ID: 953924762

View in Genome Browser
Species Human (GRCh38)
Location 3:46977074-46977096
Sequence GGTTAGTACTTGGGCAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953924762_953924766 -2 Left 953924762 3:46977074-46977096 CCGGTTTTGCCCAAGTACTAACC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 953924766 3:46977095-46977117 CCACACTAATCACTCCATGCTGG 0: 1
1: 0
2: 0
3: 8
4: 95
953924762_953924767 6 Left 953924762 3:46977074-46977096 CCGGTTTTGCCCAAGTACTAACC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 953924767 3:46977103-46977125 ATCACTCCATGCTGGCCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953924762 Original CRISPR GGTTAGTACTTGGGCAAAAC CGG (reversed) Intronic
903874783 1:26466294-26466316 GGTAAGTACTTGAGAAGAACTGG + Intronic
906757981 1:48339169-48339191 GGTTAATAATTTGGAAAAACTGG + Intronic
909137288 1:71817357-71817379 GGGAAGTACTTGGGCTAAAATGG - Intronic
910684668 1:89904059-89904081 GGTTTGTCCTTGGACAGAACTGG - Intronic
910818575 1:91320040-91320062 GGTAAGTTTATGGGCAAAACAGG - Intronic
912793745 1:112676931-112676953 TTTTAGTACTGGGGAAAAACTGG + Intronic
913579478 1:120211698-120211720 TGGTAGAACTTGGGCAAAAATGG + Intergenic
913628695 1:120686690-120686712 TGGTAGAACTTGGGCAAAAATGG - Intergenic
914561411 1:148823125-148823147 TGGTAGAACTTGGGCAAAAATGG + Intronic
914611424 1:149307083-149307105 TGGTAGAACTTGGGCAAAAATGG - Intergenic
919830184 1:201535453-201535475 GGGTTGGACATGGGCAAAACAGG - Intergenic
921600904 1:217105433-217105455 TGTTAGTAATTGGGGAAATCAGG + Intronic
924148171 1:241098845-241098867 TGTTCTTAGTTGGGCAAAACAGG - Intronic
924841793 1:247718610-247718632 GCTGAGTACTTTGGAAAAACTGG + Intergenic
1065034837 10:21627273-21627295 CTTTAGTACTTGGGCTAAAGAGG - Intronic
1070240102 10:74671692-74671714 GGTTAGAAATTGGTCAAACCAGG + Intronic
1075240509 10:120774268-120774290 GATAAGTACTTGGCCACAACTGG - Intergenic
1076880930 10:133238783-133238805 AGGTAGTACTTGGTCAAAAGTGG + Intronic
1078742428 11:14079738-14079760 GATCAGTACTTGGGCAATAAAGG - Intronic
1085810135 11:79672503-79672525 GATTTGTACTTTGGCAAGACCGG + Intergenic
1090128915 11:124118775-124118797 GGTTACCACTTGGGAAGAACTGG - Intronic
1096603244 12:52745618-52745640 AGTTACTGCATGGGCAAAACTGG + Intergenic
1098393955 12:69998422-69998444 GGTAAGCACTTGGTTAAAACAGG + Intergenic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1109555598 13:63971084-63971106 GGTTATTCCTTGGGGAAACCAGG - Intergenic
1112428390 13:99326166-99326188 GGTTAGGATGTGGGGAAAACTGG - Intronic
1117858226 14:60058640-60058662 GGTTATCATTTTGGCAAAACTGG + Intronic
1123222591 14:106870981-106871003 TCTTTGTACTTGGGGAAAACTGG + Intergenic
1124201713 15:27684206-27684228 TGCTAGCACTTGGGAAAAACAGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137352340 16:47724491-47724513 GGTTAGAACATGGGCACAAGGGG + Intergenic
1141112262 16:81279669-81279691 GGTTAGTACATGAGGGAAACAGG + Intronic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1147452891 17:40517111-40517133 GGATAGTACTTGGCCCAAAAGGG - Intergenic
1150221466 17:63497838-63497860 GGTCAGTGCTTGGGCCAGACAGG - Intronic
1164253245 19:23503380-23503402 GGTTTCTACATGGGCAGAACCGG - Intergenic
1164317664 19:24108118-24108140 GGTTTCTACATAGGCAAAACCGG + Intronic
1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG + Intronic
926242507 2:11099543-11099565 GGCTAGTGCTTGGGCAGAAATGG + Intergenic
930989947 2:57641170-57641192 CGTTAGCATTAGGGCAAAACAGG - Intergenic
