ID: 953923449

View in Genome Browser
Species Human (GRCh38)
Location 3:46967717-46967739
Sequence CAGCTGTATGACAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953923449_953923454 2 Left 953923449 3:46967717-46967739 CCCCAGGGCCTGTCATACAGCTG 0: 1
1: 0
2: 1
3: 28
4: 281
Right 953923454 3:46967742-46967764 ACTCAATAAATACTTATTAGTGG 0: 1
1: 1
2: 9
3: 75
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953923449 Original CRISPR CAGCTGTATGACAGGCCCTG GGG (reversed) Intronic
900925961 1:5706124-5706146 CAGAGCTATGACAGGGCCTGGGG + Intergenic
901137463 1:7007367-7007389 CAGCTGTACGCCAGAGCCTGTGG + Intronic
901689903 1:10965989-10966011 CTACTGTGTGCCAGGCCCTGAGG + Intronic
902436003 1:16398381-16398403 TGGCTCTAAGACAGGCCCTGTGG - Intronic
903052800 1:20614113-20614135 CTGCTTTGTGCCAGGCCCTGAGG + Intronic
903591078 1:24456377-24456399 ATGCTGGATGCCAGGCCCTGGGG - Intronic
903705568 1:25283241-25283263 TGGCTGTAGGCCAGGCCCTGTGG + Intronic
903721670 1:25410182-25410204 TGGCTGTAGGCCAGGCCCTGTGG - Intronic
904094190 1:27965047-27965069 CAGCTATTAGCCAGGCCCTGTGG + Intronic
904774535 1:32898691-32898713 CTGCTCTGTGCCAGGCCCTGGGG + Intronic
906141688 1:43537486-43537508 CAGCTGTCAGCCAGGCGCTGGGG + Intronic
906965755 1:50454884-50454906 CAGCAGTATGCTAGGACCTGGGG - Intronic
907695493 1:56723115-56723137 CAGTTTTATGTCAGGCCCTGGGG + Intronic
908459785 1:64338313-64338335 CAGCTGTATGACAGAGCCCCAGG + Intergenic
910074374 1:83260241-83260263 GAGGTTTATGACAGGCCCTTGGG + Intergenic
910348246 1:86265850-86265872 CAGTTCTATGACAGGCCCTCTGG + Intergenic
910914446 1:92274311-92274333 CAGCTGCATTCCAGGCCCTGTGG - Intronic
911128461 1:94364425-94364447 CAGTCCCATGACAGGCCCTGGGG + Intergenic
911259188 1:95666363-95666385 AAGCTGTATGTCGGGACCTGGGG + Intergenic
914436573 1:147665668-147665690 GAGCTTTGTGTCAGGCCCTGTGG - Intronic
915468064 1:156109333-156109355 CAGCTGCTTGATAGGCCTTGAGG - Intronic
916578609 1:166088628-166088650 TAGCTGTATGCCAGTCCGTGAGG - Intronic
917110346 1:171541167-171541189 TCGCTGTCTGAGAGGCCCTGAGG - Exonic
917334941 1:173916890-173916912 CGGATGGATGGCAGGCCCTGGGG + Intronic
917799474 1:178557679-178557701 GGGCTGTTTGACATGCCCTGTGG + Intergenic
918161909 1:181909163-181909185 CAGCATTCTGACAGTCCCTGGGG + Intergenic
918752514 1:188290217-188290239 AAGATGTCTGACATGCCCTGGGG + Intergenic
920110631 1:203584697-203584719 CAGCTCCAAGACAGCCCCTGAGG + Intergenic
923699314 1:236284583-236284605 CAGCATTGTGAGAGGCCCTGGGG + Intergenic
924772671 1:247090279-247090301 CCGCTGTATGTCAGCCACTGGGG + Intergenic
1063940419 10:11122951-11122973 CAGCTGCATGACTAGCCCTTCGG - Intronic
1064327006 10:14360676-14360698 CAGCAGTGTGACAGTCACTGTGG - Intronic
1065876004 10:29997610-29997632 CAGCTTGATTTCAGGCCCTGGGG - Intergenic
