ID: 953922342

View in Genome Browser
Species Human (GRCh38)
Location 3:46960853-46960875
Sequence TTGTGGGTATGGAGGTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953922334_953922342 18 Left 953922334 3:46960812-46960834 CCGTCTCAGCTGCTGAAGGTGTA 0: 1
1: 0
2: 1
3: 23
4: 339
Right 953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG 0: 1
1: 0
2: 0
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953922342 Original CRISPR TTGTGGGTATGGAGGTATAA AGG Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
907750996 1:57262962-57262984 TTAAGGGTGTGGTGGTATAAGGG + Intronic
908223033 1:62027564-62027586 TTGTTGGTAGGGATGTAAAATGG - Intronic
909776264 1:79489089-79489111 TTGGTGGTATGGAGAGATAATGG + Intergenic
911203356 1:95068748-95068770 TTGAGGGTAGGAAGGTATCAAGG - Intronic
911434363 1:97837080-97837102 TTCTGGTTTTGGAGGAATAAAGG + Intronic
914440668 1:147703330-147703352 TTCTGAGCATGGAGATATAATGG + Intergenic
916332986 1:163639055-163639077 GTGTGGAGATGAAGGTATAAGGG - Intergenic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063552536 10:7046543-7046565 ATTTAAGTATGGAGGTATAAGGG - Intergenic
1067676999 10:48389937-48389959 ATGTGGGTATGGAGGTTCATAGG + Intronic
1069835266 10:71304153-71304175 TTGGGGGTAAGGATTTATAAGGG + Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1073376174 10:103036880-103036902 TTGTGGGTATGGCTATAAAAGGG + Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1074859671 10:117500856-117500878 TTGTGCGTTTGTAGGTGTAAAGG - Intergenic
1077789433 11:5422596-5422618 TGGTGAGGATGGAGGCATAATGG - Exonic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1085388789 11:76171813-76171835 TTGGGGGTAGGGAGGAATCATGG - Intergenic
1088477351 11:110256024-110256046 TTGTGTGTAGGGTGGTAAAACGG - Intronic
1089224498 11:116905550-116905572 TTGCTGGTAGGGATGTATAATGG - Intronic
1090780092 11:130000463-130000485 TAGAGGTTATGGAGGTATAAAGG - Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1093810322 12:23485042-23485064 TTGGGGGGATGGAGGTAAAGTGG - Intergenic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1096539189 12:52295001-52295023 TTGTGGCTATCGAGGTAGAAAGG - Intronic
1097468450 12:59957378-59957400 TTGTGTGTCTGGAAGTAAAATGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1101410776 12:104466205-104466227 TTGTGCTTATAGAGGCATAAGGG + Intronic
1101556817 12:105817768-105817790 TGATGGGTAAGGAGGTAGAAAGG - Intergenic
1101891602 12:108721186-108721208 GTTTGGTTATGGAGTTATAAAGG - Intronic
1105941406 13:25151077-25151099 TTGTGAGTATCCTGGTATAATGG - Intergenic
1106874505 13:34056988-34057010 TTGTGGAAATGCAAGTATAAAGG - Intergenic
1109430318 13:62224414-62224436 TCGGAGGTATGGAGATATAACGG - Intergenic
1109992313 13:70074208-70074230 ATGTGGCTATGGAGATATAATGG - Intronic
1110872695 13:80470841-80470863 TTTTGTGTATGGAGGTAGAGAGG + Intergenic
1113011492 13:105772700-105772722 TTATGGCTATAAAGGTATAATGG + Intergenic
1115090827 14:29573013-29573035 TGGTGGGAATGGAGCTATATTGG + Intergenic
1115812315 14:37123213-37123235 TTGGGGAGATGGAGGTAGAAAGG + Intronic
1116172203 14:41417290-41417312 TTGTGGATATGGTGGTAGAGTGG - Intergenic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119417838 14:74486413-74486435 TTCTGTGGATGGAGTTATAAAGG - Exonic
1121867685 14:97378020-97378042 TTGTACATATGCAGGTATAAAGG + Intergenic
1125168622 15:36740525-36740547 ATGTGGCTATGGAGATATAATGG + Intronic
1126178968 15:45766214-45766236 TTGTGGTCATGGAGGTATCAAGG - Intergenic
1126316989 15:47380669-47380691 TTATGGGCATGGAAGTATACAGG + Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1126903531 15:53339430-53339452 TTGTGTGTATGTAGGCATGAAGG + Intergenic
1127232766 15:57014828-57014850 ATGGGGGTGGGGAGGTATAATGG + Intronic
1133559460 16:6937288-6937310 ATGTGGGAATGAAGGTAAAAAGG - Intronic
1134779855 16:16885863-16885885 TTGTGGGGAGGGAGGTCTAAGGG - Intergenic
