ID: 953923678

View in Genome Browser
Species Human (GRCh38)
Location 3:46969268-46969290
Sequence GGGAGCAATGCCAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953923678 Original CRISPR GGGAGCAATGCCAAGGTAGA AGG (reversed) Intronic
900103656 1:973264-973286 GGGAGCAAGGCCCGGGCAGAGGG + Exonic
902560857 1:17276723-17276745 GGGCGCCATGCCAAGGCAGGAGG + Intronic
902850516 1:19152271-19152293 GGGATCAATCCCTGGGTAGAAGG - Intronic
906282540 1:44564210-44564232 GGTGGCAGTGACAAGGTAGAAGG - Intronic
908929744 1:69304235-69304257 GTGAGCATTGCCAGGGAAGAAGG - Intergenic
909531258 1:76684240-76684262 GGGATCAGTGGCAAGGTAGGGGG + Intergenic
911117890 1:94265257-94265279 GTCAGCAATGCCAAGGCAGAAGG - Intronic
915087278 1:153397315-153397337 AGGAGCAATTCCCAGGCAGATGG + Intergenic
917202718 1:172533723-172533745 GAGAGAGGTGCCAAGGTAGAGGG + Intronic
918362711 1:183775141-183775163 GTGAGTATTGCCAAGGAAGAAGG - Intronic
921263562 1:213404324-213404346 GGGAGCACTGGCCAGGTAGAGGG + Intergenic
921470297 1:215540030-215540052 GGGAGGAATCCCAAGGTTGTTGG - Intergenic
922188428 1:223296311-223296333 GGCATCAATGTCAGGGTAGATGG + Intronic
924505619 1:244680742-244680764 GGGAGAAATGGCAGGGGAGAAGG + Intronic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1065805529 10:29390494-29390516 GGGAGCAATGTCAAGGTTGGAGG + Intergenic
1065943140 10:30583167-30583189 GGGAGCAATGCCAAGGTTGGAGG - Intergenic
1067183537 10:44008008-44008030 GGGAGCATTTCAAAGGTGGAAGG + Intergenic
1068031081 10:51705968-51705990 AGGAAAAATGCCAAGGGAGATGG - Intronic
1068636171 10:59350695-59350717 GGTTGCAATGCCAAGGAAGAAGG + Intronic
1069597752 10:69683461-69683483 GTGAGCAAAGGCAAGGAAGAGGG + Intergenic
1069781612 10:70959708-70959730 GGGAGTGATGAGAAGGTAGAGGG - Intergenic
1070054819 10:72924521-72924543 GGGCTCAATGCCAAAGTAGAGGG - Exonic
1071400880 10:85269522-85269544 GGGATCAATGGCAAGAGAGAAGG + Intergenic
1074887706 10:117707375-117707397 GGGAGAACAGCCAAGGTCGATGG + Intergenic
1075222668 10:120598633-120598655 AGGAGCAGTGACAAGGCAGATGG - Exonic
1075529036 10:123211576-123211598 GGGAGTAATACTAAAGTAGAGGG - Intergenic
1079026353 11:16950923-16950945 GCAATGAATGCCAAGGTAGAAGG - Intronic
1080609587 11:33892359-33892381 GGGAGAAATTCAAAGGGAGAAGG - Intergenic
1080854167 11:36097400-36097422 TGGAGCAAAGCCAAGCCAGAAGG - Intronic
1084125445 11:67096051-67096073 GGAAGCCAAGCCAAGGTAGGCGG + Intergenic
1085773514 11:79345200-79345222 GGGAGCAAAGCCAAGAAACACGG + Intronic
1085885945 11:80521965-80521987 GGGAGGAAAGGCAAGGTATAAGG - Intergenic
1087416455 11:97862211-97862233 AGGAGTATTGCCAAGGAAGAAGG + Intergenic
1088195103 11:107265008-107265030 GGGAGAAAAGCAAAGGCAGATGG + Intergenic
1088236452 11:107729775-107729797 GGGATCAATGCCTGGGTACATGG - Intergenic
1088451803 11:109989249-109989271 GGTAGCAATGCAAATGGAGAAGG + Intergenic
1088592134 11:111413006-111413028 GTGAGCAATGCCACTCTAGAAGG + Intronic