1066297389 10:34066772-34066794 CAGCCCGATGACAGGCTCTGTGG - Intergenic
1067414682 10:46094385-46094407 CAGCAGAATGCCAGGCTCTGAGG + Intergenic
1067581245 10:47447441-47447463 CAGCAGAATGTCAGGCTCTGAGG - Intergenic
1069455843 10:68553226-68553248 GAGCTGTGTGACAGGAGCTGGGG - Intergenic
1071292677 10:84198698-84198720 CAGCAGTATGCCAGGCACTGAGG - Intronic
1072723052 10:97792504-97792526 CAACTGTATGCCAGGCACTGTGG + Intergenic
1075008101 10:118844736-118844758 CATCTCTAGGAAAGGCCCTGAGG - Intergenic
1076511561 10:131017830-131017852 CAGCTGCACGACAGGAGCTGTGG - Intergenic
1078018681 11:7637392-7637414 CCGCTGTGTGCTAGGCCCTGTGG + Intronic
1079129929 11:17741369-17741391 TTACTGTATGCCAGGCCCTGTGG - Intronic
1079452860 11:20612289-20612311 CAGCTGTGTGCCAGGCATTGTGG + Intronic
1082953864 11:58847732-58847754 CATCTGTATCTCAGGGCCTGAGG + Intronic
1083066265 11:59926833-59926855 GGGCTGTTTGACATGCCCTGCGG - Intergenic
1083185124 11:61013044-61013066 CAACAGTATCACAGGCCTTGAGG - Intronic
1083558418 11:63651643-63651665 CTGCTGGAAGACAGACCCTGAGG - Intronic
1083675025 11:64320387-64320409 CTGCTAAATGACAGGCACTGTGG + Intronic
1084960339 11:72713103-72713125 CAGCTGCCTGTCAGACCCTGAGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085080447 11:73629502-73629524 CAGCTGTTCCAAAGGCCCTGGGG - Intergenic
1085419360 11:76342289-76342311 CTCCTGTATGCCAGGCACTGTGG - Intergenic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1086943605 11:92823124-92823146 CTGCTGCATGGCAGGCACTGGGG - Intronic
1089169420 11:116501781-116501803 CTACTTTATGCCAGGCCCTGGGG + Intergenic
1089180051 11:116577300-116577322 CTGCTGTATGCCAGACACTGTGG - Intergenic
1090751260 11:129748356-129748378 CAGCACCATGACAGGCACTGAGG - Intergenic
1092865487 12:12757072-12757094 CAGCTGTAGGCCAGGCACAGTGG - Intronic
1094349170 12:29504143-29504165 CTTCTGTATGCAAGGCCCTGTGG + Intronic
1094769551 12:33638289-33638311 GAGCAGTATGACAGCCCATGAGG + Intergenic
1095040040 12:37431367-37431389 CAGCTGTGTGGCAGGCTCAGTGG - Intergenic
1095374001 12:41504643-41504665 CTGCTGTATGACAGGTGCTCAGG - Intronic
1100750684 12:97695484-97695506 CTCCTGTATGACAGGCCTGGTGG + Intergenic
1101452269 12:104790294-104790316 CAGCTTCCTGACAGCCCCTGGGG - Intergenic
1101501267 12:105306464-105306486 GGGCTGTTTGACATGCCCTGTGG + Intronic
1101585764 12:106084183-106084205 CTGCTGTTTTACAGGCTCTGGGG - Intronic
1101829232 12:108244153-108244175 CACCTGTATGACAGTTCCGGTGG + Intronic
1101966758 12:109287311-109287333 TAGCTGTCTGAGATGCCCTGAGG + Intronic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1103557185 12:121773688-121773710 CAGCTGCATACCAGGCCCCGAGG + Intronic
1103736374 12:123063422-123063444 CAGCTGTGTGCCAAGCCCTGGGG - Intronic
