ID: 953918287

View in Genome Browser
Species Human (GRCh38)
Location 3:46934715-46934737
Sequence AGGCCTATTCCCAAGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953918279_953918287 18 Left 953918279 3:46934674-46934696 CCTTAAACCAGTTCTCTCTTGAT 0: 1
1: 0
2: 2
3: 15
4: 208
Right 953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG 0: 1
1: 0
2: 3
3: 13
4: 155
953918278_953918287 25 Left 953918278 3:46934667-46934689 CCATCTTCCTTAAACCAGTTCTC 0: 1
1: 0
2: 0
3: 20
4: 300
Right 953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG 0: 1
1: 0
2: 3
3: 13
4: 155
953918280_953918287 11 Left 953918280 3:46934681-46934703 CCAGTTCTCTCTTGATTCATTCT 0: 1
1: 0
2: 4
3: 43
4: 466
Right 953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG 0: 1
1: 0
2: 3
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953918287 Original CRISPR AGGCCTATTCCCAAGAAACA GGG Intronic
901618899 1:10565391-10565413 AGGGCTATACCCTAGGAACATGG - Intronic
904942296 1:34172805-34172827 AGGCCCATTCCCATGAAACATGG + Intronic
907752215 1:57273399-57273421 AGGCCCTTTCCCAGGAGACAGGG + Intronic
909377505 1:74956993-74957015 AGGCCCATTCCCATAAGACATGG + Intergenic
910354378 1:86339427-86339449 AGGCCCACTCCCAAGGCACAAGG + Intergenic
910569852 1:88687471-88687493 AAGTCTATTTCCAAGAAACCTGG + Intronic
910629868 1:89343564-89343586 AGGCCCAATCCCATGAACCAAGG + Intergenic
910786866 1:91008445-91008467 AGGGCTATTCCCAAGAACTCTGG + Intronic
917055579 1:170978101-170978123 AGCTCTACTTCCAAGAAACATGG + Intronic
919078600 1:192842188-192842210 AGTCCTCTGCCCAAAAAACAAGG - Intergenic
919528402 1:198682779-198682801 AGGCCTATGCCTAACAAAAATGG - Intronic
923106403 1:230857177-230857199 AGGCCTATTCCCAAGAAGCGGGG + Intronic
1063929138 10:11011557-11011579 TGCCCTATTCCTATGAAACAGGG + Intronic
1070279627 10:75038956-75038978 AGGCCTATTGAGAAGAATCAAGG + Intronic
1070686775 10:78490703-78490725 AGAACTATTCCCAAGAAATAAGG + Intergenic
1071994091 10:91129988-91130010 AGGGCCTTTTCCAAGAAACAAGG - Intergenic
1073729817 10:106274274-106274296 AGGCCCATTCCCATGAACTAGGG + Intergenic
1074780300 10:116797672-116797694 AGGGCTTTTCCCTGGAAACAGGG - Intergenic
1075229040 10:120656674-120656696 AGGCATTTACCCAAGAAAAATGG - Intergenic
1077460563 11:2707242-2707264 AGGCCTGTCCCCAAGACCCAGGG - Intronic
1077541591 11:3149115-3149137 AGGGCTATTGCTAAGACACAGGG - Intronic
1079394245 11:20048433-20048455 AGGCCTATTCACATGACACTGGG - Intronic
1079622387 11:22569717-22569739 AGGCCTTTTCTCATGACACAAGG + Intergenic
1080944282 11:36953514-36953536 AGTCTTATTCCCATGTAACAGGG - Intergenic
1082748827 11:56996603-56996625 AGGCCCAATCCCATGAACCAGGG - Intergenic
1084564059 11:69919741-69919763 AGGACTATTCCCAAGAGCCCTGG - Intergenic
1085071915 11:73554570-73554592 AGGCATTTTTCCAAAAAACAAGG + Intronic
1086559245 11:88148084-88148106 AGGAAGAATCCCAAGAAACAGGG + Intronic
1086915552 11:92526186-92526208 AGGCCTGTTCCGCAGAAGCATGG - Intronic
1088885327 11:114001492-114001514 AGGCCTATTCCTGGGAGACAGGG + Intergenic
1090044507 11:123319160-123319182 GGACCTTTTTCCAAGAAACATGG - Intergenic
1093903164 12:24660231-24660253 AAGCCTTTTTCCAAGAAAGATGG - Intergenic
1101976043 12:109359739-109359761 AGGCCTTTTCGCAACAATCATGG - Intronic