1088711241 11:112510891-112510913 GGCAGAATTGCCAAGATAGACGG - Intergenic
1090916231 11:131165480-131165502 GGAAGCATCGCCAAGGTATAGGG - Intergenic
1092004683 12:5059396-5059418 GGGATGAATGCCAGTGTAGATGG - Intergenic
1093532545 12:20184995-20185017 GGGAGGAATAACAAGGTAGGGGG + Intergenic
1094849354 12:34375475-34375497 GGGAGCAAGCCCAAGGTGGCAGG - Intergenic
1095782842 12:46079133-46079155 GGGAGCAGGGCCAAGAGAGAAGG + Intergenic
1096768080 12:53910755-53910777 GGGAATAATGCCAAGGCAGGCGG - Intergenic
1098771951 12:74563696-74563718 GGGAGCTATGACAGGGCAGAAGG + Intergenic
1099993600 12:89753037-89753059 GGGAGCAACATCAAGGCAGAGGG - Intergenic
1101555998 12:105810074-105810096 GACAGCAATCCCAAGGTGGAAGG + Intergenic
1103603910 12:122072580-122072602 TGGAGCAAGGCCAGGGAAGAGGG - Intergenic
1109166265 13:59039319-59039341 GGGGCCAAGGTCAAGGTAGAAGG - Intergenic
1110565879 13:76957162-76957184 GGCAGCATTGCCAATGTGGAGGG - Exonic
1111102829 13:83610432-83610454 TAGAGCAAAGCCAAGGCAGAAGG + Intergenic
1114058713 14:18999778-18999800 GTGGGCAATGCCAGGGTACATGG - Intergenic
1114103831 14:19401976-19401998 GTGGGCAATGCCAGGGTACATGG + Intergenic
1114576329 14:23717510-23717532 TGGAGCAATGCCATGAAAGAGGG + Intergenic
1118033457 14:61840503-61840525 GGGAGCAAAACCCAGGAAGAGGG + Intergenic
1120228756 14:81820130-81820152 GGGAGTAATGCCAATATAAAAGG - Intergenic
1122544068 14:102512737-102512759 GGCAGCAGTGCCAAGGCTGATGG + Intergenic
1124188561 15:27551604-27551626 GGGAGCAAAGCCAGGGCAAAGGG - Intergenic
1124956183 15:34362108-34362130 GGGAGAAATGAGAAGGAAGAAGG - Intronic
1126122731 15:45268092-45268114 GGGTGCAAGGCCAATGTAGAAGG - Intronic
1131109458 15:89756054-89756076 GGGAGACATGCCCAGGGAGAAGG - Intergenic
1131760928 15:95621974-95621996 GGCAGCAATGCAAAGGAATAGGG + Intergenic
1132180030 15:99745279-99745301 GTAAGCATTGCCAAGGGAGAGGG - Intergenic
1133511490 16:6462209-6462231 TGGAGGACTGCGAAGGTAGATGG - Intronic
1133631316 16:7624846-7624868 TGGAGAAATGCCAAGGTTGTTGG + Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134747744 16:16601063-16601085 GGGAGCATTGCAAATGTAAATGG - Intergenic
1135947176 16:26875415-26875437 GTGAGCATTGCCAAGGAAGAAGG - Intergenic
1137554748 16:49463452-49463474 GGGAGGGATGGCAAGGTAGGGGG + Intergenic
1138405388 16:56788709-56788731 GGGAGGAAGGCCAAGGTTAAGGG - Intronic
1139526273 16:67518664-67518686 GGGAGCAAGGCCATGCTTGAGGG - Intronic
1139544289 16:67642385-67642407 TGGAGCCATGCCCAGGTGGAGGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1143449135 17:7025209-7025231 GGGAGAAAAGCCAAGAAAGAGGG - Intronic
1143621959 17:8085940-8085962 GGGTGCCATGCCAGGGTAGCAGG + Intronic
1143663873 17:8345084-8345106 GGGAGAAGTGCCCAGGAAGATGG - Intronic
1146519124 17:33512705-33512727 GGAGGCAGTGCCAAGTTAGAAGG - Intronic
1147977565 17:44256539-44256561 GGGAGCCAAGCCAAGGTGGCTGG + Intronic
1152316476 17:79583573-79583595 GGGATCAATGACAAGGTCAAGGG + Intergenic
