053062-139053084 GGGAAGGGTAATGGGACCGGGGG + Intergenic
1016439497 6:144068483-144068505 AGGCAGGGAGATGGCTGCTGGGG - Intergenic
1016612905 6:146012855-146012877 GGGCTGGGGGATGGGTGGTGGGG - Intergenic
1016632896 6:146252494-146252516 AGGCATGGTGGTGGGTGCTGAGG + Intronic
1016876593 6:148871364-148871386 GGGCATTGTGCTGGATCCTGGGG - Intronic
1017827313 6:158091459-158091481 GGGCTGGGTGCTGGGTGCAGTGG + Intronic
1017874475 6:158513612-158513634 GGGCATGGTGGTGGGTGCGGTGG - Intergenic
1018085789 6:160300270-160300292 GGGCATGGTGCTGGGCCCCGGGG + Intergenic
1018349760 6:162943949-162943971 GGGCAGGTGGGTGGGTCCTCAGG - Intronic
1020788406 7:12595471-12595493 GGGTGGGGGGAGGGGTCCTGGGG + Intronic
1022443294 7:30451107-30451129 GGCCATGGTCATGAGTCCTGGGG + Intronic
1022471166 7:30682581-30682603 GGGCAGGGTGGAGGGCCCGGGGG - Intronic
1022502233 7:30889042-30889064 GGGCGGGGTGAAGGGGCCTGGGG + Intronic
1022943775 7:35262220-35262242 AGGCTGGGGGCTGGGTCCTGAGG + Intergenic
1023274104 7:38499551-38499573 CTGGAGGGTCATGGGTCCTGGGG - Intronic
1023352662 7:39335857-39335879 GGGCAGGGCGTTGGGAACTGTGG - Intronic
1023822206 7:43986547-43986569 GGGCAGGGGGCTGGGGCCTGGGG - Intergenic
1023847359 7:44129932-44129954 GTGGAGGGTGCTGGGTGCTGAGG - Intergenic
1023940044 7:44763365-44763387 GGGCAGGGAGCTGGATCCTGCGG - Exonic
1024061990 7:45704857-45704879 GGGCAGGGTGAGGGTTCTAGGGG - Intronic
1024237210 7:47407828-47407850 GGGCAGGGTGGTTTCTCCTGAGG - Intronic
1024248442 7:47488439-47488461 GGGCAGGGTGGTTCCTCCTGAGG + Intronic
1024510118 7:50197324-50197346 GGACTGGGCCATGGGTCCTGAGG - Intergenic
1024559646 7:50632408-50632430 GGGCAGTGTGCTGCGTCCTGGGG - Intronic
1024985874 7:55192631-55192653 GGCCTGGGGGACGGGTCCTGGGG + Intronic
1025198404 7:56948591-56948613 GGGGAGGGCGGTGGGTCCGGGGG - Intergenic
1025286457 7:57666260-57666282 GATCAGGGTGATGGTTGCTGAGG - Intergenic
1025854763 7:65267244-65267266 GGGCAGAATCATGGATCCTGGGG + Intergenic
1026298319 7:69075653-69075675 GGGCAGGGTGGTGGGTTCCTGGG + Intergenic
1026869296 7:73840985-73841007 GGGCAGGGTTCTGGGGCCAGGGG + Intronic
1027186041 7:75971498-75971520 GGGCGGGGTGAGGGGTGGTGCGG + Intronic
1028895865 7:96040861-96040883 GGGCATGGTGGTGTGTGCTGTGG - Intronic
1029272313 7:99384603-99384625 GGCCTGGGTGATGGCTCTTGGGG - Intronic
1029436511 7:100566933-100566955 GGGAAGGGTGATGGAAGCTGGGG - Exonic
1029650846 7:101890321-101890343 GGACAGGGTGTTAGGTCCAGAGG + Intronic
1029750472 7:102539961-102539983 GGGCAGGGGGCTGGGGCCTGGGG - Intronic
1029768424 7:102639069-102639091 GGGCAGGGGGCTGGGGCCTGGGG - Intronic
1029822693 7:103160506-103160528 GGGAATGGTGAAGGGTACTGGGG - Intergenic
1034085869 7:148322017-148322039 GGGGAGGGGGACGGGTGCTGAGG - Intronic