1103143264 12:118570889-118570911 GGGCCTATTCCCAACAGAGATGG - Intergenic
1103265064 12:119622779-119622801 AGCCCTTTTCCCAAGTACCAGGG + Intronic
1104317650 12:127719092-127719114 AGGCCTATTGCAGAGAAAAAAGG - Intergenic
1104960895 12:132488353-132488375 AGGCCTCTTCCCAAGTAGCCTGG - Intergenic
1106842475 13:33699070-33699092 AGTCCTGTTCCCAAGTACCAGGG - Intergenic
1108131094 13:47301065-47301087 TGGACTCTTCCCAAGTAACAGGG - Intergenic
1108455657 13:50611198-50611220 AGCCATATGCCCAAGAACCAGGG - Intronic
1108847221 13:54692905-54692927 AGGCCCAATCCCATGAACCAAGG - Intergenic
1112893045 13:104262402-104262424 AGGCTTATTTTCAAGAGACAGGG - Intergenic
1113175626 13:107560073-107560095 AGCCCTAATCCCAAAAAACTTGG - Intronic
1113533750 13:111048171-111048193 AATCCTATTCCTAAGAAAGAGGG - Intergenic
1113980110 13:114267768-114267790 AGTCCTCCTCCCATGAAACATGG + Intronic
1114237698 14:20836645-20836667 AGGCCCAGTCCCAAGGCACAAGG - Intergenic
1114773743 14:25457987-25458009 AGGCCCAGTCCCAAGGCACAAGG + Intergenic
1116013677 14:39380879-39380901 GGGCCTATTCCGAAGAGACTAGG + Intronic
1116767664 14:49092163-49092185 AGGAGTATTCCCAAGAAAAAGGG + Intergenic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118941601 14:70344709-70344731 AGGCCCAGTCCCAAGGCACAAGG + Intronic
1120151101 14:81035009-81035031 GGGCCAATTCCCAAAAAACAGGG + Intronic
1120442612 14:84559285-84559307 AGGCCCAATCCCAAGAACTAGGG - Intergenic
1122506026 14:102232417-102232439 AGCGCGATTCCCAAGAACCAGGG + Intronic
1123968218 15:25480164-25480186 AGGCAAGTGCCCAAGAAACAAGG + Intergenic
1126463419 15:48938063-48938085 AGGCCTAATCCTAGGAAACCAGG + Intronic
1127304084 15:57684939-57684961 AGGCCTGTCCACAAGAAGCATGG + Exonic
1128925376 15:71650562-71650584 AGGCCCAGTCCCAAGGCACAAGG + Intronic
1129679733 15:77651821-77651843 AGCCCTTTTCCCTTGAAACAAGG - Intronic
1129681481 15:77660849-77660871 AGGCCTCTTCCCAAGACAGGCGG + Intronic
1130716714 15:86341795-86341817 TGGCCTACTCACAAGTAACAAGG - Intronic
1131091279 15:89626507-89626529 AATCCTATTCCCAAAAGACAAGG + Intronic
1131262952 15:90898236-90898258 AGGGCCATTCCTAAGGAACAAGG + Intergenic
1131324586 15:91430066-91430088 AGGCCCAGTCCCAAGGCACAAGG + Intergenic
1135209716 16:20514384-20514406 AGTCCTTTTAGCAAGAAACAAGG + Intergenic
1139370268 16:66463139-66463161 AGGCATATACCCAAGAAAAATGG - Intronic
1140041768 16:71412847-71412869 AGCCCTGTTCCCAAGAGAGATGG - Intergenic
1141311698 16:82919632-82919654 AGCACTATTCACAATAAACATGG - Intronic
1148700111 17:49582035-49582057 AGGGCTATTCCAAAGAATTAAGG - Intronic
1149621015 17:58045072-58045094 AAGCTATTTCCCAAGAAACATGG - Intergenic
1153102317 18:1487773-1487795 AGGAATAATCTCAAGAAACAAGG + Intergenic
1153903243 18:9637494-9637516 AGGCAAATGCCCAAGAAACCAGG + Intergenic
1155804178 18:30145223-30145245 AGGCCCAGTCCCAAGGCACAAGG + Intergenic
1159277046 18:66234580-66234602 AGGCCTATGCAGAAGAAAAATGG + Intergenic
1163742695 19:19025906-19025928 AGTCTTGTTCCCAAGAACCACGG + Exonic
1163921409 19:20293229-20293251 AGGCATATTCTCAAGATGCAGGG + Intergenic
1163939743 19:20480642-20480664 AGGCCCAGTCCCAAGGTACAAGG - Intergenic
1163970646 19:20790669-20790691 AGGCATATTCTCAAGATGCAGGG + Intronic
1165241747 19:34474344-34474366 TGGCCTACACCCAAGGAACATGG + Intergenic