1157711723 18:49854392-49854414 GGGAGCATTGCCCAGGTAACTGG - Intronic
1158457412 18:57620603-57620625 GGAAGCGATGCCACGGGAGATGG - Exonic
1165265645 19:34661498-34661520 AGGAACAAGGCCAAAGTAGAAGG + Intronic
1165309351 19:35021253-35021275 GGGAGCGTTGCCCAGGTAGTGGG + Intronic
1166059932 19:40319960-40319982 GGGAGGAAGGTCAAGGAAGAGGG - Exonic
1166774651 19:45304981-45305003 GGGAGCCATGGCAAGGTTGTAGG + Intronic
927067633 2:19489895-19489917 GGGAGCAATTTCAATGTAAAAGG - Intergenic
927246600 2:20961683-20961705 GAGAACAGTGCCAAGCTAGAGGG + Intergenic
928133563 2:28671195-28671217 GGGGGAAATGCCAACGAAGAGGG + Intergenic
928209495 2:29313013-29313035 GGGACCAGTACCAAGCTAGAGGG - Intronic
929054428 2:37863514-37863536 GAGAACAAAGCCAAGGGAGAGGG - Intergenic
932691384 2:73916692-73916714 GTCAGCAATGCCAGGGTACATGG - Exonic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
934544728 2:95205552-95205574 AGGAGTATTGCCAAGGAAGAAGG - Intergenic
937457324 2:122053910-122053932 GGGAGCAAGGCAAGGGCAGAGGG + Intergenic
937976936 2:127588227-127588249 GGGGGCCATGCCTGGGTAGAGGG + Intronic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
942433050 2:175936053-175936075 GGCTGCAATGGCAAGGCAGATGG + Intronic
942616587 2:177797154-177797176 GGGAGGAGAGCCAAGGTAAAGGG - Intronic
946898664 2:224351518-224351540 AGGAGCAAGGCCAATGCAGAAGG + Intergenic
948289395 2:236814017-236814039 GGGAGCTCTGCCAAGACAGAGGG - Intergenic
948487677 2:238291183-238291205 GGCAGCATTCCCAAGGTAGGTGG - Intergenic
948791002 2:240376838-240376860 GCCAGCCATGCCAGGGTAGAGGG - Intergenic
1169426115 20:5498642-5498664 GGCAGCAATGCCAAGGGGAATGG - Intergenic
1169981017 20:11383952-11383974 GGGAGAAATGTCAAGGAAGTTGG + Intergenic
1171358801 20:24572151-24572173 AGGAGTATTGCCAAGGAAGAAGG - Intronic
1173013823 20:39207343-39207365 TGAAGCTATGCCAAGGTAGCTGG + Intergenic
1174550636 20:51359090-51359112 GGTACCATTGCCAAGGAAGAAGG - Intergenic
1175770174 20:61618505-61618527 GGCAGCAACACCAAGGTGGAAGG - Intronic
1176268973 20:64225602-64225624 GTGTGTATTGCCAAGGTAGAGGG + Intronic
1176274199 20:64254662-64254684 GGGAGGAATGCCGAGTTAGGAGG + Intergenic
1177455594 21:21333377-21333399 GGGAGATATGACAAGGAAGATGG - Intronic
1178197655 21:30366946-30366968 TGCAGCAATCCCAAGATAGAAGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180477199 22:15722397-15722419 GTGGGCAATGCCAGGGTACATGG - Intergenic
1180557706 22:16591357-16591379 GGCATCAATGCCGTGGTAGACGG + Exonic
1182087260 22:27569650-27569672 GGGAGCAATGAAAGGGTAGCGGG + Intergenic
1184020905 22:41820871-41820893 GAGAGCCATGCCTATGTAGAAGG + Intronic
949904555 3:8848141-8848163 GGGAGTAATGTCAAGGTATGGGG - Intronic
950268946 3:11597766-11597788 AGGAGTATTGCCAAGGAAGAAGG - Intronic
950898685 3:16476711-16476733 TGGAGCAATGCCACAGTCGAAGG + Intronic
951036508 3:17938711-17938733 GGTGGCAATGCCAGGGTAAAAGG + Intronic