1034268286 7:149791532-149791554 GAGCAGGGTTGTGGGGCCTGGGG + Intergenic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1034386828 7:150747370-150747392 GGGCAGGGTCATGAGACATGTGG - Intronic
1034688859 7:152998089-152998111 GTGCAGGGTGAAGGATGCTGAGG + Intergenic
1034937496 7:155209495-155209517 GGCCAGGATGGGGGGTCCTGGGG - Intergenic
1035170249 7:157013311-157013333 GGGCAGATTGCTTGGTCCTGAGG + Intergenic
1035261972 7:157667728-157667750 GGGGAGGGTGTTAGGTCGTGAGG - Intronic
1035300978 7:157896979-157897001 GGGTGGGGAGGTGGGTCCTGTGG - Intronic
1035409857 7:158630886-158630908 GGGTATTGGGATGGGTCCTGTGG - Intergenic
1035565973 8:641708-641730 GGGGAGGGGGAGGGGTCCTCCGG - Intronic
1035987615 8:4452099-4452121 GGGCAGTGTGATGCTTCCAGAGG + Intronic
1036627138 8:10481588-10481610 GGGCAGGATGGTGGGTAATGCGG - Intergenic
1037647220 8:20803480-20803502 GAGGAGGGTGAGGGCTCCTGAGG + Intergenic
1037878597 8:22561717-22561739 GGGCAGGGTGGTTGGTGCTCAGG - Intronic
1038269791 8:26065936-26065958 CTGTAGGGGGATGGGTCCTGAGG - Intergenic
1038419379 8:27422534-27422556 GGGCTGGGTGTTGGGTCTTCAGG + Intronic
1039550414 8:38439321-38439343 AGGCAGGGTGCTGTCTCCTGTGG - Intronic
1041770477 8:61467469-61467491 GGCCATGGTGATGGGTTCAGAGG - Intronic
1041931797 8:63295203-63295225 GGGAAGGGATATTGGTCCTGGGG + Intergenic
1043729258 8:83653566-83653588 GGGCATGGTGATGGCACCTGTGG + Intergenic
1044744879 8:95362277-95362299 GGGGAAGGTGATGGGGGCTGAGG + Intergenic
1044806959 8:96018177-96018199 TGGCAGGGCTATGAGTCCTGAGG + Intergenic
1045244656 8:100432564-100432586 TGGCAGGGTGAAGGGTCTGGGGG - Intergenic
1046727368 8:117690241-117690263 GGGCAGGGTGATGTGATCTCTGG + Intergenic
1047548945 8:125848789-125848811 GGGCAGGGTGAATGCTACTGTGG - Intergenic
1048496844 8:134942498-134942520 GGGCCAGGTCATGGGTTCTGGGG + Intergenic
1049037411 8:140087255-140087277 CTGCAGGGTGATGGGGCCGGGGG - Intronic
1049088472 8:140495713-140495735 GGGCAGGGGGCTGGGGCCGGAGG - Intergenic
1049219828 8:141424114-141424136 AGGCAGGGTGCTGGGCTCTGTGG - Intronic
1049298156 8:141854842-141854864 GGGCTGGGGGAGGTGTCCTGGGG + Intergenic
1049410736 8:142472947-142472969 GGGCAGGGTGATCCATCCTCTGG + Intronic
1049551324 8:143261300-143261322 GGGGAGGAAGATGGGCCCTGGGG + Intronic
1049586391 8:143434510-143434532 GGGCAGGGGGGTGCGTCATGAGG + Intergenic
1049844607 8:144793672-144793694 GGGCAGGGTGAGGGGTTCTGGGG + Intergenic
1053285139 9:36845274-36845296 GGGTAGGGAGATGAGTCTTGAGG - Intronic
1053515724 9:38729211-38729233 GGGCACTGTGCTGGGTTCTGAGG + Intergenic
1054459758 9:65456299-65456321 GGGCAGGGGCATACGTCCTGCGG + Intergenic
1057584223 9:96315087-96315109 TGGCAGCGTGAGGAGTCCTGTGG - Intergenic
1057804552 9:98210982-98211004 GGGAAAGGAGATGGGCCCTGAGG + Intronic