1144219065 17:13083698-13083720 TTGTGGGAAGTGAGGTATCATGG - Intergenic
1145740232 17:27267777-27267799 TAGTGGGTATAGGGGTATATAGG - Intergenic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1146369238 17:32254641-32254663 TTGTGAGGATGTAGGTAAAAAGG - Intergenic
1154460687 18:14581920-14581942 TTGTAGGCATGGTGGTAGAAAGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1166379673 19:42349416-42349438 GGGTGGGTTTGGAGGTATCAGGG + Intronic
925648689 2:6065716-6065738 ATCTGGGGATGGGGGTATAAAGG - Intergenic
926518207 2:13876465-13876487 TCGTGGGTATAGATGTTTAATGG + Intergenic
926835827 2:17018773-17018795 ATGTGGGAATGGAAGTATATGGG - Intergenic
928999502 2:37332127-37332149 TGGTGAGTATGGAGGGATACTGG + Intergenic
932011607 2:67983523-67983545 TGGTGAGGATGGAGGGATAAGGG - Intergenic
932696746 2:73963320-73963342 ATGTGGGTATGGGGGTACAGGGG - Intergenic
932946389 2:76237463-76237485 TGGTGGATATGGTGGTATAAAGG - Intergenic
933167862 2:79095250-79095272 TTGTCGGTATAGAGGGAGAAAGG + Intergenic
935041112 2:99428099-99428121 GACTGGGTATGAAGGTATAAAGG + Intronic
935208509 2:100918789-100918811 TTGCTGGTAGGGAGGTAAAATGG + Intronic
936915240 2:117633440-117633462 TGGTGGGTGCTGAGGTATAAAGG - Intergenic
937373111 2:121316276-121316298 TTGATGGTATGATGGTATAAAGG - Intergenic
938209407 2:129454596-129454618 GTGTGGGTGTGGCTGTATAAGGG + Intergenic
939103787 2:137926039-137926061 ATTTGGGTATGGAGATATTATGG - Intergenic
939151788 2:138481935-138481957 TTTTTGGTATGGAGCTGTAAGGG + Intergenic
940204629 2:151189233-151189255 GTGTGTGTATGGTGGTAGAATGG - Intergenic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940617669 2:156070371-156070393 TCCTGGGTAGGGAGGTAAAAGGG + Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940682368 2:156803326-156803348 TTGTGGGTATGGAGGAGTAGAGG - Intergenic
946316302 2:218915512-218915534 TTGTGGGTAAGGAAAGATAAAGG + Intergenic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171252902 20:23663050-23663072 AGGTGGGAATGGAGGTAGAAAGG - Intergenic
1171259385 20:23718367-23718389 AGGTGGGAATGGAGGTAGAAGGG - Intergenic
1172430394 20:34885918-34885940 TTATGGATATGGGGGTAAAAAGG + Intronic
1180865229 22:19114837-19114859 TGGTGGGTATGGTGGACTAAGGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
949248576 3:1955153-1955175 TTGTGTAGATGTAGGTATAATGG - Intergenic
951040699 3:17986355-17986377 TTCTGAGGATGGAGGTATAAGGG + Intronic
951952678 3:28217837-28217859 TTGGGGCTATGGATTTATAATGG + Intergenic
952586217 3:34895673-34895695 TTGTTGTTTTGGAGGTACAATGG + Intergenic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
956615561 3:71168263-71168285 TTGTGGTTAAGGAGGTATTTAGG - Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
959560973 3:107780539-107780561 TTGTGGCTTGAGAGGTATAATGG - Intronic
960266207 3:115624012-115624034 TTGAGGGTGTGGACGTAGAAAGG + Intronic
963033164 3:140999454-140999476 ATGAGGGTAGGGAGGAATAAAGG - Intergenic
964557997 3:157962209-157962231 TTGTGGCCATGCAGGTAAAATGG - Intergenic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
965978035 3:174649710-174649732 CTGTGTGTATGTATGTATAAAGG - Intronic
967363621 3:188660736-188660758 TTGTGGGGATGGGGGTATATGGG - Intronic
970572165 4:17393588-17393610 AGGTTGCTATGGAGGTATAATGG - Intergenic
971466114 4:26963298-26963320 TTCTGGGTATGAAAGTATAAAGG + Intronic
971724643 4:30294661-30294683 TTGTGTGTATGTGTGTATAAAGG - Intergenic
972038961 4:34566093-34566115 TTGTTGTTATGGAGATAAAAAGG - Intergenic
972492693 4:39602697-39602719 TTGAGGGTATAGAAATATAATGG - Intronic
973280504 4:48355286-48355308 TTGGGGGTGAGGAGGCATAAGGG + Intronic
973966859 4:56171866-56171888 CTGTGTGTTTGGAGCTATAAAGG - Intronic
975408252 4:74017164-74017186 TTGTGTGTGTGGATGTATATAGG + Intergenic
976449843 4:85175773-85175795 ATGTGGGTATGGATATAAAAAGG - Intergenic