953042786 3:39269642-39269664 GGGAGCAGTCCCAAGCCAGATGG - Intronic
953747428 3:45585844-45585866 AGGAGCATTGCTAATGTAGAAGG - Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
956459597 3:69457991-69458013 GGGAGAAAAGCCAAGAAAGATGG - Intronic
956525737 3:70158202-70158224 GGGAGCAGGGACAAGGGAGAGGG - Intergenic
961530452 3:127537144-127537166 AGGAGGAAGGCCAGGGTAGAGGG - Intergenic
962700266 3:137991443-137991465 AGGAGCAATGCCAGGATAGGGGG - Intergenic
964472696 3:157071377-157071399 GGGAACACTGCCTGGGTAGAGGG - Intergenic
966284227 3:178274328-178274350 GGTAGCAATGCCAAGTAAGTAGG - Intergenic
968626044 4:1627129-1627151 GGGTGCAAGGCCAAGCTGGACGG - Intronic
969603092 4:8188629-8188651 GAGGGCTATGCCAGGGTAGAAGG + Intronic
973256738 4:48120984-48121006 AGGAGCAAAGCCAAGGGATATGG - Intronic
974105454 4:57464945-57464967 GGGTGCATTGTCAAGGGAGAAGG + Intergenic
976779273 4:88740124-88740146 GGAAGCCATGGCAGGGTAGAGGG - Intronic
978712702 4:111804443-111804465 GCGTTCACTGCCAAGGTAGAAGG - Intergenic
979324185 4:119360262-119360284 GGGAGGGATGCCAAGGGAGGCGG + Intergenic
980098700 4:128519935-128519957 GAGGGCACTGCCAAGGTACATGG + Intergenic
980106007 4:128589026-128589048 GGCAGGAAGGCCATGGTAGAAGG - Intergenic
981077697 4:140607436-140607458 GGGTGCCATGCCTAGGTACATGG + Intergenic
981725215 4:147840267-147840289 GGGAGCAAAGCCAGGTTTGATGG - Intronic
983176772 4:164597225-164597247 AAGAGCATTGCCAAGGAAGAAGG - Intergenic
983242024 4:165244962-165244984 GGGAGGGATGCCAAGGGAGGCGG + Intronic
984253161 4:177358712-177358734 GGGAGAAGGGCCAAGGTAGAAGG - Intronic
984851339 4:184155613-184155635 GGGAGAGATGCCGAGGGAGAGGG + Intronic
985778290 5:1856829-1856851 GGGAGCATTTCCAAGGGAGGAGG + Intergenic
986414461 5:7514768-7514790 GGGAGCAAGGCCATGTAAGATGG + Intronic
987000653 5:13656070-13656092 GGGAGCAGTGTCATGGAAGAAGG - Intergenic
987277380 5:16376039-16376061 GGGAGCATTGCCAGGTTGGAGGG + Intergenic
992769411 5:80033576-80033598 GAGAGCAATAAGAAGGTAGAAGG - Intronic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
996065347 5:119072899-119072921 GAGAGCAATGCCCAGGTGTAAGG - Intronic
996332269 5:122343024-122343046 GGAAGAAATGCCAGGGTAGATGG + Intronic
996581718 5:125038673-125038695 GGGAGGAGTGCCAAGGAAGCGGG - Intergenic
996990672 5:129626870-129626892 GGAAGTACTACCAAGGTAGATGG + Intronic
1001057795 5:168463824-168463846 GGGAGCAATGCCATGAGAAAGGG - Intronic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1004295328 6:14404970-14404992 GGGAAGAATGCACAGGTAGATGG + Intergenic
1004682260 6:17907694-17907716 GGGAGCAAATCCTAGGCAGAAGG + Intronic
1005960271 6:30688754-30688776 GTGAGCCAGGCCCAGGTAGAGGG + Exonic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007340089 6:41185943-41185965 GGGAGCAGGGCCAAGGGAGGGGG - Intergenic
1007597130 6:43058184-43058206 GGGAGCAACATCAAGGCAGAGGG + Exonic
1011508484 6:88074092-88074114 GGGAGAAAGGCCTAGGCAGAGGG + Intergenic