1059454496 9:114390978-114391000 GGCCTGTGTGCTGGGTCCTGGGG - Intronic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1060205727 9:121681743-121681765 GGGCTGGGTGCTGGGAGCTGAGG + Intronic
1060549404 9:124477956-124477978 GGGCCGGGTGGGGGGTCCGGAGG - Intronic
1060977239 9:127771725-127771747 GGGCCTGATGATGGGTCCTGGGG - Intronic
1061476123 9:130867812-130867834 GGCCAGGGAGATGAGTTCTGGGG + Intronic
1061618263 9:131794143-131794165 GAGCAGGGTGAGGGGCCATGTGG + Intergenic
1061896789 9:133652406-133652428 GGGCAGGGGGAGGGTGCCTGTGG + Intronic
1061939151 9:133874803-133874825 GGGGAGGGAGATGGATCCTAGGG - Intronic
1062008537 9:134254475-134254497 TGGTAGGGTGGTGGGTGCTGTGG + Intergenic
1062107514 9:134763997-134764019 GGGCAGCGTGGTGGGGTCTGGGG + Intronic
1062136786 9:134933372-134933394 GGGCAGGGTGGGGGGTCAGGGGG - Intergenic
1062165578 9:135105752-135105774 GGGCAGGGTGCGGGGACTTGTGG + Intronic
1062326378 9:136014442-136014464 GGGCATGGTGGTGGCGCCTGTGG - Intronic
1062425341 9:136503664-136503686 GGGCCTGGGGATGGCTCCTGGGG - Intronic
1062443824 9:136585108-136585130 GGACAGGGAGATGGGGCCAGTGG + Intergenic
1062468708 9:136692708-136692730 GGGCAGGGGCCTGTGTCCTGGGG + Intergenic
1062579121 9:137221865-137221887 GGGGAGGGGGTTGGGTTCTGAGG - Intergenic
1185464453 X:346390-346412 GGGCAGAGGGAAGGGCCCTGCGG + Intronic
1187372802 X:18724768-18724790 GGGCAGGGTGGGGGGTTATGGGG + Intronic
1187737173 X:22316868-22316890 GGGCAGAGTGAAGGGGCTTGCGG - Intergenic
1189504133 X:41594220-41594242 AGGCAGAATGAGGGGTCCTGGGG - Intronic
1190823157 X:53993410-53993432 GGGCACTGTGATAGGTGCTGTGG - Intronic
1191102054 X:56740979-56741001 GGGAAGGGTAATGGGTGGTGGGG - Intergenic
1192191206 X:68992204-68992226 AGGCAGGGTGCTGGGCACTGGGG + Intergenic
1193835863 X:86342856-86342878 GGTCAGGGTGGTGGCTGCTGAGG - Intronic
1194972798 X:100362655-100362677 GGGCGTGGTGGTGGGTGCTGTGG + Intronic
1195253473 X:103070767-103070789 GATCAGGGTGATGGTTGCTGAGG - Intergenic
1195954675 X:110317279-110317301 GGGCAGGGTGAGGGGTGGTGGGG + Intronic
1196458078 X:115903775-115903797 GGGCAGAGTGAGTGGACCTGGGG - Intergenic
1196882321 X:120209395-120209417 GAGCAGGGTGTCAGGTCCTGGGG - Intergenic
1197372337 X:125640310-125640332 GGTGATGGAGATGGGTCCTGAGG + Intergenic
1197745964 X:129932390-129932412 GGGCGGGGCGCTGGGACCTGGGG - Intergenic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1199934490 X:152558915-152558937 GGGCCTGGTGTTGGGTCATGGGG - Intergenic
1199980596 X:152918424-152918446 GGAAAGGGTCATGGGTCGTGAGG + Intronic
1201060102 Y:10037316-10037338 GGGCTGGGTGTGGGGTGCTGTGG - Intergenic
1201562017 Y:15327989-15328011 GGGCAGGCTGCTGGGGCCTTGGG - Intergenic
1201867832 Y:18673554-18673576 GGGCAGGGTGGTGCGTCCTGGGG - Intergenic