ID: 953925570

View in Genome Browser
Species Human (GRCh38)
Location 3:46980770-46980792
Sequence CTGTGGGTACAGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953925570_953925579 -5 Left 953925570 3:46980770-46980792 CCATTTTCCTTCTGTACCCACAG 0: 1
1: 0
2: 7
3: 47
4: 453
Right 953925579 3:46980788-46980810 CACAGCAGGGAGGGATCCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 312
953925570_953925578 -6 Left 953925570 3:46980770-46980792 CCATTTTCCTTCTGTACCCACAG 0: 1
1: 0
2: 7
3: 47
4: 453
Right 953925578 3:46980787-46980809 CCACAGCAGGGAGGGATCCCAGG 0: 1
1: 0
2: 2
3: 34
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953925570 Original CRISPR CTGTGGGTACAGAAGGAAAA TGG (reversed) Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
900785924 1:4650493-4650515 CTCCGGGTACAGATGGAAAGAGG - Intergenic
901318283 1:8323683-8323705 CAATGGGTGCTGAAGGAAAAGGG + Intronic
901421055 1:9151516-9151538 TCGTGGGTGCGGAAGGAAAAAGG - Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
902771751 1:18649205-18649227 GTGCGGGTACAGGAGCAAAACGG + Intronic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905646781 1:39630309-39630331 CTGCGGGTACAGAAGACAGAAGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907113992 1:51952579-51952601 CTGAGGGTACAGAAACAATAAGG - Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908075633 1:60514757-60514779 ATGTGTGTACAGAAAAAAAAAGG + Intergenic
908200727 1:61792829-61792851 TTGAGGGTAAAGAAGTAAAATGG - Intronic
908632212 1:66121572-66121594 CTGTTGTTCCAAAAGGAAAATGG + Intronic
908965553 1:69757788-69757810 CTGTGGATACAGAAGCAAATGGG + Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909670657 1:78184686-78184708 CTGAGGTTACATAAGGAAAGTGG - Intergenic
909820714 1:80056334-80056356 CTGTGGCTTCAGTAGGCAAAAGG + Intergenic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
911809808 1:102261444-102261466 CTGTAGGCCCAAAAGGAAAAGGG - Intergenic
912738814 1:112174661-112174683 TTGTGGGTGCAGAAAAAAAAAGG + Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
915498090 1:156295185-156295207 CAGTGGGGACAGGATGAAAAGGG + Intronic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917541919 1:175922629-175922651 CTGAGGTTACAGAAAGAATAGGG - Intergenic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
918008867 1:180567762-180567784 CTGGGGTGAGAGAAGGAAAATGG - Intergenic
918477336 1:184939381-184939403 TTGTGGGGACAGTAGGAATAGGG - Intronic
919497282 1:198288729-198288751 CTGTGGTGACAGAAGTAAACAGG - Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920097349 1:203495120-203495142 CTGTGGGTACAGAATGAATGAGG - Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921488934 1:215750227-215750249 TTGGGGGAACAGAAGTAAAACGG + Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
923096046 1:230775965-230775987 CTATGGGAAAAGAATGAAAAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
1063212032 10:3889319-3889341 CTCTGGGTACAGAAGTAAAAAGG - Intergenic
1063438333 10:6052551-6052573 TTGAGGGTACAGGAGGAAGAGGG - Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1066983621 10:42443009-42443031 CTTTGGGGACACAAGGAAAAGGG + Intergenic
1068839483 10:61593979-61594001 CTATGGGTAAACAAGTAAAAAGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1070335542 10:75452070-75452092 CCTTGGGTACTGAAAGAAAAAGG - Intronic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072866238 10:99065310-99065332 AACTGGGTGCAGAAGGAAAATGG - Intronic