936729656 2:115365265-115365287 GATTTGTAGTTGGGCAACACTGG - Intronic
940738410 2:157479797-157479819 GGTGAGTCCTAGGGCTAAACTGG + Intronic
1174645478 20:52081670-52081692 GGTTAGGTATTGGGGAAAACTGG - Intronic
1176254276 20:64142697-64142719 GGTGAGAACTTGGGCAGAAGAGG + Intergenic
1179222862 21:39425200-39425222 GGTTAGGACTTGGGTGACACTGG - Intronic
952255305 3:31690046-31690068 TGTTAGTAATTGGCCAAAAAAGG + Intronic
953095206 3:39768093-39768115 GGTGAGTATTTGGGCAATATAGG - Intergenic
953924762 3:46977074-46977096 GGTTAGTACTTGGGCAAAACCGG - Intronic
956607509 3:71087590-71087612 GTTTAGCACTTTGTCAAAACAGG + Intronic
960029266 3:113041364-113041386 GGTTAGTCCTTGGGGAATGCAGG + Intergenic
960173710 3:114492774-114492796 TGTTACCATTTGGGCAAAACTGG - Intronic
963844867 3:150145048-150145070 GATAAGTAATTGGGCAAAATGGG + Intergenic
973160576 4:47011223-47011245 GGTGAGGTCTTGGGCAAAACAGG - Intronic
976958522 4:90935796-90935818 GGTTACTACTGGGGAAAAAAAGG + Intronic
990014350 5:51040818-51040840 GTTTAGTAATTGGGAAAAATAGG + Intergenic
990063146 5:51676906-51676928 GCTGATTATTTGGGCAAAACTGG - Intergenic
990879258 5:60521169-60521191 GCTTTGTACTTGGGCAATATGGG - Intronic
991356248 5:65772183-65772205 GGTAAGTACTTGGAAAAAAGAGG - Intronic
993028024 5:82668542-82668564 GTTGAATACTTGGTCAAAACTGG + Intergenic
993333984 5:86634146-86634168 GGTTAGGACTTGGGCAAAGGGGG + Intergenic
993775177 5:91985496-91985518 CTTTAGTACTTTGGAAAAACGGG - Intergenic
995153660 5:108883134-108883156 AGTAAGTACTCGGGCAATACTGG - Intronic
996620185 5:125491500-125491522 GATTAGTACTAGGGCAAAAAAGG - Intergenic
1000175623 5:158749652-158749674 GTTTAGGATTTGGGGAAAACAGG + Intronic
1002057644 5:176607841-176607863 GTTTTGTGCTTGGGCACAACTGG - Intronic
1003257573 6:4487801-4487823 GGTGAGTAGTTTGGCACAACAGG - Intergenic
1004959958 6:20776873-20776895 GGTTGCAACTAGGGCAAAACAGG + Intronic
1012535345 6:100289684-100289706 GGCTAGTATTTGGGCAAACAAGG - Intergenic
1014390617 6:120857716-120857738 GGTCAGCACGTGGGCAGAACTGG - Intergenic
1016258504 6:142138952-142138974 CCTTAGTATTGGGGCAAAACTGG - Intergenic
1027195960 7:76030399-76030421 GGTAAGTACTTGGAAAAAAGCGG - Exonic
1028411042 7:90530646-90530668 GGCTAGTAGTTAGGCAAAATGGG - Intronic
1030001562 7:105069685-105069707 TGTTAACACTGGGGCAAAACAGG - Intronic
1031639318 7:124142294-124142316 GGTTAGTTCAAGGTCAAAACGGG + Intergenic
1033675063 7:143532835-143532857 GGTTAGCACTAGGCTAAAACTGG - Intergenic
1033696773 7:143796606-143796628 GGTTAGCACTAGGCTAAAACTGG + Intergenic
1043559995 8:81481602-81481624 GGTTAGAAATTGGGAAGAACTGG + Intronic
1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG + Intronic
1053456040 9:38233744-38233766 GCTTTGGAGTTGGGCAAAACTGG + Intergenic
1053597382 9:39576067-39576089 GGTGAGTAGTTGGGCTAAATAGG + Intergenic
1053855400 9:42333038-42333060 GGTGAGTAGTTGGGCTAAATAGG + Intergenic
1054568882 9:66788932-66788954 GGTGAGTAGTTGGGCTAAATAGG - Intergenic
1189396213 X:40625069-40625091 CGTTAGTTCTTGGACAAAACAGG + Intergenic
1189701401 X:43718354-43718376 GGGTAGTAGTGGGGGAAAACAGG + Intronic
1190228274 X:48562151-48562173 GGTTAGTACTTGGGAGAAGCTGG - Exonic
1193230508 X:79039626-79039648 GCATAGTACTTGTACAAAACAGG - Intergenic
1194914679 X:99691003-99691025 AGTTGGCACTTGGGCAACACAGG + Intergenic
1197435724 X:126425708-126425730 GGTTAGTCCTAGGGCTGAACTGG - Intergenic
1199672603 X:150159590-150159612 GGCTTGCACTTGGGCAAAGCAGG - Intergenic
1201959542 Y:19663773-19663795 GGTTAGTACTTTTGCTCAACAGG + Intergenic