1103862219 12:124024539-124024561 CAGCTGGAGGCCAGGCTCTGTGG + Intronic
1104632894 12:130419234-130419256 CAGCTGTCTGTCTGACCCTGGGG + Intronic
1105013630 12:132772744-132772766 CAGCTGTGTGACAGGGTCTGCGG - Exonic
1106229025 13:27807591-27807613 CCACTGTGTGCCAGGCCCTGGGG - Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107283099 13:38758534-38758556 CAGTTGAATGCCAGCCCCTGGGG + Intronic
1108506766 13:51119183-51119205 CAGGTGTATGGCACGCCCTGTGG + Intergenic
1109465396 13:62725704-62725726 CCACTCCATGACAGGCCCTGGGG + Intergenic
1112153159 13:96786449-96786471 CAGGTGTATGCCAGGGTCTGGGG - Intronic
1112182508 13:97098245-97098267 CCGCTCCATGACAGGCCCTGGGG + Intergenic
1115788195 14:36849941-36849963 CAGCTATGTGTCAGTCCCTGGGG + Intronic
1116298292 14:43141334-43141356 CAGCCGTATCACAGGGCCTGTGG - Intergenic
1117757543 14:58991334-58991356 AAGCTGTTAGAAAGGCCCTGTGG - Intergenic
1119600226 14:75970934-75970956 TCACTGTAAGACAGGCCCTGGGG - Intronic
1120643861 14:87048460-87048482 CAACTGAATGACAGGGACTGGGG + Intergenic
1122744887 14:103891735-103891757 TAGGTGTATGTCAGGCCCGGTGG - Intergenic
1123019394 14:105390562-105390584 AACCTGTCTGCCAGGCCCTGTGG - Intronic
1123104988 14:105837157-105837179 CACCTGAAAGACAGCCCCTGGGG + Intergenic
1124558078 15:30746253-30746275 CTGCTGTGTGCCAGGCACTGTGG + Intronic
1124640901 15:31395971-31395993 CACGTGTATCACAGGCCCTGAGG - Intronic
1125625215 15:41102959-41102981 CTGCTGTATGACTGACCCTCTGG + Intronic
1125677092 15:41507959-41507981 TTGCTGTGTGCCAGGCCCTGTGG - Intronic
1129264262 15:74385596-74385618 CAACTGGATGCCAGGCCTTGAGG - Intergenic
1129573489 15:76715532-76715554 CAGCTGTATCTTGGGCCCTGTGG - Intronic
1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG + Intergenic
1132585285 16:703522-703544 CAGCTGTCAGCCAGGCTCTGGGG - Intronic
1135328407 16:21542507-21542529 CAGGTGTACGACAGGCAGTGTGG + Intergenic
1136067568 16:27769158-27769180 CTGCTGTGTTCCAGGCCCTGAGG + Intronic
1136338754 16:29628480-29628502 CAGGTGTACGACAGGCAGTGTGG + Intergenic
1136658254 16:31727416-31727438 CAGCTCTATGACTGCTCCTGTGG + Intronic
1138554192 16:57762558-57762580 CAGATGCATGCCTGGCCCTGTGG + Intronic
1139472466 16:67185466-67185488 CAGCTGCAGGACAGACACTGAGG + Exonic
1139506832 16:67402510-67402532 CAGCTGAATGAATGACCCTGGGG - Intronic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1141185515 16:81784251-81784273 CAACTCTATGCCAGGCACTGAGG - Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141612004 16:85187146-85187168 CAGCTGCCTGGCAGGCTCTGTGG + Intergenic
1142041437 16:87897045-87897067 CAGGTGTACGACAGGCAGTGTGG + Intronic
1142122328 16:88393081-88393103 CAGCTTCCTGCCAGGCCCTGCGG - Intergenic
1142130320 16:88429120-88429142 CAACGGAATGACAGACCCTGGGG + Exonic
1142558505 17:795682-795704 CAGCTGTACTGCAGGGCCTGGGG + Intergenic