1073185573 10:101613378-101613400 CTGGGGGAAATGAAGGAAAAGGG + Intronic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1075203329 10:120424648-120424670 CTGTGGGTTCTGGAGGAGAAGGG + Intergenic
1075340015 10:121639501-121639523 TTTTGGCTACAGAAGGAAGAAGG - Intergenic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1078493800 11:11796048-11796070 CTTGGAGTACAGAAGGGAAATGG - Intergenic
1078910408 11:15725790-15725812 CTCTGGGTACAAAAAGAGAAGGG + Intergenic
1079089009 11:17467737-17467759 CTGCAGGGACAGAAGGAAATGGG - Intronic
1079091154 11:17481204-17481226 CTGGGGGTACAGGAGAAATACGG - Intergenic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079721662 11:23822509-23822531 CTGAAGGAACAGAAGGCAAAAGG - Intergenic
1080368086 11:31600897-31600919 ATGGGGGTACAGGAGGAAAACGG - Intronic
1081471507 11:43376591-43376613 CTGTAAGTCCAGAAGCAAAAAGG - Intronic
1082116878 11:48338320-48338342 CTGTCTGTAAAGAAAGAAAATGG - Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1084175074 11:67418733-67418755 CTGTGGGCAGAGAAGGCAAGTGG - Intronic
1084572718 11:69969216-69969238 CTTTGGGGACAGCAGGAGAAGGG - Intergenic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1087079226 11:94153616-94153638 CTGTGGCTGCATAAGGTAAAGGG + Exonic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1087454041 11:98361065-98361087 GTGTGGGTACAGGAATAAAAGGG + Intergenic
1089676804 11:120095892-120095914 TGGTGGGTACAGAAGGAACTTGG - Intergenic
1090517878 11:127448140-127448162 GTGTGGCTAGAGAAGGAAATTGG - Intergenic
1090711029 11:129385392-129385414 CTGTCCTTTCAGAAGGAAAAAGG + Intronic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1090800642 11:130169489-130169511 CTGTGGTTACAGAAGGCCATGGG + Intronic
1090887897 11:130895310-130895332 CTGGGGGACCAGAAGCAAAATGG - Intronic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091087815 11:132740090-132740112 CAGAGGGTACAGAAAGAAAAGGG + Intronic
1091718831 12:2797706-2797728 CTGCAGGTACAGAAGCAAACAGG - Intronic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1093077080 12:14769836-14769858 CTGGGGGTCTAGAAGGGAAACGG - Intronic
1093334168 12:17880270-17880292 CTGTTGGTAGAAATGGAAAATGG + Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096272035 12:50173063-50173085 CTGTTGGTAAAGCAGAAAAAGGG - Intergenic
1096373275 12:51086127-51086149 CTGTGCATACAGAAGACAAAAGG + Intergenic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1098153510 12:67572887-67572909 CTGAGGGTACAGAAAAGAAAAGG + Intergenic
1098289187 12:68940204-68940226 ATGTGGGTAGGGCAGGAAAAGGG - Intronic
1098747497 12:74258455-74258477 CTGTGGGAAGATAAGGATAAAGG + Intergenic
1100022175 12:90082855-90082877 TTGTGGGTAGAGGAGTAAAAAGG + Intergenic
1100639278 12:96466275-96466297 CTCTTGGAACAGAAGAAAAATGG - Intergenic
1101329570 12:103746559-103746581 CCATGGGTACAGAATGAAAGTGG + Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1103563832 12:121805592-121805614 CTCTGGGTTCGGAAGGAAAGGGG - Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1104509439 12:129363358-129363380 TCGTGGCTACATAAGGAAAATGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104633420 12:130423603-130423625 CTGTGGGCACAGAAAAGAAATGG + Intronic
1108902396 13:55428011-55428033 CTTTGGGGACTCAAGGAAAAGGG + Intergenic
