ID: 953925547

View in Genome Browser
Species Human (GRCh38)
Location 3:46980639-46980661
Sequence AGATGGGTGGGGAGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 442}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953925547_953925557 11 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925557 3:46980673-46980695 TCAGGTGGAGTCAGAAGGTGAGG 0: 1
1: 1
2: 2
3: 37
4: 239
953925547_953925556 6 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925556 3:46980668-46980690 ATACTTCAGGTGGAGTCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 170
953925547_953925561 30 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925561 3:46980692-46980714 GAGGGGAGTGACTCAGACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 130
953925547_953925558 12 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925558 3:46980674-46980696 CAGGTGGAGTCAGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 30
4: 372
953925547_953925555 -4 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925555 3:46980658-46980680 ATCTCAGAAAATACTTCAGGTGG 0: 1
1: 0
2: 1
3: 29
4: 276
953925547_953925559 13 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925559 3:46980675-46980697 AGGTGGAGTCAGAAGGTGAGGGG 0: 1
1: 0
2: 3
3: 30
4: 486
953925547_953925553 -7 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925553 3:46980655-46980677 CCCATCTCAGAAAATACTTCAGG 0: 1
1: 0
2: 2
3: 63
4: 383
953925547_953925560 29 Left 953925547 3:46980639-46980661 CCTCCTGAGCTCCCCACCCATCT 0: 1
1: 0
2: 5
3: 44
4: 442
Right 953925560 3:46980691-46980713 TGAGGGGAGTGACTCAGACGTGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953925547 Original CRISPR AGATGGGTGGGGAGCTCAGG AGG (reversed) Intronic
900078119 1:834374-834396 AGCTGGGTGTGGAGATCAGGGGG + Intergenic
900163969 1:1237372-1237394 GGATGGGTGGGGAGCGCCTGGGG - Intergenic
900221089 1:1509574-1509596 AGAGGGGTGGGCTGCACAGGAGG + Intergenic
900702953 1:4059222-4059244 AAGTGGGCCGGGAGCTCAGGTGG + Intergenic
900750833 1:4396249-4396271 AGAGGAGTGTGGAGCTCAGGAGG + Intergenic
900761210 1:4472347-4472369 AGCTGGGTTGGGGGCTCAGCTGG + Intergenic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901705771 1:11071886-11071908 AGATTGGTGGGGAGTGCTGGAGG - Intronic
901825516 1:11858676-11858698 AGAGCGGAGGGCAGCTCAGGGGG - Intronic
902117095 1:14130238-14130260 AAATGTGTGGGGAGGGCAGGTGG + Intergenic
902650736 1:17835867-17835889 GGATGGATGGGAAGATCAGGTGG - Intergenic
903277395 1:22230919-22230941 AGATGGGTGGGCAGATGAGTGGG - Intergenic
903277445 1:22231113-22231135 AGATGGGTGGGCAGATGAGTGGG - Intergenic
903277494 1:22231315-22231337 AGATGGGTGGGCAGATGAGTGGG - Intergenic
903284806 1:22269947-22269969 AGATTAGTGGGGAGCTATGGGGG - Intergenic
903579017 1:24357338-24357360 AGCTGGGTGGGAAGTTCAGGAGG - Exonic
903744593 1:25577965-25577987 ACACAGGTCGGGAGCTCAGGGGG + Intergenic
904319898 1:29689843-29689865 GGATGGATGGGGAGCTCTGAGGG + Intergenic
904605520 1:31695812-31695834 GAATGGGCAGGGAGCTCAGGGGG + Intronic
904605801 1:31696942-31696964 AGGTGGGTGGGCAGGACAGGTGG - Exonic
904826910 1:33280054-33280076 AGCTGGGTGGGCAGCTGAGCTGG + Intronic
904905866 1:33896834-33896856 AGATGTGTGGATATCTCAGGGGG + Intronic
905269662 1:36779242-36779264 AGCTGGGTGTGTATCTCAGGAGG - Intergenic
905329859 1:37186982-37187004 AGAGAGGTCAGGAGCTCAGGTGG - Intergenic
905561347 1:38929614-38929636 ATGTGGCTGGGGAGCTCAGGAGG + Intronic
905690519 1:39939385-39939407 AGATGGGAGGATTGCTCAGGAGG - Intergenic
906139821 1:43527389-43527411 ACATGGATGAGAAGCTCAGGTGG - Intronic
906719047 1:47992611-47992633 AGATGGGCGGTGAGCGCCGGGGG + Intronic
906745028 1:48215516-48215538 AGATGGGTGCTGAGCTGAGTGGG - Intergenic
907246683 1:53113558-53113580 AGATGGCAGGGCTGCTCAGGAGG - Intronic
909977705 1:82064696-82064718 GGATGGGTGGGCAGCACTGGGGG - Intergenic
911101871 1:94101776-94101798 AGCTGGGCGGGGAGCCCAGAAGG + Intronic
912075817 1:105873761-105873783 AGAAGGTGGGGCAGCTCAGGCGG - Intergenic
912714315 1:111971630-111971652 AGATGGGTCTGGAGCTTAGCAGG - Intronic
914753920 1:150552652-150552674 AGATGGGGTGGGAGCCTAGGGGG - Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915395139 1:155577856-155577878 AGCTAGTTGGGGAGCTGAGGTGG - Intergenic
915447416 1:155981868-155981890 TGATGGGAGGGGAGGGCAGGTGG - Intronic
916379604 1:164195389-164195411 AGATGGACGGGTAGCTCAGTTGG - Intergenic
916853159 1:168724618-168724640 AGATGTGTGGGGAGAGGAGGTGG + Intronic