1143390137 17:6555511-6555533 CTACTGTATGGCCGGCCCTGTGG + Intronic
1143653001 17:8275864-8275886 CTGCTGTATGTAAGACCCTGTGG + Intergenic
1143756471 17:9071603-9071625 CAGCTGTAGGACTGGCCCCAGGG - Intronic
1143887161 17:10073281-10073303 CAGCTGTGTCAGAGCCCCTGGGG - Intronic
1144705750 17:17366869-17366891 CAGCTGTCAGGCAGGCCCTCGGG + Intergenic
1144760757 17:17706075-17706097 CACCTGTTTCATAGGCCCTGAGG + Intronic
1144764823 17:17726545-17726567 CTGCTGTGTGCTAGGCCCTGGGG - Intronic
1146442744 17:32911262-32911284 GAGGTGTATACCAGGCCCTGGGG + Intergenic
1146969973 17:37064787-37064809 CTACTGTGTGACAGGCACTGGGG + Intergenic
1148002547 17:44398281-44398303 CAGCAGTCAGCCAGGCCCTGTGG - Exonic
1148811005 17:50291211-50291233 CAGTTATAGGACAAGCCCTGGGG + Intergenic
1150637316 17:66922755-66922777 GAGCTGTATGACAGGGAATGAGG + Intergenic
1151437197 17:74105122-74105144 CTGCTGCATGCCAGGCACTGGGG + Intergenic
1152386432 17:79977510-79977532 CTGCTGCGTGCCAGGCCCTGTGG - Intronic
1152421343 17:80195009-80195031 CTGCTGTATGCCAGACACTGGGG - Intronic
1155236694 18:23827054-23827076 CAGATGTATGACTGACCTTGAGG - Intronic
1156349565 18:36291841-36291863 CAGCAGCATGACATGCCCAGAGG - Intergenic
1156473491 18:37391706-37391728 AAGCTCTATGCAAGGCCCTGAGG - Intronic
1156642547 18:39119776-39119798 CAGCTGTATGTAAGGCCATAGGG - Intergenic
1157514571 18:48301703-48301725 CAGCTGGATGAGAGGCATTGGGG + Intronic
1158154641 18:54411643-54411665 CAGCTCTATGACAGACCATGTGG - Intergenic
1159728777 18:71998158-71998180 AAGCTGAATGACAAGCCCTGAGG + Intergenic
1160579376 18:79874945-79874967 CAGGTATGTGACAGGCCCTGAGG + Intronic
1160834547 19:1118481-1118503 CAGCTGTGGGCCAGGACCTGGGG + Intronic
1161931849 19:7345828-7345850 CTACTGTATGCCAGGCACTGTGG - Intergenic
1162078584 19:8205438-8205460 CAGCTGGATGGGAGGACCTGGGG - Intronic
1165770895 19:38379554-38379576 CAGCTGTGTGCCTGGCACTGTGG + Intronic
1166419144 19:42621367-42621389 CTCCTATATGCCAGGCCCTGTGG + Intronic
1168064069 19:53909454-53909476 CAGCCGCATGACCGGCCCCGAGG - Exonic
925015814 2:523489-523511 GAGATGTAGGCCAGGCCCTGAGG + Intergenic
925170141 2:1745069-1745091 CAGGTGGCTGACAGGCCCCGGGG - Intergenic
925776731 2:7343272-7343294 CTGCTGCATGACAGGGCCAGGGG - Intergenic
925991924 2:9261023-9261045 GAGCCGTATGACAGCCCCTTGGG + Intronic
926340976 2:11904143-11904165 CAGCTGTATGTCAGGCACTGTGG - Intergenic
926764786 2:16314801-16314823 CTGCTTTGTGCCAGGCCCTGTGG - Intergenic
927447534 2:23177519-23177541 CAACTCCATGACAGGCCCCGGGG - Intergenic
927511989 2:23649687-23649709 CAGTTGTCTGACAGGGCCAGAGG + Intronic
928592747 2:32834096-32834118 CAGCTCTGTGATAGACCCTGAGG + Intergenic
929584668 2:43106154-43106176 CAGCTGTTTTATAGGCCCTGTGG - Intergenic