1109588230 13:64438662-64438684 ATATGTGTAAAGAAGGAAAAAGG - Intergenic
1111215661 13:85137771-85137793 CAGTGGGTACAGTAAGAACATGG + Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111885042 13:94009742-94009764 CTGTGGGCAGAGAATGGAAATGG + Intronic
1112502949 13:99956465-99956487 CGGAGGGTCCAGAAGGAAAGTGG - Intergenic
1112915943 13:104550478-104550500 CTCTGGTTTCAGGAGGAAAATGG + Intergenic
1113127627 13:106997852-106997874 CTGTGTGTACAAAAGTAAACGGG - Intergenic
1113414418 13:110117133-110117155 CTGGGGTGACCGAAGGAAAAAGG - Intergenic
1114379461 14:22185877-22185899 CTGTTGGTACAAGAAGAAAACGG + Intergenic
1114836004 14:26203686-26203708 CTGAGGGTACAGAAGAAAAGGGG - Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1116251388 14:42487429-42487451 AGATGGGTAAAGAAGGAAAAAGG + Intergenic
1116275057 14:42822637-42822659 CTGTGGGTAAAAATGGGAAATGG - Intergenic
1116666041 14:47776932-47776954 TTGAGGTTACAGAAGGAATAGGG + Intergenic
1116964887 14:51003825-51003847 CTGGGGGTAAATAAGGAAAACGG - Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118114439 14:62759451-62759473 CTGTGCTTACAGAAGGATATTGG + Intronic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1119203228 14:72774402-72774424 CTGTTGGTAGAAATGGAAAATGG - Intronic
1119417340 14:74481317-74481339 CTGTTAGGACAGAAGGCAAAGGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119887725 14:78157544-78157566 GTGTGTGTACATAAAGAAAACGG - Intergenic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG + Intergenic
1121573377 14:94964218-94964240 TTGTGGGTACAGAAGCAGGAGGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1121910161 14:97782795-97782817 CTGTGGATACAGAGAGTAAATGG + Intergenic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1126399572 15:48255788-48255810 CTGTGGATAAAGGAGGAAATTGG - Intronic
1126840801 15:52715582-52715604 CTGTGACGAAAGAAGGAAAAGGG + Intergenic
1128070059 15:64789947-64789969 CTGAGGGGGCAGGAGGAAAAGGG - Intergenic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1130229951 15:82089232-82089254 ATCTGGGTACTGAAGGAAAGGGG - Intergenic
1131158002 15:90086797-90086819 CTTTGGTTCCAGTAGGAAAATGG - Intronic
1131273207 15:90959408-90959430 CTGTGGGTGCAGTTGAAAAAGGG + Intronic
1131433238 15:92403084-92403106 ATGTGGTTACAGTAGGAAAGGGG - Intronic
1131472172 15:92706944-92706966 CTGTGGGCTCAGAAGCACAAAGG + Intronic
1132279155 15:100597725-100597747 TTGTGGGGGCAGATGGAAAAGGG - Intronic
1134528804 16:14965971-14965993 CTGTGTGCCCAGAAGGCAAATGG - Intergenic
1136402944 16:30028390-30028412 CAGGGGGTACAGAAGCTAAACGG + Intronic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1137398063 16:48131140-48131162 CTGTTGATACAGAAGGGAAAAGG + Intronic
1138538017 16:57670024-57670046 CTGTGGCTACAGGAGGGAAATGG + Intronic
1139141993 16:64276604-64276626 TTGTGGGCATAGAAAGAAAAGGG + Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1139435410 16:66934065-66934087 ATGTGGGAAGTGAAGGAAAAGGG + Exonic
1139867560 16:70075006-70075028 CTGTGTGCCCAGAAGGCAAATGG + Intergenic
1140255419 16:73331491-73331513 CTGTGGCAACAGAAGAACAAAGG - Intergenic
1141303698 16:82841031-82841053 CTGTGATGACAGAAGGCAAATGG + Intronic
1141525497 16:84608526-84608548 CTGTGGGCAAAGAAGGCAATGGG + Intronic
1142073615 16:88104756-88104778 CTGTGGGGACAGGCAGAAAACGG - Intronic
1143049950 17:4116971-4116993 CAGCTGGTACAAAAGGAAAAGGG - Exonic