920674443 1:208029497-208029519 GGCTGGGCGGGGAGCGCAGGTGG - Intronic
920826708 1:209429664-209429686 AGATGAGTGGCTAGATCAGGGGG + Intergenic
921632887 1:217456021-217456043 AGATGGATGGGGAGCTGGGAAGG - Intronic
922541110 1:226420619-226420641 AAATGGGTAGGGATCTAAGGAGG + Intergenic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
923749767 1:236736756-236736778 AGATCAGTGGAGAGTTCAGGTGG + Intronic
924665601 1:246068491-246068513 TGATGGATGCAGAGCTCAGGAGG + Intronic
1063183730 10:3631342-3631364 TGATGGGTGGGGAGAGAAGGTGG + Intergenic
1063270987 10:4509794-4509816 AGATGGGAGAGGAGCCCATGTGG + Intergenic
1066515894 10:36160177-36160199 AGGTGCTTGGGGAGCTGAGGCGG - Intergenic
1066547697 10:36518792-36518814 AGGTGGGTGGGGAGGTCGGAGGG - Intergenic
1067205450 10:44208406-44208428 ATATGGGTCAGGAGCTCAGGAGG - Intergenic
1067902128 10:50253103-50253125 AGATGGCTGGGGAAGTCTGGAGG - Intergenic
1069655010 10:70081321-70081343 AGGTGTGTCGGGAGCTCAGGAGG + Intronic
1069777011 10:70933170-70933192 AGTTGGCTGGTGAGTTCAGGAGG + Intergenic
1070806250 10:79272739-79272761 AGAGGTGAGGGGAGCTCAGTGGG + Intronic
1071490226 10:86131212-86131234 AGCTGATTGGGGAGCTCAGCGGG - Intronic
1071719464 10:88128892-88128914 AGAAGGGTGGGGAAGTGAGGAGG + Intergenic
1072158859 10:92747966-92747988 AGATGGGGGGGAAGGTGAGGAGG - Intergenic
1072623519 10:97096410-97096432 AGAGTGGTGGGGAGGGCAGGAGG - Intronic
1073165930 10:101451649-101451671 AGGTGTGTGGGGACCTCAGGGGG - Intronic
1074096517 10:110318164-110318186 AGATGGATGGGGAGGCCAGGAGG - Intergenic
1074445377 10:113517336-113517358 CGATGGGTGGGGAACCCAGCTGG - Intergenic
1075959505 10:126556300-126556322 AGATGGGAGGAGAGCTGAGTGGG + Intronic
1076137946 10:128057726-128057748 AGATGGGTCAGGAGGTCATGTGG + Intronic
1076529577 10:131135656-131135678 AGCTGCCTGGGCAGCTCAGGTGG - Intronic
1076874897 10:133211127-133211149 AGAGGGGTGGTGGGCTGAGGGGG + Intronic
1077124113 11:924996-925018 AGAGGGCTGGGGAGCAGAGGGGG + Intronic
1077538999 11:3137930-3137952 AGATAGCTGTGGAGCTGAGGGGG + Intronic
1077872093 11:6270926-6270948 AGCTGGGAGCGGAGGTCAGGTGG + Intronic
1079381384 11:19940936-19940958 AGAAGGGTGTGGAGTTCAGATGG + Intronic
1081843027 11:46217160-46217182 AGATCGCTTGAGAGCTCAGGAGG + Intergenic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1083175716 11:60948868-60948890 AGATGGGTGAGGCTCTCTGGAGG + Intronic
1083476640 11:62919730-62919752 AGATGGGGTGGGAGAGCAGGGGG - Intronic
1083889826 11:65590158-65590180 AGATGGGCGGGCGGCTGAGGTGG + Exonic
1085300615 11:75456209-75456231 TGATGGGTTGGGAGATCAGCAGG + Intronic
1085474767 11:76783046-76783068 AGATTGCTGGGGCGCGCAGGGGG + Intronic
1086605905 11:88696107-88696129 AGATGGATGGGGAGGCCAGAAGG + Intronic
1087654381 11:100904637-100904659 AAAAAGGTGGGGAGGTCAGGTGG - Intronic
1088233064 11:107692862-107692884 AGATGGGTGGGGGGCAGGGGTGG + Intergenic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089196009 11:116694482-116694504 AGATGGTGGGGGAGCATAGGGGG - Intergenic
1089327464 11:117667069-117667091 AGATGGCTGGCAGGCTCAGGTGG + Intronic
1089813609 11:121152574-121152596 AGATGGGCGGTGGGTTCAGGTGG + Intronic
1090260264 11:125314355-125314377 AGATGGGTTGGGAGCCAGGGTGG + Intronic
1090277328 11:125429358-125429380 AGGTGGGCTGGGTGCTCAGGTGG - Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090457884 11:126865527-126865549 ATGGGGGTGGGGAGCTCAGGTGG + Intronic
1090553830 11:127852403-127852425 AGAGGGATGGGGAGGTCTGGGGG + Intergenic
1091450699 12:570488-570510 AGAGGAGTGGGGAGCGCAGCAGG + Intronic
1093957156 12:25233439-25233461 AGCTATTTGGGGAGCTCAGGTGG + Intronic
1096314700 12:50554232-50554254 GCATGGGTGGGTAGCTAAGGTGG - Intronic
1096681047 12:53255480-53255502 AGAAGGGTGGGGAGGGAAGGAGG + Intergenic
1096780717 12:53990680-53990702 GGATGGGTGGGGGGCTCTTGGGG - Intronic
1097837215 12:64285095-64285117 AGCTGAGTGTGGAGCTCAGGAGG + Intronic
1097853154 12:64434103-64434125 AGATGGGAGGATAGCCCAGGAGG - Intronic
1097961744 12:65538283-65538305 AGATGGGTGAAGAGCTCCAGGGG + Intergenic
1098877933 12:75886189-75886211 ACATGGATGGGGTGCTCTGGGGG + Intergenic
1099325955 12:81214581-81214603 AGATGCTTGGGAATCTCAGGAGG + Intronic
1099719408 12:86341822-86341844 TGATGGCTGGAGAGCTCAGGTGG - Intronic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1102215560 12:111159103-111159125 AGCTGGGTTGGGCTCTCAGGTGG - Intronic
1103256198 12:119543527-119543549 AGATGGGTAGGCAGATAAGGAGG + Intergenic