931649035 2:64452441-64452463 CTGCTGTATACCAGGCACTGGGG - Intergenic
932050331 2:68391976-68391998 CTGCTATATGCCAGGCACTGTGG + Intronic
932305957 2:70704487-70704509 CAGCTGTGTGAGAGGCTGTGGGG - Intronic
933738107 2:85511595-85511617 CAGCTGCATTAAAGGCTCTGAGG + Intergenic
933891099 2:86770858-86770880 CAGGTCTCTGACAGGCACTGAGG + Intronic
933966432 2:87433294-87433316 CAGCTGTGTGAGAGGCAATGAGG - Intergenic
935105651 2:100040874-100040896 CACCTGGATGATATGCCCTGTGG - Intronic
936327363 2:111517191-111517213 CAGCTGTGTGAGAGGCAATGAGG + Intergenic
937468502 2:122155533-122155555 CAGCTCCATGCCAGGCGCTGGGG + Intergenic
937916586 2:127102237-127102259 AAGCTGTGTGACTGTCCCTGAGG - Intronic
938549709 2:132368861-132368883 CAACCCTATGACAGGCCCAGGGG + Intergenic
939409029 2:141800088-141800110 CTACTATATGACAGGGCCTGTGG - Intronic
943451838 2:188052208-188052230 CAGCTGAATGAAGGTCCCTGAGG + Intergenic
946190562 2:218005660-218005682 CTGCTGTATGCCAGGCTCTGGGG - Intergenic
946586407 2:221192545-221192567 GAGCTGTGTGACAGGAACTGAGG - Intergenic
946735520 2:222750780-222750802 CCGCTGTATGCAAGGCACTGTGG + Intergenic
947044148 2:225959367-225959389 TATCTGTAGGACAGGACCTGAGG - Intergenic
1169058553 20:2643334-2643356 CATCAGAATGCCAGGCCCTGAGG + Intergenic
1169179326 20:3549243-3549265 CAGCTTTATGAGATGCTCTGGGG - Exonic
1169224223 20:3846455-3846477 TAACTGTATGCCAGGCCATGGGG + Intergenic
1169791273 20:9413249-9413271 CAGCTGTCTAACATGCCATGAGG + Intronic
1170706564 20:18749298-18749320 CAGCACTCTCACAGGCCCTGAGG - Intronic
1170838860 20:19907645-19907667 CAGCTTTATCTCAGACCCTGGGG - Intronic
1171525417 20:25806141-25806163 CAGCTGTGTGGCAGGCTCAGTGG - Intronic
1171534607 20:25876051-25876073 CAGCTGTGTGGCAGGCTCAGTGG - Intergenic
1171551410 20:26049743-26049765 CAGCTGTGTGGCAGGCTCAGTGG + Intergenic
1171573276 20:26273884-26273906 CAGCTGTGTGGCAGGCTCAGTGG + Intergenic
1171792533 20:29540945-29540967 CAGCTGTGTGGCAGGCTCAGTGG + Intergenic
1171837587 20:30171524-30171546 CAGCTGTGTGGCAGGCTCAGAGG - Intergenic
1171855940 20:30343436-30343458 CAGCTGTGTGGCAGGCTCAGTGG - Intergenic
1172878595 20:38181816-38181838 CAGCTCTGTGCCAGGCCCTGGGG + Intergenic
1173388019 20:42606456-42606478 CTGCTATGTGCCAGGCCCTGGGG + Intronic
1173551636 20:43936952-43936974 CTGCTGTGTGCCAGGCACTGTGG + Intronic
1173853448 20:46233622-46233644 TCTCTGTATGCCAGGCCCTGTGG - Intronic
1173979570 20:47212747-47212769 CAGCTCTCTGACAGACTCTGAGG - Intronic
1174419574 20:50390896-50390918 TTGCTCTATGCCAGGCCCTGGGG - Intergenic
1175342987 20:58246666-58246688 CTGCTGTATGGCAGGCCCATGGG - Intergenic
1175895153 20:62332801-62332823 CGGCTGAAGGGCAGGCCCTGGGG - Intronic
1177325546 21:19583779-19583801 CTGCTGCATGATAGGCCCAGTGG + Intergenic
1179482179 21:41685450-41685472 CAGCAGGGTGACAGGCGCTGGGG - Intergenic