1011626123 6:89285226-89285248 GCCAGCAATGCCAGGGTAGCTGG - Intronic
1013524027 6:110958419-110958441 GGGAGGACTGGCAAGGCAGAAGG - Intergenic
1016149795 6:140726337-140726359 ATGAGTAATGCCAAGGAAGAAGG + Intergenic
1016149917 6:140727901-140727923 GGAAGCAATTCAAAGGTAAAAGG + Intergenic
1017535318 6:155341078-155341100 GGGAGCAAAGTCAATCTAGAAGG - Intergenic
1018489851 6:164280458-164280480 GGAAGAAATGCCAAGGAAAAGGG - Intergenic
1019420242 7:947509-947531 GGGAGCAGTGTCCAGGGAGACGG - Intronic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1022637951 7:32154963-32154985 GGGAGTAAGGCCAAGGTGGCTGG + Intronic
1024001485 7:45192517-45192539 TGGAGTATTGCCAAGGAAGAAGG + Intergenic
1025111723 7:56222781-56222803 GAGTGCAATCCCAGGGTAGAAGG + Intergenic
1027845426 7:83367780-83367802 GGGAGCAAAACCATGGTACAAGG - Exonic
1029083077 7:97990036-97990058 TCCAGGAATGCCAAGGTAGAGGG - Exonic
1030686265 7:112490102-112490124 GGGAGCAATTCCAAGGCAAGTGG + Exonic
1030980967 7:116185427-116185449 GTGAGCAATACTCAGGTAGAAGG - Intergenic
1033117107 7:138635027-138635049 GGGAGGGAGGCCAAGGCAGATGG + Intronic
1037890185 8:22619936-22619958 AGGAGAAATACCAAGGTTGAGGG - Exonic
1040001631 8:42581959-42581981 GGGAGCAAGGCAGAGGGAGAAGG - Intergenic
1041190809 8:55352193-55352215 GGGAGAGAGGCCAAGGGAGAGGG + Intronic
1042462222 8:69082901-69082923 GGGAGTAATGACAAGGAAAAAGG + Intergenic
1043843195 8:85133550-85133572 AGGAGAAATGTCAAAGTAGAAGG - Intronic
1046956396 8:120066970-120066992 AGGATCAATGCTAAGGTACAAGG + Intronic
1047366216 8:124214140-124214162 GGGAGGAATGCTCAGGTAAAGGG - Intergenic
1048049490 8:130803974-130803996 GGGAGCAGAGCAAAGGTAAATGG + Intronic
1055152639 9:73021038-73021060 GGGAGAAACGGCAAGGCAGAGGG + Intronic
1055726415 9:79234531-79234553 GGGAGCAAAGTCAAGGGAAAAGG - Intergenic
1056548211 9:87630459-87630481 GGCAGCAAAGGCTAGGTAGAAGG - Intronic
1058905402 9:109478521-109478543 GGCACCAATGCCAAGGAAGTGGG + Intronic
1060559213 9:124529030-124529052 AGGAGCCATGCCAAGGCCGAAGG - Intronic
1060861658 9:126959966-126959988 GGGAAGAATGGGAAGGTAGAAGG + Intronic
1185936115 X:4258324-4258346 GTGAGCAATACTCAGGTAGAAGG + Intergenic
1186876776 X:13825373-13825395 GGGTGGGATGCCAAGGCAGAAGG + Intronic
1186899707 X:14040759-14040781 GGGAACAATGGCAAGAAAGATGG + Intergenic
1188261703 X:28031543-28031565 GGCAGCAGTGCCAGGGCAGATGG + Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1192491844 X:71582750-71582772 GGGAGAAAGGCCATGGGAGAAGG - Intronic
1193944056 X:87710032-87710054 AGGAGAAATGCCAAGGAAAAGGG + Intergenic
1196398248 X:115288839-115288861 GGGAGGGATGCCAAGGCAGATGG + Intergenic
1198801316 X:140450599-140450621 GGGAGCAAAGCCAAGCTTTAGGG + Intergenic
1202267215 Y:23032851-23032873 GGGAGCCAAGCCAAGGTAGGTGG - Intergenic
1202420207 Y:24666595-24666617 GGGAGCCAAGCCAAGGTAGGTGG - Intergenic
1202450579 Y:25003487-25003509 GGGAGCCAAGCCAAGGTAGGTGG + Intergenic