1104626608 12:130361346-130361368 AGATGGGAGGAGAGCTCTGGAGG + Exonic
1104722215 12:131050897-131050919 TGATAGGAGGGGAGCTCAGGTGG + Intronic
1107563630 13:41580188-41580210 AGATGGGAGGGGAGCGTAGCTGG - Intronic
1107864504 13:44690607-44690629 AGATGGGTGGGAAGTCAAGGAGG + Intergenic
1108311740 13:49199131-49199153 AGATACTTGGGGAGCTGAGGTGG - Intronic
1111046384 13:82819467-82819489 TGATGGGAGGTGATCTCAGGTGG - Intergenic
1111197994 13:84898483-84898505 AGATGGGGGTGTAGCTCATGGGG + Intergenic
1112033329 13:95476189-95476211 AGACGTGTGTGGAGCTCAAGAGG + Intronic
1113218283 13:108068972-108068994 AAGTGGGTGGGGAGGTGAGGGGG - Intergenic
1113547015 13:111160790-111160812 AGAAGGGTGAGGAGCAAAGGGGG - Intronic
1113560022 13:111271320-111271342 AGATGGGTGGGGAACTGAGGAGG - Intronic
1113683229 13:112259707-112259729 AGATTAGTGTGGAGCACAGGAGG - Intergenic
1114267307 14:21080630-21080652 AGATGGGGTGGGAGGGCAGGGGG - Intronic
1114570486 14:23663882-23663904 AGATGGGCAGGGCCCTCAGGTGG + Intergenic
1115767140 14:36634685-36634707 AGATGGGGGTGGACCTCAGGAGG - Intergenic
1116734410 14:48671018-48671040 AGGTGGGTGGGAAGCCCTGGAGG - Intergenic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1117982063 14:61351370-61351392 AGATGGGCGAGGAGTGCAGGTGG + Intronic
1118235764 14:64003990-64004012 AGAAGGGAGGGGAGGTGAGGGGG - Intronic
1118862382 14:69674554-69674576 GGAAGAGTGGGGAGCTCTGGAGG - Intronic
1118927608 14:70207022-70207044 ATATGCATGGGAAGCTCAGGAGG - Intergenic
1119227705 14:72956626-72956648 AGCTGGGTGGGGAGACTAGGAGG + Intronic
1119377860 14:74209171-74209193 AGATGGGTGGCAGGGTCAGGAGG + Intergenic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1119720435 14:76886197-76886219 AGATGGGTGGGGAGGTGGAGTGG - Intergenic
1119756491 14:77123726-77123748 TGGTGGGTGGGGAGCTATGGAGG + Intronic
1120716642 14:87847743-87847765 AGATGGGTTGGGAGCTACAGAGG - Intronic
1121293280 14:92794708-92794730 AGATGGGTGGGGAGCAGAGTGGG + Intronic
1121680965 14:95792471-95792493 AGATGAGAGGAGAGATCAGGAGG + Intergenic
1121840746 14:97131805-97131827 AGATGGGTGGGAAGATTAGATGG + Intergenic
1121865652 14:97359995-97360017 AGATGGGTGCCCAGCTCAGTGGG + Intergenic
1122513547 14:102289735-102289757 AGGCGGGTGGGAAGCTGAGGCGG - Intronic
1122768722 14:104087565-104087587 AGAGGAGTGGGGAGCCCAGCAGG + Intronic
1125003923 15:34797059-34797081 ACATGGTTGGGGAGTTCAGAGGG - Intergenic
1128380292 15:67107374-67107396 AGAAGGGTGGGGTGCTTATGTGG - Intronic
1128666951 15:69545309-69545331 GGATGGGTGGAGGGCACAGGAGG - Intergenic
1129192728 15:73946890-73946912 AGCTAGGTGGGGAGCACAGAGGG + Intronic
1129608930 15:77038111-77038133 AGCCGGGTGGGGATCCCAGGAGG - Intergenic
1129700995 15:77768708-77768730 AGAGGGGCGGGGAGCAAAGGAGG - Intronic
1129708439 15:77807957-77807979 AGCTGGGTGGGGACCAGAGGAGG - Intronic
1130020725 15:80229157-80229179 AGGTGAGTGGGGATATCAGGTGG - Intergenic
1130048669 15:80465413-80465435 AGAGGGGTGTGGACCTCAGGAGG + Intronic
1130060517 15:80566556-80566578 AGGTGGGAGGGGAGCTTTGGTGG - Intronic
1131107275 15:89743797-89743819 AAATGGGTGGGGAAAACAGGTGG - Intergenic
1132532718 16:461245-461267 TGACAGGAGGGGAGCTCAGGCGG + Intronic
1132749120 16:1449234-1449256 CGATGGGTGGGGAGCTCCACGGG - Intronic
1132852780 16:2032440-2032462 AGATGGTCAGGGAGCCCAGGAGG + Intronic
1133028801 16:3000125-3000147 ACATGGGTCGGGGGCCCAGGAGG - Intergenic
1133769453 16:8859285-8859307 TGATGGGTGGGGGGCTGTGGTGG + Exonic
1133929834 16:10223082-10223104 AGATGGGCAGGAATCTCAGGGGG + Intergenic
1134059802 16:11192316-11192338 AGAAGGATGGGGAGCCCTGGAGG + Intergenic
1135476590 16:22781618-22781640 ACATGGAGAGGGAGCTCAGGGGG + Intergenic
1136009712 16:27355654-27355676 AGAGTGGTGGGGAGATGAGGTGG + Intronic
1136271731 16:29152593-29152615 AGAGGGGCAGGGAGCTCAGAGGG + Intergenic
1139531055 16:67542948-67542970 ACTTGGGTGGGGAGTTCTGGGGG - Exonic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1139647049 16:68338918-68338940 AGAGGGCTGGGCAGCTGAGGGGG + Intronic
1139678266 16:68539845-68539867 AGATGGATGGGATGCCCAGGAGG - Intronic
1139869997 16:70099775-70099797 AGCTGTTTGGGAAGCTCAGGTGG + Intergenic
1139960284 16:70713664-70713686 AGGAGAGTGGGGAGCCCAGGAGG - Intronic
1139964169 16:70736471-70736493 AGATGTGTGGGGGTCACAGGTGG - Intronic
1140385448 16:74532772-74532794 AGCTGTTTGGGAAGCTCAGGTGG - Intronic
1140459848 16:75130947-75130969 AGATCTGTGGGGAGGTCAGCAGG - Intergenic