1168716060 19:58528078-58528100 AGGCCCAGTCCCAAGATGCAAGG + Intronic
927376409 2:22420035-22420057 AGGCCCAGTCCCAAGGCACAAGG - Intergenic
928481549 2:31689290-31689312 AAGCCCAACCCCAAGAAACAAGG - Intergenic
930302686 2:49637249-49637271 AGAACTGTTCCCATGAAACAAGG + Intergenic
933429795 2:82161559-82161581 AGGCATTTTCCCAAGCAACAAGG + Intergenic
934966151 2:98724663-98724685 AGGCCTTTACATAAGAAACAAGG + Intronic
937141602 2:119606441-119606463 AGGGCCATTCCCCAGAGACAGGG - Intronic
940763242 2:157761615-157761637 AGGCCTTTTCTCTAGAATCATGG + Intronic
943466146 2:188231304-188231326 GGGCCTATTCCCAACAAACAAGG + Intergenic
944007985 2:194935139-194935161 AGGCCACTTCCCAAGAACCAAGG - Intergenic
1169834543 20:9863422-9863444 AGGTCTCTTCACAAGAAAGATGG + Intergenic
1170792347 20:19518495-19518517 AGGCAGATTCCAAAGAAGCATGG + Intronic
1173559905 20:43995941-43995963 AGGACTATTCACAACAAACATGG - Intronic
1175722382 20:61294939-61294961 AGGCCTCTGCCCCAAAAACACGG + Intronic
1178097159 21:29228396-29228418 AGGCATATTGCCTAGAAACATGG + Intronic
1181995526 22:26878583-26878605 ATGCCAATGCCCCAGAAACAGGG - Intergenic
1183189230 22:36311035-36311057 AGGTCTGTTCCCAAGCCACAAGG - Intronic
950258239 3:11523399-11523421 AGGCCTAGACAGAAGAAACAGGG + Intronic
950395081 3:12727962-12727984 AGGCCCATTCCTAGGAGACATGG - Intergenic
953240123 3:41141209-41141231 AGGCCAATTCAAAAGAAACCGGG - Intergenic
953722135 3:45365598-45365620 GAGTCTATTCCCAAGAAGCAAGG + Intergenic
953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG + Intronic
956198546 3:66679160-66679182 GGGTTTATTCCCAAGATACAAGG - Intergenic
956529096 3:70197607-70197629 AAGCCTAGTGACAAGAAACAGGG - Intergenic
956876987 3:73473753-73473775 AGGCCTCTTGCCAAGAGCCATGG + Intronic
961308436 3:125976189-125976211 TGGCCAATTCCCAGGAAATATGG + Intronic
961638821 3:128351907-128351929 AGGACTGTTCCCTAGAAGCAAGG + Intronic
964820266 3:160761118-160761140 AGACATATTCCCCAGAAAAAAGG + Intronic
965315419 3:167183891-167183913 GGGCCTGTTCCCAACAAAAAAGG + Intergenic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
970084033 4:12325176-12325198 AGCCCTAATCACAAGGAACATGG + Intergenic
970794453 4:19894037-19894059 AGGCCCATTCCCAAGGCACAAGG + Intergenic
972992722 4:44841676-44841698 AGTCCTATTACCATGAAAAAAGG + Intergenic
973051689 4:45606994-45607016 AGGCCCAGTCCCAAGGCACAAGG + Intergenic
974538344 4:63198359-63198381 AGGACTATTGCCAAGGAAAAAGG - Intergenic
974745196 4:66063766-66063788 AAGCCTATTCTAAAGAAAAAAGG + Intergenic
974949351 4:68569601-68569623 AGGCCCAGTCCCAAGATGCAAGG + Intronic
975964660 4:79956826-79956848 AGTTTTATTCCCAAGAAGCAAGG + Intronic
977638487 4:99328250-99328272 GGGCCTGTTCCCAACAGACAGGG + Intergenic
978905541 4:114001338-114001360 AGGGCTAACCCCAAGAAAAAAGG + Intergenic
979448614 4:120842378-120842400 AAGCCTTTTCCCAAGTGACAAGG + Intronic
979979196 4:127234040-127234062 AGGCCTAGTTCCAATACACATGG + Intergenic
983421388 4:167522385-167522407 AAACTTATTCCCAAGTAACATGG - Intergenic
984476421 4:180241322-180241344 TGGACTCTTCCCAAGAACCAGGG - Intergenic
986077676 5:4354755-4354777 TGGGTTATCCCCAAGAAACAGGG - Intergenic
987562173 5:19538715-19538737 AGGCCTACTCACAAGAAGGAAGG + Intronic
993547308 5:89229359-89229381 AGGCCTATCCCCAAAGATCAAGG - Intergenic