1180573976 22:16755601-16755623 CAGCTGTGTGGCAGGCTCAGTGG - Intergenic
1181462512 22:23094110-23094132 CAACTCTGTGACAGGCCCTGGGG - Intronic
1182087455 22:27571115-27571137 CTGCTGCATGCCAGGCACTGAGG - Intergenic
1184292156 22:43503158-43503180 CTATTGTATGCCAGGCCCTGGGG - Intronic
950941709 3:16899171-16899193 CAGCTCCATGACATGCCTTGAGG - Intronic
951883102 3:27498631-27498653 GAGCTGCATGACAGGAACTGGGG - Intergenic
953648985 3:44782783-44782805 CAGCAGTTGCACAGGCCCTGAGG + Intronic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
953939943 3:47085017-47085039 CAACTGTAGGCCAGGCGCTGTGG - Intronic
954652757 3:52175432-52175454 CAGCTGTGTGCCGGGGCCTGTGG + Intergenic
954705945 3:52480550-52480572 AGGGTGTCTGACAGGCCCTGAGG + Intronic
954815692 3:53278714-53278736 CAGCTGGATCACAGGCCATATGG - Intergenic
955176903 3:56625209-56625231 AAGCTGTATAGCTGGCCCTGAGG - Intronic
955611106 3:60758172-60758194 GAGCTGTGTGACAGGCCCCTTGG - Intronic
955731708 3:61994473-61994495 CACCTGTATCACAGGCACTATGG - Intronic
956171855 3:66439140-66439162 CAGCTGTCTGCAAGGCCATGGGG + Intronic
956473738 3:69596768-69596790 CAGTTATAGGACAGGCACTGTGG - Intergenic
956757732 3:72405770-72405792 CTGCTGTATCTCAGGCACTGAGG + Intronic
956866836 3:73377373-73377395 CACCTCCATGACAGGCACTGTGG - Intergenic
961517329 3:127446086-127446108 CAGCAGGATGCAAGGCCCTGAGG + Intergenic
961802452 3:129462386-129462408 GAGCTTTATGACAGCCCCTGAGG + Intronic
963878704 3:150504081-150504103 CAGCTTTAGGTCTGGCCCTGAGG - Intergenic
965308561 3:167099460-167099482 GAGCTGTGTAACAGGACCTGTGG - Intergenic
969089637 4:4684242-4684264 CTGCTGTGTGCCAGGCCCTGTGG + Intergenic
969449456 4:7264777-7264799 CAGCTGCAGGCCAGACCCTGAGG + Intronic
970217679 4:13776719-13776741 AAGCTCTCTGACAGGCCCTGGGG + Intergenic
974008571 4:56585627-56585649 CAACTGTAGGACAGGCGCAGTGG - Intronic
975865864 4:78723101-78723123 CATTTATATAACAGGCCCTGTGG - Intergenic
977770204 4:100849050-100849072 CAGCTAGATGGCAGGCCCTGTGG + Intronic
977811319 4:101358864-101358886 CAGCTACATGACAGCCCTTGGGG + Intergenic
978051748 4:104209257-104209279 CAGCTGTGTGTCAGGCACTATGG - Intergenic
980996307 4:139783040-139783062 CAGCTAAATGACAAGCCCTGGGG - Intronic
981992132 4:150934460-150934482 CTACAGTATGCCAGGCCCTGAGG + Intronic
988642061 5:33050592-33050614 CAGCTATATCACAGCCCCTTGGG + Intergenic
990271452 5:54145678-54145700 CAACTCCATGCCAGGCCCTGAGG - Intronic
990453590 5:55961215-55961237 AAGTTATATTACAGGCCCTGTGG - Intronic
990515466 5:56527414-56527436 AAGTTCTATGACAGGCCCTCAGG - Intronic
994579144 5:101616414-101616436 CAGCTCTATGAAAAGGCCTGTGG + Intergenic
997756706 5:136406364-136406386 CAGATGGAGGACAGGCTCTGAGG + Intergenic
998281800 5:140817054-140817076 GTGCTGTATCACAGGTCCTGAGG + Intronic