1141218302 16:82045279-82045301 AGATGGATGGGGGGCTCACTGGG - Intronic
1141704329 16:85656348-85656370 AGATGGACGAGGAGCTAAGGCGG + Exonic
1141807958 16:86354439-86354461 AGTTGGGTGGGGAGTACTGGGGG - Intergenic
1141818192 16:86427033-86427055 AGACGGAAGGGGAGCTGAGGAGG + Intergenic
1142075398 16:88114753-88114775 AGAGGGGCAGGGAGCTCAGAGGG + Intronic
1142215683 16:88828734-88828756 AGGTGGGTGGGGAGGTCTGTGGG + Intronic
1142702066 17:1668835-1668857 AGGTGTGTTGGGAGCTCAGCTGG - Intronic
1143722639 17:8823410-8823432 AGATGGGTTGGGTGCCCATGCGG + Exonic
1144166280 17:12614022-12614044 AGAGGAGTGGGTAGCCCAGGTGG - Intergenic
1144834572 17:18150222-18150244 GGATGGGTTGGGAGCTCATATGG + Intronic
1144874101 17:18388174-18388196 AGATGGGTGGGGAGAAGAGTTGG - Intronic
1145158123 17:20556242-20556264 AGATGGGTGGGGAGAAGAGTTGG + Intergenic
1145807036 17:27741834-27741856 AGCTGGGAGGGGAGCCCATGGGG + Intergenic
1145837231 17:27963727-27963749 AGATGGGCCTGAAGCTCAGGCGG - Intergenic
1145985387 17:29042698-29042720 TGGTGGGTGGTGAGGTCAGGGGG - Intronic
1146017687 17:29247008-29247030 AGAAGAGTGGGGAACTCTGGCGG + Intronic
1146375130 17:32288728-32288750 AAGTGGGTGGGGAGCTCCGCTGG + Intronic
1147243518 17:39106015-39106037 AGATGGGTCTGGAGCTCACAGGG - Intronic
1147428914 17:40359646-40359668 ACTTGGGGGGGGGGCTCAGGTGG + Intergenic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147904513 17:43814123-43814145 AGGTGGGGAGGGAGCTCAGCAGG - Intronic
1148158532 17:45436986-45437008 AGAGGGGTGAGGAGCGCACGGGG + Exonic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148497473 17:48061590-48061612 AGATGGGTGGAGAACTGGGGAGG + Intergenic
1150141595 17:62734336-62734358 GGGTGGGTGAGGGGCTCAGGAGG + Intronic
1150767277 17:68012148-68012170 AGATGGGAGGTAAGCCCAGGAGG + Intergenic
1151323684 17:73366190-73366212 AGGAGGGAGGTGAGCTCAGGGGG + Intronic
1151460975 17:74253726-74253748 GGATGAGAGGAGAGCTCAGGAGG - Intronic
1151484010 17:74387365-74387387 CGGTGGCTGGGGAGGTCAGGTGG + Intergenic
1151730796 17:75910064-75910086 AGATGGGGAGGAAGCTGAGGAGG + Intronic
1151791075 17:76306404-76306426 AGCTGGGTGGGGAGGCCAAGAGG - Intronic
1152404178 17:80087126-80087148 AGATGGGTGGAGGGCACAAGAGG - Intronic
1152494385 17:80660824-80660846 AGAAGGGTGGGGAGATGGGGTGG - Intronic
1152624580 17:81382362-81382384 ACATGGGTGGGGACCAGAGGAGG - Intergenic
1152688328 17:81705828-81705850 AGATGCGTGGGGTGCCCATGGGG + Intronic
1152946607 17:83201036-83201058 GGCTGGTTGGGGAGCTCCGGGGG + Intergenic
1153504260 18:5779873-5779895 AGAGGGGTGGGAGGCTCTGGGGG + Intergenic
1153678378 18:7476674-7476696 AGACGGGAGGGGAGAGCAGGGGG - Intergenic
1155060200 18:22221787-22221809 AGATGGGCTGGGAGCTCTGAAGG + Intergenic
1155144674 18:23073230-23073252 AGACGGGTTGGGGGCTGAGGTGG + Intergenic
1156182290 18:34619558-34619580 AGATTGGATGGGAGGTCAGGAGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156816342 18:41316265-41316287 AGGTGGCTGGGGAGGTGAGGAGG - Intergenic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1158480552 18:57817974-57817996 AGATGGATTGGGAGCTTTGGGGG - Intergenic
1159416241 18:68152672-68152694 AGGTGGATGGGGAGGCCAGGAGG - Intergenic
1159844215 18:73439645-73439667 GTATGGGTGGGAAGCTCAGCAGG + Intergenic
1160224161 18:76999181-76999203 AGCTGGGTGGGGCACTTAGGGGG + Intronic
1160541580 18:79626916-79626938 AGGTGGGTGGAGAGCTCTGGAGG - Intergenic
1160771189 19:831921-831943 AGGTGGGTGCGGAGCGCCGGAGG - Exonic
1161725308 19:5925140-5925162 AGATGGGCGGGTAGAGCAGGTGG - Intronic
1162829680 19:13276518-13276540 AGATGAGTGGGGAGGTGAGGGGG - Intronic
1163300925 19:16445716-16445738 ACATGGGTGGGCAGCTCCAGAGG - Intronic
1163849535 19:19655360-19655382 AGCTCGATGGGCAGCTCAGGAGG + Exonic
1164845025 19:31424630-31424652 AAATGGGTGGGGAGCCCTGGTGG - Intergenic
1166682162 19:44775693-44775715 AGATGGGGGTGGGGCTAAGGAGG + Intergenic
1166822701 19:45590448-45590470 AGATCGCTGGAGAGCCCAGGAGG + Exonic
1167523932 19:49972271-49972293 GGATTGGTGGGGAGCTGCGGAGG + Intergenic
1167575100 19:50314234-50314256 AGATCGGAGTTGAGCTCAGGTGG - Intronic
1167724566 19:51201397-51201419 AGATGGGGTGGGAGCCCAGCAGG - Intergenic
1167758191 19:51426458-51426480 AGATGGGGTGGGAGCCCAGCAGG + Intergenic
1167925733 19:52819932-52819954 ACATGGGTGGACAGCTGAGGTGG + Intronic
1167929974 19:52856231-52856253 ACATGGGTGGACAGCTGAGGTGG + Intronic
1168110444 19:54189089-54189111 AGAGGGGTGTGGAGCTCCGAAGG - Intronic