1143546836 17:7601989-7602011 ATCAGGGTACTGAAGGAAAATGG + Intronic
1143881529 17:10033786-10033808 CTGCAGGCACTGAAGGAAAATGG + Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145254004 17:21312940-21312962 TTGAGGTTACAGAAGGAATAAGG + Intronic
1146671440 17:34740826-34740848 CTCTGGGTACAGAAATGAAAGGG + Intergenic
1148470263 17:47888900-47888922 GTGTGGGTTCAGAAGGACCAGGG - Intergenic
1148486497 17:47994507-47994529 CTGTGGATAGACAAGGAAAGGGG + Intergenic
1148964909 17:51426993-51427015 CTGTGGGTTCTGAAGAAGAAAGG + Intergenic
1149349335 17:55771524-55771546 CTCAGTCTACAGAAGGAAAAAGG + Intronic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150470432 17:65432677-65432699 CTATGTGTCCAGGAGGAAAATGG - Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1151623303 17:75260960-75260982 CTGTGGTCACTGCAGGAAAAAGG + Intronic
1151800860 17:76378869-76378891 CTAAGGGTACAGGAGGAAAGGGG - Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153372276 18:4332798-4332820 CTGAGAGGTCAGAAGGAAAATGG - Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1154014185 18:10601879-10601901 CTGTTTGTACAGAAAAAAAAAGG - Intergenic
1154134447 18:11763348-11763370 CTGTGGTTACAGAAGTGAAGTGG - Intronic
1156996719 18:43477994-43478016 CTGTAACTACAGAAAGAAAAAGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157304366 18:46506380-46506402 GTGTGGGTTCAGAAGGAAGCAGG + Intronic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1157493384 18:48139030-48139052 CTGTGGGTGCATAAGGAACAGGG + Intronic
1157630722 18:49092757-49092779 ATCTGGGGACAGAAGGAGAAGGG + Intronic
1158323833 18:56293231-56293253 CACTAGGTACAAAAGGAAAAGGG + Intergenic
1158856318 18:61545961-61545983 CTTTGGGCACAGATGGGAAAAGG + Intronic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1160662878 19:309187-309209 CTGATGCTACAGAAGGGAAAGGG - Intronic
1161979034 19:7621014-7621036 CTGTGCGTACAGCAGGTACAAGG + Exonic
1162823025 19:13234846-13234868 CTATGGGAACAGAAGGATGAAGG + Intronic
1164025577 19:21348722-21348744 CTGAGGGTACTGCAGGAGAACGG + Intergenic
1164070735 19:21765981-21766003 CTGTGCCTAGAGAAGGTAAAAGG + Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165193708 19:34084832-34084854 CTGAGGCTACAGAAAGAATAAGG + Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165635066 19:37333758-37333780 CTGTGGATACAGAATTTAAAGGG + Intronic
1165899334 19:39161557-39161579 CTGTGGGGGCAGAACGGAAAGGG - Intronic
1167702727 19:51060094-51060116 CTGTGGGTGCAGAAAGAAGGTGG + Intronic
1168041917 19:53765656-53765678 GGGTGGGTACTGAAGGCAAATGG - Intergenic
1168070279 19:53946244-53946266 CTGAGGTTACAGAATGTAAAAGG - Intergenic
925824404 2:7833298-7833320 ATGTGGGAGCAAAAGGAAAATGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926829934 2:16950661-16950683 TTGTGGGGACAGAAGACAAAGGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928651557 2:33409543-33409565 CTGTGGGTAACAAAGGCAAAAGG - Intergenic
928852025 2:35759569-35759591 CTGTGAGAACATAAAGAAAATGG - Intergenic
929882168 2:45846627-45846649 CTGTGGCTGCAGAAAGAAACAGG - Intronic
930575651 2:53143826-53143848 GCGTTGGTATAGAAGGAAAAAGG + Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
931324400 2:61203693-61203715 GTGTGGGTAAAGAAAGATAAAGG + Intronic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
932056015 2:68445100-68445122 CTGCTGGTACAGGAGGACAATGG + Intergenic