999275100 5:150325011-150325033 CAGCTCTATGTTAGGCACTGGGG - Intronic
1002026085 5:176397161-176397183 CTGCTGCATGCCAGGCTCTGGGG - Intronic
1003559185 6:7166881-7166903 CAACTCTTTCACAGGCCCTGAGG - Intronic
1003939440 6:11009675-11009697 CAGCTGTATGAAAGCCAGTGAGG + Intronic
1005411086 6:25547608-25547630 CAGAAGTGTGCCAGGCCCTGGGG + Intronic
1005876830 6:30017250-30017272 CAGTTGAATAACAGGTCCTGGGG + Intergenic
1007694780 6:43725231-43725253 CAGTTGTGTAACAGGCTCTGGGG + Intergenic
1008613268 6:53203689-53203711 CTGCTGTCTGCCAGGCACTGTGG - Intergenic
1010254106 6:73738455-73738477 TAGCTGGATAACAGGCGCTGAGG + Intronic
1011083131 6:83511136-83511158 CTACTATATGCCAGGCCCTGTGG + Intergenic
1015389283 6:132663022-132663044 CTGCTATATGCTAGGCCCTGGGG - Intergenic
1018470922 6:164097172-164097194 CAGCTCTGTGCCAGGCACTGAGG - Intergenic
1019538009 7:1538850-1538872 CACCTGGCTGCCAGGCCCTGGGG + Intronic
1020309904 7:6859622-6859644 CAGCTGTGTTGCAGGACCTGAGG + Intergenic
1020389452 7:7642711-7642733 CAGCTGAATGACAGGCCCCATGG - Intronic
1022483932 7:30763302-30763324 CAGCTTTAAGGCAGGCCTTGAGG - Intronic
1022563005 7:31369422-31369444 CAGCTGGATGACAGGGACTATGG - Intergenic
1023748101 7:43341144-43341166 CAACCCTATGACAGACCCTGGGG - Intronic
1023962406 7:44937839-44937861 CAGGTGGATGAGAGACCCTGAGG + Intergenic
1023965710 7:44962206-44962228 TAACTGAAGGACAGGCCCTGCGG - Intergenic
1024608025 7:51038855-51038877 CCTCTGAATGACAGGCCTTGGGG - Intronic
1024911444 7:54451478-54451500 GGGCTGTTTGACATGCCCTGTGG - Intergenic
1025286098 7:57663007-57663029 CAGCTGTGTGGCAGGCTCAGTGG - Intergenic
1025300063 7:57811945-57811967 CAGCTGTGTGGCAGGCTCAGTGG + Intergenic
1026304824 7:69131731-69131753 CAGCTGTAGGCCAGGCGCAGTGG + Intergenic
1027196142 7:76031794-76031816 CAGCTGTTTTACAGCCCATGTGG - Intronic
1027251947 7:76404384-76404406 CAGCTGGATGAGAAGCGCTGGGG - Exonic
1027292071 7:76725105-76725127 GAGGTTTATGACAGGCCCTTGGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029608686 7:101615105-101615127 CAGCTGTCTGGCAGGCACCGGGG - Intronic
1029659734 7:101952061-101952083 CAGCAGCATCACAGGACCTGGGG + Intronic
1029724294 7:102392059-102392081 CAGCTCTGTGACAGACACTGAGG + Intronic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1033252488 7:139773083-139773105 CTGCTGTGTGTCAGGCCCTGTGG - Intronic
1034462126 7:151203825-151203847 CATCAGAATGACAGGACCTGGGG + Intronic
1036640951 8:10583418-10583440 CAGGTGTCAGACAGGGCCTGGGG - Intergenic
1036751342 8:11445334-11445356 CTGCTGGAGGACAGGACCTGTGG - Intronic
1038540078 8:28384939-28384961 CAGCTCCCTGACAGGACCTGTGG + Intronic
1040060054 8:43096091-43096113 CCGCTGTGTGCCAGGCACTGGGG + Intronic
1042296934 8:67230000-67230022 CAGCAATAAGACAGGTCCTGTGG + Intronic