925207668 2:2021106-2021128 AGAAGGGTGGGGAGCTTAGGAGG + Intronic
926052636 2:9754516-9754538 AGAGGAGTGGGGAGGTCAGGGGG - Intergenic
926254379 2:11177345-11177367 AGGTGCCTGGGGAGCTGAGGCGG + Intronic
926790608 2:16567521-16567543 AGATCGGTGAGGAACTGAGGCGG + Intronic
927219872 2:20696873-20696895 AGATGGGAGGGGAGGTAAGAAGG - Intronic
927291144 2:21406123-21406145 AGATGTAAGGGGAGCTGAGGAGG + Intergenic
928135101 2:28682175-28682197 AGATGGATGGGGATGTCGGGGGG + Intergenic
929214895 2:39401686-39401708 AGCTGCTTGGGGAGCTTAGGTGG + Intronic
929276462 2:40030971-40030993 AGACGGGTGGGGAGAATAGGGGG + Intergenic
929610708 2:43268841-43268863 TGCTGGCTGGGGTGCTCAGGAGG + Intronic
929995788 2:46825641-46825663 AGATGGGTGGGGGCATCGGGGGG - Intronic
932090718 2:68803867-68803889 GAATGGGTGGGGAGCTCAACAGG + Intronic
932214564 2:69958553-69958575 GGGTGGGTGGGGAGCTGGGGAGG - Intergenic
932358417 2:71085875-71085897 AAGTGGGTGGGGAGAACAGGAGG - Intergenic
932370656 2:71184760-71184782 AAGTGGGTGGGGAGAACAGGAGG - Exonic
932739453 2:74280601-74280623 AGATGGGTGGTGAGACCAGAGGG + Intronic
932991137 2:76789357-76789379 AGGTGGGTGGTGAGGTCAAGAGG - Intronic
934950718 2:98573551-98573573 AGAGGGATGGTGAGCCCAGGAGG + Intronic
935736537 2:106111061-106111083 AGAGGGGTCGGAAGCTCAAGTGG - Intronic
936505662 2:113103751-113103773 AGATGGTTGGGGAGAGCAGAGGG + Intergenic
937378796 2:121356906-121356928 AGAGGGGCTGGGAGCCCAGGAGG + Intronic
937931121 2:127205848-127205870 GGCTGGAGGGGGAGCTCAGGGGG - Intronic
938226861 2:129624162-129624184 TGTGGGGTGGGGAGCTGAGGTGG + Intergenic
938791005 2:134675977-134675999 TGTGGGGTGGGGTGCTCAGGAGG - Intronic
940846025 2:158643176-158643198 AGATTGGTGAGGAACACAGGTGG + Intronic
941096394 2:161243326-161243348 AGATGGCTGTGCAGCTCAGAAGG + Intergenic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
946446656 2:219745856-219745878 AGGAGGTTGGGGAGATCAGGAGG + Intergenic
946476289 2:220009659-220009681 AGATGTGAGTGGAGCTCAGTGGG + Intergenic
947658716 2:231850420-231850442 TGCTGGGTGGGAGGCTCAGGTGG + Intergenic
947805775 2:232966865-232966887 AGGCGGGTGAGGAGCTAAGGTGG + Intronic
948342989 2:237270176-237270198 AGGTGGGTGGGAGGCACAGGTGG - Intergenic
948375292 2:237516967-237516989 GGATGGATGGGCAGCTAAGGTGG + Intronic
948385141 2:237576262-237576284 AGCTGGCTGGGGAGCTCAGTGGG - Intronic
948616525 2:239202742-239202764 AGAAGTGTGTGGAGCTCATGAGG - Intronic
948736395 2:240009136-240009158 AGGTGGGTGAGGAGCTGGGGAGG - Intronic
1168740813 20:189899-189921 AAATGGGTTGGAAGCTCAGACGG - Intergenic
1169027549 20:2383373-2383395 GGATGGGTGGAGAGCTAAGTCGG + Intronic
1170040039 20:12030335-12030357 AGATGGTTGGGGAGCAAAGGTGG + Intergenic
1170059898 20:12247889-12247911 AGAGGAGTGGGGAGGTGAGGGGG + Intergenic
1170326050 20:15155457-15155479 AGCAGGGTGGGCAGTTCAGGTGG - Intronic
1170627048 20:18037839-18037861 AGGAGGGAGGGGAGGTCAGGAGG - Intronic
1170801806 20:19596606-19596628 AGAGGGTTGGGCGGCTCAGGAGG - Intronic
1171939181 20:31308152-31308174 AGTTGGGTAGGGAGTTGAGGTGG - Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1172939476 20:38644634-38644656 AGATGGGTGGGGGGGATAGGTGG - Intronic
1173351097 20:42246309-42246331 AGATGGGAGGGGAGGGTAGGAGG - Intronic
1173479561 20:43388499-43388521 GGGTGGGTGGGGAGCTCTTGAGG - Intergenic
1173728317 20:45312046-45312068 AGATAGGTGGGGAGACCGGGAGG + Intronic
1174239790 20:49124310-49124332 AGATGGGTGGGGGGTTTAGAAGG - Intronic
1174580830 20:51570415-51570437 AGGTGGGTGAGGTGCTCAGCTGG + Intergenic
1175278819 20:57788944-57788966 AGTTGGTTGGGGAGGGCAGGAGG + Intergenic
1175853232 20:62104836-62104858 AGAAGGGAAGGGAGCCCAGGGGG + Intergenic
1175901409 20:62361310-62361332 AGAAGGGCGGGGAGCTGGGGAGG - Intronic
1177540829 21:22492051-22492073 AGTTACTTGGGGAGCTCAGGTGG + Intergenic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1178199834 21:30390917-30390939 AGATGGGTGGGGAGCTAGAAGGG - Intronic
1178899410 21:36587400-36587422 AGTGGGGTGGAGAGCTCAGGAGG - Intergenic
1179170596 21:38970094-38970116 GGCTGGGTGGGGGCCTCAGGTGG - Intergenic
1179783222 21:43715844-43715866 GGATGGATGGGGAGCTGAGAGGG - Intergenic
1179956273 21:44740936-44740958 AGCTGGGAGGGGAGGCCAGGCGG - Intergenic
1179968388 21:44819364-44819386 AGGTGGGTGGCCAGCTCAGACGG + Intergenic
1180835713 22:18928552-18928574 AGAGGGTTGGGGAGCTGGGGAGG - Intronic
1180949138 22:19713443-19713465 GGACGGGTGGGGAGCAGAGGCGG + Intergenic