977327768 4:95597919-95597941 TTTGAGGTATGGATGTATAATGG - Intergenic
978665045 4:111172434-111172456 TTATAGGTCTGGAGGTAAAAAGG - Intergenic
980953768 4:139407902-139407924 TTCTGGGAATGGAGTTACAATGG + Intronic
984664000 4:182405853-182405875 TGGAGGGTATGGAGGAATAAAGG + Intronic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
987480539 5:18451258-18451280 GTGTGGGGATAGAGCTATAAAGG - Intergenic
988895014 5:35663515-35663537 TTTTGGGTATGGAAGAATAAGGG - Intronic
989164871 5:38424059-38424081 TTCTGGGGGTGGAGGTAGAAGGG - Intronic
992530829 5:77650349-77650371 GTGTGTGTGTGGAGGTACAAGGG + Intergenic
993810543 5:92470713-92470735 GTGTAGGTATGGAGGTATGGAGG + Intergenic
997035935 5:130191207-130191229 TGGTGGGTATGGAAGTGAAAGGG - Intergenic
998661566 5:144244593-144244615 TTGTTAATATGGAGATATAATGG - Intronic
999466470 5:151810829-151810851 TTGGGGGGATGGATATATAAGGG + Exonic
1001878698 5:175223559-175223581 TGGTGGGTTTGGCGGTACAATGG + Intergenic
1005944225 6:30583970-30583992 TTGTGGCTATGGAGTTGGAAGGG + Intronic
1006680610 6:35794638-35794660 TTGTGGGTAAGGAGTTTTAATGG - Intergenic
1007809645 6:44476836-44476858 TTGAGGGCATGGAGGTCTGAGGG + Intergenic
1008093643 6:47316638-47316660 TTGTGGGTTTACAGGAATAAGGG - Intergenic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1011614863 6:89188367-89188389 TTGTGGGTAGTAATGTATAATGG - Intronic
1015689990 6:135911241-135911263 CTGTGGGTGTGGAGATTTAATGG - Intronic
1017802547 6:157910712-157910734 TTGTAAGTATGCAGGTAGAAAGG + Intronic
1018698027 6:166405782-166405804 TTGTAGGTAATGAGGTAGAAAGG + Intergenic
1027671270 7:81103066-81103088 TTGTGAGTTTGGAAGAATAATGG + Intergenic
1030445337 7:109642216-109642238 GTGGTGGTATGGAGGGATAATGG + Intergenic
1030811932 7:113983212-113983234 GTGTGGGGATGGGAGTATAAGGG + Intronic
1031166910 7:118239900-118239922 TTGTGGGTATCTATCTATAAAGG - Exonic
1032333875 7:131006323-131006345 TTGGGGGAATGGAGGTAGAGAGG + Intergenic
1033988861 7:147259962-147259984 TTGTGGGGAGGGAGGGATAGTGG - Intronic
1036063492 8:5352381-5352403 GTGTGTGTATGTATGTATAAAGG - Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037611895 8:20482976-20482998 TTGTGTGTATGTATGTGTAAGGG + Intergenic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1040529645 8:48256154-48256176 TTGTGGGTTTAGGGGAATAAGGG + Intergenic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1041749504 8:61244731-61244753 ATGTGTGTATGGGGGTATAGGGG + Intronic
1042089526 8:65143754-65143776 TGAAGGGAATGGAGGTATAAAGG - Intergenic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1042582656 8:70298582-70298604 TTGTTGGTATAGAATTATAACGG - Intronic
1043514874 8:80986676-80986698 TGGAGGGTATGGAGGGATTAGGG + Intronic
1043777338 8:84286583-84286605 TTGTAGATAAGGAGGTTTAAAGG + Intronic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1050101800 9:2127589-2127611 TAGTGGGTATGGAAGTCTAATGG + Intronic
1052272556 9:26641667-26641689 TTATGGGGCTGGAGTTATAAAGG - Intergenic
1052491317 9:29172903-29172925 GTGTGTGTATGTAAGTATAAGGG - Intergenic
1052498495 9:29258913-29258935 TTGTGGTACTGGAGATATAATGG - Intergenic
1060492460 9:124094913-124094935 ATGTGGGTTTGAAGGTTTAAAGG + Intergenic
1060624325 9:125096449-125096471 TGATGGGTATGAAAGTATAAAGG + Intronic
1062246431 9:135569663-135569685 TTGTGGGGAGGGTGGTACAAGGG + Intergenic
1186978641 X:14935543-14935565 TTGGGGGTATGGAGGATTAGAGG - Intergenic
1188043890 X:25403207-25403229 TTAGGGGTATAGAGGTATATTGG + Intergenic
1188865732 X:35311100-35311122 TTGAGGATATGAAGATATAAAGG - Intergenic
1193525629 X:82584629-82584651 TTGTGAAGATGAAGGTATAATGG - Intergenic
1193538924 X:82746999-82747021 TTGTGTGTATGTATGTATATGGG - Intergenic
1196602163 X:117614710-117614732 CAGTGAGTATGGAGGTATTAGGG - Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1200915073 Y:8564380-8564402 TTTTGGGAATGGAGATAGAAGGG + Intergenic