995105382 5:108371523-108371545 TGGCCCATTCACAAGAAAAAAGG + Intronic
997771269 5:136556588-136556610 AGCTCTAGTCCCAAGAAATAAGG + Intergenic
998093409 5:139383704-139383726 TGGCCTTGTGCCAAGAAACATGG + Intronic
1000524221 5:162335448-162335470 AGGACTATTCGCATGAAAAATGG - Intergenic
1001018206 5:168160699-168160721 AGGCATCTTCCTAAGAAGCAAGG - Intronic
1001829520 5:174773913-174773935 AAGCCCATTCCCAAGAGAGAGGG - Intergenic
1005297761 6:24443390-24443412 GTGCCTAATCACAAGAAACACGG + Intronic
1005873518 6:29994762-29994784 AGGCCTATGCCCAAGACAAGGGG - Intergenic
1010036108 6:71327738-71327760 AGGCCCAATCTCAACAAACATGG - Intergenic
1011029499 6:82906581-82906603 AGCCATTTTCCCAAGAAACATGG + Intronic
1013798054 6:113907687-113907709 AGCCCTATTCCCTAGAATAAGGG - Intergenic
1016512484 6:144859179-144859201 AGGCAAAGTCACAAGAAACATGG - Intergenic
1018000928 6:159577859-159577881 AGGCTTCTTCCCAGGAACCAGGG + Intergenic
1020494029 7:8824336-8824358 AGGAATATTTCCAAGAAAAAAGG - Intergenic
1021546012 7:21813552-21813574 TGGCATATTCCTAAGAAAAAAGG - Intronic
1021631732 7:22654116-22654138 AGCTCTGTTGCCAAGAAACAAGG - Intergenic
1023340326 7:39212609-39212631 AGGCCAAAGCCCAATAAACATGG - Intronic
1023980610 7:45067890-45067912 AGGCCAATCCCCAGGAAGCAGGG - Intronic
1024908637 7:54419617-54419639 GGTCGTATTCCCAAGAAGCAGGG + Intergenic
1029803318 7:102973267-102973289 AGGCCCAGTCCCAAGGCACAAGG + Intronic
1032019421 7:128398779-128398801 AGCCCTCTTCCCAAGGAACAGGG + Intronic
1037689010 8:21167278-21167300 AGGCATGTTCCCAAGATCCAGGG - Intergenic
1039244656 8:35595696-35595718 AGGCCTGTTCCCAAGAGGGAGGG + Intronic
1041872847 8:62654776-62654798 AGGCTTTTTTCCATGAAACAAGG + Intronic
1042157653 8:65863292-65863314 AGGCCCAGTCCCAAGGCACAAGG + Intergenic
1042285186 8:67101847-67101869 AGGACTATTACAAAGAAATATGG - Intronic
1043372376 8:79610427-79610449 ATCCCTATTCCCAAGCAACCAGG + Intergenic
1044254350 8:90042912-90042934 AGGCCTCTTCCCTAGAACCAGGG - Intronic
1045791060 8:105985093-105985115 AGTACTATTCACAATAAACAAGG + Intergenic
1047825980 8:128575725-128575747 AGGGCAATTCCCTAGAAAAATGG - Intergenic
1048717826 8:137287479-137287501 AGGCCCAGTCCCAAGACACAAGG + Intergenic
1050981388 9:12020286-12020308 AGTCCTATCCCCAAGGTACAGGG - Intergenic
1057951552 9:99373111-99373133 AGACCTGTCTCCAAGAAACAGGG + Intergenic
1059433244 9:114262195-114262217 AGGCCTGTGCCCATGAATCACGG + Intronic
1186627515 X:11310324-11310346 AGGTATATACCCAAGAAATATGG + Intronic
1188593033 X:31862797-31862819 AGGCCCATTCCTAAGGCACAAGG + Intronic
1192946577 X:75969769-75969791 AGGCCCAGTCCCAAGGCACAAGG - Intergenic
1193240666 X:79165522-79165544 AGGCTTATCCTCAAGAAAAAAGG + Intergenic
1193721275 X:84990357-84990379 AGGCAAATTCCTAAGAGACATGG - Intergenic
1193775869 X:85641446-85641468 AGCCCTAATCCTAAGAAAAAGGG - Intergenic
1194345896 X:92765398-92765420 TGGCCTACTCCCAAGAATGAAGG - Intergenic
1194391589 X:93324254-93324276 ATGACTATCCTCAAGAAACATGG + Intergenic
1197947081 X:131851209-131851231 AGGCCCAGTCCCAAGGCACAAGG - Intergenic
1198511812 X:137359606-137359628 AGGCCTATTCCATATACACAGGG + Intergenic
1200116541 X:153772081-153772103 AGGCCTGTGGCCAAGAAACCTGG + Intronic
1200654244 Y:5882046-5882068 TGGCCTACTCCCAAGAATGAAGG - Intergenic