1042841693 8:73130609-73130631 AAGCTCTGGGACAGGCCCTGGGG + Intergenic
1043850859 8:85215326-85215348 AAGCTGTATGACAGGAAATGAGG - Intronic
1044609820 8:94080473-94080495 CACCTCTGTGACAGACCCTGTGG + Intergenic
1045174240 8:99704160-99704182 CATCTGGATGACAGAGCCTGGGG - Intronic
1047816808 8:128473705-128473727 CAGTGGTATGAGAGGCCCAGGGG - Intergenic
1048082460 8:131143590-131143612 AAGTTCTATGACTGGCCCTGAGG - Intergenic
1048441355 8:134461904-134461926 CAGATGGATGACAGGCACGGGGG + Intergenic
1049000358 8:139822152-139822174 CAGCTGTGGGCCAGGCCGTGGGG + Intronic
1049034318 8:140062462-140062484 CAGCTGGAGTAAAGGCCCTGGGG - Intronic
1049159282 8:141087034-141087056 CTGCTGTGTGCCAGGCACTGGGG + Intergenic
1050420567 9:5460073-5460095 CTGCTGTATATCAGGCCCTGGGG - Intronic
1055044392 9:71910381-71910403 GAGCGGTAGGACAGTCCCTGCGG - Intronic
1055118019 9:72626172-72626194 CAACTGCATGAGAGACCCTGAGG + Intronic
1055648333 9:78382203-78382225 CATCTATGTGACAGGCTCTGGGG - Intergenic
1055928991 9:81540357-81540379 CAACTGTGTGTCAGGCACTGTGG - Intergenic
1056473104 9:86925038-86925060 CTGCTGGATGACAGGCATTGTGG + Intergenic
1056631181 9:88294290-88294312 GAGCTGTATGCCAGGAACTGGGG + Intergenic
1057265582 9:93615454-93615476 CAGCTATGTGCCAGGCACTGTGG + Intronic
1058032942 9:100219317-100219339 CAGCTGTAGGCCAGGCACAGTGG + Intronic
1058899572 9:109430578-109430600 AAGTTCTATGCCAGGCCCTGGGG + Intronic
1059714837 9:116904188-116904210 CGTATGTATGCCAGGCCCTGTGG - Intronic
1060072794 9:120564989-120565011 CACCTGTATGGCAGGCCTTATGG - Intronic
1061053313 9:128208634-128208656 TTGCTGTGTGCCAGGCCCTGAGG + Intronic
1061400858 9:130367614-130367636 TTGCTGTGTGCCAGGCCCTGGGG + Intronic
1061429181 9:130520386-130520408 CTGCTGTATGCCAGGCCCCAGGG + Intergenic
1062029511 9:134355921-134355943 CAGGTGTCAGACAAGCCCTGGGG + Intronic
1062181615 9:135194077-135194099 CAGCTGTCTGTCAGGTCCCGTGG - Intergenic
1062277320 9:135737050-135737072 CAGCTCTGTGCCAGGCACTGGGG + Intronic
1062328167 9:136022656-136022678 ATGCTGTGTGCCAGGCCCTGGGG - Intronic
1187998451 X:24955048-24955070 CTTCTGTGTGACAGGCACTGTGG + Intronic
1192047845 X:67695285-67695307 CAGCTCAGTGACAGGGCCTGAGG - Intronic
1192247562 X:69386466-69386488 CAGCTGTCAGCCAGGCCCTAGGG - Intergenic
1192262978 X:69519345-69519367 CAGCTCCATGTGAGGCCCTGAGG + Intronic
1193442879 X:81565014-81565036 CTGCTGCATCATAGGCCCTGAGG + Intergenic
1193484346 X:82068094-82068116 TTGCTATATGACAGGCCCTCTGG + Intergenic
1195647662 X:107250437-107250459 GAGCTTTATGATAGGACCTGTGG + Intergenic
1196202971 X:112906982-112907004 CAGCTTTATGACAGGCACAGTGG + Intergenic
1199528964 X:148825700-148825722 CAGCTGTATAGCAGTCTCTGTGG + Intronic
1200225024 X:154412440-154412462 GAGCTGTAAGATATGCCCTGTGG - Intronic