1181042596 22:20199309-20199331 AGCTGGGTGAGGGGCTCTGGTGG - Intergenic
1182072117 22:27470923-27470945 AGATGGGTGGGTAGGTAAGCAGG + Intergenic
1182447626 22:30398627-30398649 AGAGAGGTGGGCAACTCAGGTGG - Intronic
1183072672 22:35407269-35407291 AGGTGGATGGGAAGCTGAGGAGG - Intronic
1183108520 22:35631192-35631214 AGATGGGAGGAGAGCAAAGGCGG - Intronic
1183411926 22:37659714-37659736 AGGTGTGTGGGGAGCAAAGGCGG + Intronic
1184036944 22:41922806-41922828 AGATGGGGTGGGAGCTGGGGTGG + Intergenic
1184044817 22:41966445-41966467 AGATGAGAGGGGAGCTCAGGGGG + Intergenic
1184057100 22:42059984-42060006 TGATGGGCATGGAGCTCAGGAGG + Exonic
1184066083 22:42122090-42122112 GGGTGAATGGGGAGCTCAGGAGG - Intergenic
1184288820 22:43487388-43487410 ACATGGGTGGTGAGCTCCGTGGG + Intronic
1184681271 22:46073574-46073596 AGTAGGGTGGGGAGGGCAGGGGG - Intronic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1185077441 22:48690920-48690942 AGATGTGGGGTAAGCTCAGGAGG - Intronic
1203285802 22_KI270734v1_random:153851-153873 AGAGGGTTGGGGAGCTGGGGAGG - Intergenic
949736086 3:7173365-7173387 AGAGGGGTGGGGAGAGCAGTTGG - Intronic
950042850 3:9931267-9931289 TGAGGGGTGAGGGGCTCAGGGGG + Intronic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
951508650 3:23477911-23477933 AGAAGGGTGAGGAGCAAAGGGGG - Intronic
953653247 3:44824870-44824892 AGCTATGTGGGGAGCTGAGGTGG - Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954414094 3:50384551-50384573 TGATGGGTGGGGTGGGCAGGGGG - Intronic
954927672 3:54251118-54251140 AGATAAGTAGGGAGGTCAGGAGG + Intronic
955693928 3:61616816-61616838 AGATGGGTGCAGAGCTGGGGTGG - Intronic
957479232 3:80770125-80770147 AGGTGGATGGGGAGATCAGAAGG + Intergenic
961182320 3:124886842-124886864 GGAGGGGCGGGGAGCGCAGGCGG - Intronic
961486764 3:127222261-127222283 AGCTGTGTGGGGGGCTGAGGTGG + Intergenic
961532317 3:127547302-127547324 AGCTCGGAGGGGAACTCAGGAGG + Intergenic
961633916 3:128321174-128321196 AGACAGGTGGGAAGCTCTGGGGG + Intronic
961923484 3:130451494-130451516 AGAAGGGTGAGGAGCTGAAGTGG + Intronic
963312093 3:143720701-143720723 AGGTGGCTGGGGAGGTTAGGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966930255 3:184671405-184671427 GCATGGTTGGGGAGCTGAGGAGG + Intronic
966930387 3:184671968-184671990 GCATGGTTGGGGAGCTGAGGAGG + Intronic
966946391 3:184779782-184779804 GGGTGGGTGGGGTGCTGAGGTGG + Intergenic
967069777 3:185952599-185952621 AGATGAGTGGGGAGCTGAAAGGG - Intergenic
968449275 4:667539-667561 AGAGGGGTGGTGGGCACAGGCGG - Intronic
968509220 4:987999-988021 AGATGGGAGGGGAGGGCTGGGGG + Exonic
968581986 4:1399448-1399470 GCATGGGTGGGGAGCACAGGGGG + Intergenic
968633294 4:1663958-1663980 ACATGGGAGGGGAGCGCACGAGG + Intronic
969467284 4:7365296-7365318 GGGTGTGTGGGGAGTTCAGGAGG + Intronic
969619575 4:8272360-8272382 AGGTGCATGGGGAGCTCAGAAGG + Intronic
969687411 4:8683428-8683450 AGATGGGTGGATAGCTGAGTGGG + Intergenic
971763702 4:30802718-30802740 ATAAGGGTGGGGATCTGAGGAGG + Intronic
971805209 4:31350060-31350082 AGAAGGGTGGGGTGTTCAGATGG + Intergenic
971831515 4:31701637-31701659 AGATGGATGGGGAGCTGGGAAGG - Intergenic
975516728 4:75256211-75256233 AAAAAGGCGGGGAGCTCAGGGGG - Intergenic
975762438 4:77632660-77632682 AGATGGGTGGGGAGGAGGGGTGG + Intergenic
977167118 4:93713372-93713394 AAATAGTTGGGGAGTTCAGGTGG + Intronic
979189228 4:117835656-117835678 AGATGGATGGGGAGGCCAGTAGG + Intergenic
981843285 4:149137040-149137062 AGAAGGCTGGGGGGCTTAGGAGG - Intergenic
982117336 4:152108424-152108446 AGATGGGAGGGGAGATGAGATGG + Intergenic
982275912 4:153637143-153637165 AGATGGTTGTGATGCTCAGGAGG - Intergenic
983527454 4:168773767-168773789 AGGTGGGTGGGGAGGCCGGGTGG - Intronic
983588613 4:169383070-169383092 AGATGAGTGGGGAGCTAGAGGGG + Intergenic
984562233 4:181284142-181284164 AGATGGGTGGGCAGATGAGGAGG + Intergenic
984751948 4:183286518-183286540 ATGTGGGTGGGCAGCTCGGGTGG + Intronic
984790097 4:183607420-183607442 AGATGGGTGGGGAGCCGAAAGGG + Intergenic
985770692 5:1808313-1808335 ATTTGGGAGGGAAGCTCAGGAGG - Intronic
985817598 5:2138102-2138124 AAATGGGTGAGGAGCCCATGGGG - Intergenic
986315687 5:6584918-6584940 AGCTGGGTGGGGCGCTGTGGAGG - Intergenic
987280311 5:16407161-16407183 AGATGGGTGAGGAGCTGAGGGGG + Intergenic
988418997 5:30982654-30982676 AGGTGTGTGGTGAGCTAAGGAGG + Intergenic
988425890 5:31063962-31063984 AGATGGAAGGGGAGTTGAGGTGG - Intergenic
988776522 5:34482309-34482331 GGATGGGTGGGGAGCTGGGAAGG - Intergenic
989667633 5:43874613-43874635 GGATGGGTGGGGACCAGAGGCGG + Intergenic
990523649 5:56604163-56604185 GGAAGGGTGGGGAGCTGAGCTGG + Intronic
990978301 5:61578366-61578388 TGGTGGGTGGGGAGTACAGGAGG - Intergenic
992080227 5:73230017-73230039 AGATGGAAGGGGAGGTGAGGGGG + Intergenic
992109466 5:73479264-73479286 AGCTACGTGGGGAGCTGAGGAGG - Intergenic
992355999 5:75984096-75984118 ATATGGGTGGGCAGTTTAGGAGG - Intergenic
994736285 5:103560588-103560610 CGATGGGTGGGGACATGAGGGGG + Intronic
996044838 5:118860003-118860025 AGATACGTGGGGAGCTGAGGTGG + Intronic
996858490 5:128038141-128038163 AGATGGGTGGTGAGGTGTGGAGG + Intergenic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
997872245 5:137516430-137516452 TGATGGGAGGTGAGTTCAGGAGG + Intronic
997872253 5:137516464-137516486 TGATGGGAGGCGAGTTCAGGAGG + Intronic
997872401 5:137517111-137517133 TGATGGGAGGCCAGCTCAGGAGG + Intronic
998130822 5:139650293-139650315 GGATGGGGGGGGAGCTAAGGGGG + Intronic
998392707 5:141797661-141797683 AGATGGGTGGGAGGGGCAGGAGG - Intergenic
999619418 5:153457206-153457228 AGGTGGGTGGGTGACTCAGGTGG + Intergenic
1002081432 5:176739895-176739917 AGATGGCTGGGGAGCCCCTGCGG - Intergenic
1002542058 5:179912973-179912995 GGATGGGTGGGGAACTGAGGAGG + Intronic
1002840585 6:901842-901864 AGCTGGCCGGGGAGCTCCGGTGG + Intergenic
1003143849 6:3493456-3493478 AGATGGGTAGGGTGCTCTGCAGG + Intergenic
1003813001 6:9805249-9805271 AAATGGTTGTGAAGCTCAGGAGG - Intronic
1004505868 6:16246257-16246279 AGCTGGGTGGGGAGGTCAGGGGG - Intronic
1004746196 6:18511230-18511252 AGATGGATGGGGAGGCCAGAAGG - Intergenic
1004928061 6:20434900-20434922 AGAGGGGTGGGGAGCCTAGAGGG + Intronic
1005102481 6:22187435-22187457 AGATGGGTGAGGGGCTCAGAAGG - Intergenic
1006084891 6:31588669-31588691 AGGTGTCTGGGGTGCTCAGGTGG - Exonic
1006613536 6:35310119-35310141 AGTTGGAGGGGGAGTTCAGGGGG - Intronic
1006881107 6:37340903-37340925 AGAAGGGAGGGGAGCTAAGGTGG - Intergenic
1007166351 6:39831635-39831657 AAATGGGTGGGAAGGTCAAGAGG + Intronic
1007301880 6:40873896-40873918 AGATGGGCAAGAAGCTCAGGTGG - Intergenic
1007323020 6:41040787-41040809 AGGTGGGTGGGGAGTCAAGGAGG - Intronic
1007662632 6:43496071-43496093 AGATGACTGGGGAGCACATGGGG + Intronic
1007770407 6:44187385-44187407 AGCTGTGTGGGGAGCTGAAGTGG + Intergenic
1008389799 6:50936808-50936830 GGATGGGAGGGGAGCACAGAAGG + Intergenic
1008605707 6:53137334-53137356 AGGTGGGTGGAGAGAGCAGGAGG - Intronic
1008687074 6:53937469-53937491 AGAAGGATGGGGAGAACAGGAGG + Intronic
1008877346 6:56343835-56343857 CGATGGTGGGGGAGCTGAGGTGG + Intronic
1008912965 6:56756359-56756381 AGATGGGTGTGGAGCACTAGTGG + Intronic
1010029828 6:71262121-71262143 AGTTGGGTAGAGAGCTCATGGGG - Intergenic
1010532714 6:76988773-76988795 AGATGGATGGGGAGAACAGAAGG - Intergenic
1011657851 6:89567560-89567582 AGATGGGTGGTAAGCTTTGGAGG + Intronic
1012425386 6:99108506-99108528 TGACGGGGGTGGAGCTCAGGCGG + Intergenic
1013286823 6:108689272-108689294 GGATGGGAGGGAGGCTCAGGAGG + Intergenic
1013367145 6:109445009-109445031 AGATGGGTAGGGTGATCAGGAGG + Intronic
1014325396 6:119986819-119986841 AGGTGGATGGGGAGGTCAGAAGG - Intergenic
1015454429 6:133409681-133409703 AGATGGGAGGAGGGATCAGGAGG + Intronic
1017077787 6:150634417-150634439 AAAAGGATGGGAAGCTCAGGAGG + Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1019064239 6:169282512-169282534 GAATGGCTGGGTAGCTCAGGAGG - Intergenic
1019555069 7:1625191-1625213 AGAAGGGAGGGGAGCTGAGATGG + Intergenic
1020022587 7:4877964-4877986 AGCTGGGTGGAGAGCTCGGCGGG + Exonic
1022909557 7:34887450-34887472 AGAACTTTGGGGAGCTCAGGCGG + Intergenic
1022915940 7:34952961-34952983 AGATGGGGGTGGTGCTGAGGTGG - Intronic
1023124557 7:36942527-36942549 ACATGGATGGGGATTTCAGGAGG + Intronic
1023865585 7:44236734-44236756 AGATGGGAGGGGAGCTGAGAGGG - Intronic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1026538833 7:71262791-71262813 AGCTACTTGGGGAGCTCAGGTGG - Intronic
1026555308 7:71403369-71403391 AGAAGTGTGGGAAGGTCAGGTGG + Intronic
1027122966 7:75535466-75535488 AGCTAGTTGGGGAGCTAAGGTGG - Exonic
1028835109 7:95366033-95366055 AGTGGGGTGGGGAGGGCAGGGGG + Intronic
1029122494 7:98278283-98278305 AGATGGGCGGGGGGCTGGGGGGG + Intronic
1029443657 7:100601449-100601471 AGATGGGTGGGAAGCTTTCGGGG - Intergenic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1029612452 7:101634332-101634354 AGATGGGACGGGAGCTGGGGAGG - Intergenic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1032012546 7:128356458-128356480 AGATGGGTGATGAGGTCAAGAGG - Intronic
1033363147 7:140652071-140652093 AGAGGGGTAAGGAGGTCAGGGGG + Intronic
1033369282 7:140694496-140694518 AGATGGTTGGGGAGATGACGCGG + Intronic
1033621160 7:143063032-143063054 TGATGGTTGGGTAGCGCAGGGGG + Intergenic
1033970616 7:147034684-147034706 AGGTGGATGGGGAGGTCAGAAGG + Intronic
1034266301 7:149782698-149782720 GCAGGGGTAGGGAGCTCAGGTGG + Intergenic
1034459672 7:151191499-151191521 AAATGTGTGTGGAGCTCAGCTGG - Intronic
1035322504 7:158042308-158042330 AGAGGGGTCGGGAGTTCCGGTGG + Intronic
1035527499 8:325296-325318 AGCTGGGTGTGGAGATCAGGGGG - Intergenic
1035530520 8:347049-347071 AGGAGGGTGGGGAGGTGAGGGGG + Intergenic
1035781944 8:2234436-2234458 GGAAGCGTGGGAAGCTCAGGCGG + Intergenic
1035810175 8:2484979-2485001 GGAAGCGTGGGAAGCTCAGGCGG - Intergenic
1035920270 8:3668711-3668733 GGATGAGTTGGGAGCTCAGGAGG + Intronic
1036084964 8:5603388-5603410 AGATTGGTGGGGGGCTGGGGGGG + Intergenic
1036195321 8:6708621-6708643 AGGCGGGCGGGGAGCGCAGGCGG + Exonic
1036539121 8:9686354-9686376 AGATGGATCGGGAACTCAGATGG - Intronic
1039676945 8:39678503-39678525 TGATGAGTGGGGATCTCAGGAGG + Intronic
1039984826 8:42438417-42438439 AGATGCTTGGGAGGCTCAGGCGG - Intronic
1040452439 8:47561665-47561687 AGATGGGGGAGGATCCCAGGAGG - Intronic
1040464983 8:47686111-47686133 AGCTGGGTGGGGAGCCATGGTGG - Intronic
1041109969 8:54474946-54474968 AGATGGTGGAGGAGCTGAGGGGG + Intergenic
1041527377 8:58822532-58822554 AGCTGGGTGGGTACCTCAGCTGG - Intronic
1044618088 8:94162827-94162849 AGATGTGTGTGGAGTGCAGGTGG + Intronic
1045647823 8:104316553-104316575 GCATGGGTGGGGAGCACAGGTGG + Intergenic
1045706990 8:104935595-104935617 AGATGAGGGGGGAGATCAAGTGG + Intronic
1046330093 8:112702709-112702731 AGTAGGGTGAGGAGGTCAGGAGG + Intronic
1048179233 8:132180108-132180130 AGGTGGGTGGGAAGCCCATGTGG + Intronic
1048456461 8:134583099-134583121 AGGTGGGTGGTGAGCTCGGTGGG - Intronic
1049283697 8:141763266-141763288 AGCCAGGTGGGGAGGTCAGGAGG + Intergenic
1049462184 8:142735332-142735354 AGATCAGCGGGCAGCTCAGGGGG - Exonic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049569603 8:143362965-143362987 TGGTGGGTGGGGGGCACAGGCGG - Intergenic
1049717143 8:144098427-144098449 AGCTGGGTGGGGGGCTCTGTAGG + Intergenic
1053316748 9:37058638-37058660 GGATGTGTGGGGAGCTAGGGGGG - Intergenic
1055020179 9:71660958-71660980 AGCTGCTTGGGAAGCTCAGGTGG - Intergenic
1057064852 9:92039032-92039054 AGCTAGTTGGGAAGCTCAGGTGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057457567 9:95228192-95228214 AGATGGGAGGGGAGCCAGGGCGG + Intronic
1057716949 9:97502584-97502606 ACAGGTGTGGGGAGCGCAGGCGG - Intronic
1058275820 9:103039318-103039340 ACATGGCAGGGGAGCTGAGGTGG + Intergenic
1059546748 9:115183494-115183516 AGATGGTTGGGGAGGTGGGGTGG + Intronic
1061793793 9:133071806-133071828 AGATGGGAGGGGAGCCCCTGGGG - Exonic
1061796225 9:133087302-133087324 AGATGGGAGGGGAGCCCCTGGGG - Intronic
1061955057 9:133957003-133957025 AGCTGGGTGGGGAGCTGGGCAGG - Intronic
1061999135 9:134207329-134207351 AGACGGGTGGAGAGGACAGGTGG - Intergenic
1061999196 9:134207505-134207527 AGACGGGTGGAGAGGACAGGTGG - Intergenic
1061999258 9:134207681-134207703 AGACGGGTGGAGAGGACAGGTGG - Intergenic
1062051877 9:134451709-134451731 AGATGGGTAGGGAGATGAGGTGG - Intergenic
1062138695 9:134943788-134943810 AAATGGCTGGGGAGGTCCGGGGG + Intergenic
1062166089 9:135107973-135107995 AGATGGCTGGGGAGGGGAGGGGG + Intronic
1186311402 X:8323384-8323406 AAATGGGAGGGGAGCTAAAGAGG - Intergenic
1186356752 X:8799416-8799438 AGATGGCTGGGGAGGTCCTGTGG - Intronic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1187394707 X:18909259-18909281 AGATGGGAGGGGGGCACAGAAGG + Intronic
1189472833 X:41327525-41327547 AGATGGGTGGGGAACCATGGAGG + Intergenic
1190302294 X:49064008-49064030 AGATGGGTGTGGAGAGCAAGAGG + Intronic
1190837710 X:54116569-54116591 AGATGGGTGGGGACATTAGCTGG + Exonic
1192189876 X:68984259-68984281 AGGTGGCTGGGGTGCTCAGTTGG - Intergenic
1192269470 X:69565136-69565158 AGATGGGAGGTGTGCGCAGGTGG + Intergenic
1193588719 X:83360884-83360906 AGGTGGTTGGGGATATCAGGTGG + Intergenic
1194557885 X:95384865-95384887 AGCTTGGTTGGGAGCTGAGGAGG - Intergenic
1196187278 X:112757912-112757934 ATATGGGTCTGAAGCTCAGGAGG - Intergenic
1197873094 X:131078651-131078673 AGATGGGTGGGGTGGGGAGGGGG - Intronic
1199137072 X:144266104-144266126 ACAGGGGTGGGGTGCTCATGGGG - Intergenic