932581272 2:72994100-72994122 CAGGGGGTGCAGCAGGAAAAAGG + Intronic
932972978 2:76568345-76568367 CTGTGGAAACATAAGGGAAAAGG - Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933639517 2:84744327-84744349 CTGTAGGTACAGAATGCATATGG - Intronic
935266626 2:101400531-101400553 CTCTGAGTACAGAAGGGACAGGG - Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935598964 2:104902581-104902603 CTATCGGTACAGCAGGAAAGGGG - Intergenic
935624732 2:105162738-105162760 CTGTGGGCCCAGTAGAAAAAGGG + Intergenic
937608556 2:123832013-123832035 CTGTGGGTACACAATGTATAAGG - Intergenic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
941667314 2:168255283-168255305 CTGTGGGTAAAATAGGCAAAAGG + Intergenic
942620653 2:177842244-177842266 GTCTGGGCACAGAAGTAAAACGG + Intronic
942717148 2:178906361-178906383 CTGTGGGTATATGAGGAGAAAGG + Intronic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944003523 2:194873252-194873274 CTGTGGATACATAATCAAAATGG - Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945775702 2:214103830-214103852 TTGTGGGTACAGAAGGAAAGGGG + Intronic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
948629011 2:239289817-239289839 CAGTGTGTACAGTAGGGAAACGG - Intronic
1168807273 20:679344-679366 CTGTGGGTAAATAAGGCAAGTGG + Intergenic
1169381834 20:5113802-5113824 CTGTGAGTGGAGAAGGAAATAGG - Intergenic
1169511270 20:6266794-6266816 CTGTGAGGACTGAATGAAAAAGG - Intergenic
1172462006 20:35126306-35126328 CTGTGGGTTCAGATGTACAAGGG - Exonic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173642590 20:44614511-44614533 CTGTGGGGACAGAAGGCAAGGGG - Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174217336 20:48926778-48926800 CTTTGGGTACAGCAGGCAATGGG + Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174480763 20:50829659-50829681 CCTTGGGTTCTGAAGGAAAAAGG + Intronic
1177460154 21:21398246-21398268 CTTTGGGGACTGAAGGGAAAGGG + Intronic
1178152403 21:29810534-29810556 CTGAGTTTAAAGAAGGAAAATGG - Intronic
1178671178 21:34592922-34592944 ATGTGGGAACTGAAGGAAAGAGG + Intronic
1178909678 21:36664398-36664420 GAGGGGGTGCAGAAGGAAAAGGG + Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1181207053 22:21260883-21260905 GTTTGGTTACAGAAGGAAACAGG + Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1183480893 22:38064979-38065001 CTGTGGGTGCATAAGGAGAGTGG - Intronic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184021062 22:41821825-41821847 ATGTGGGCACAGAAGCAAATGGG + Intronic
1184808513 22:46812332-46812354 CTGTGGGCACAGCAGGCACAAGG + Intronic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
950769173 3:15297360-15297382 CTGTGGGTAGAAGAGGAAACAGG - Intronic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
951274100 3:20664001-20664023 GAGTGGCTACAGAAGGAAAGGGG - Intergenic
951331539 3:21374985-21375007 CTAGAGGTAAAGAAGGAAAAAGG + Intergenic
952120830 3:30242289-30242311 TTCTGGGAACAGAAGGAAAAGGG - Intergenic
952432403 3:33236414-33236436 GTGTGCCTACAGAAGCAAAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954407407 3:50353115-50353137 CAGTGGGGAGAGAAAGAAAAAGG + Intronic
955386288 3:58483793-58483815 CTTTTGCTACAGAAGGAAAAAGG - Intergenic
959529598 3:107418203-107418225 GTGTGGGGACAGGAGGTAAACGG + Intergenic
959708008 3:109357310-109357332 CTGAGGTTACAGAAAGAAGAGGG - Intergenic
960508807 3:118524299-118524321 CTGAGGATACAGGAGGAAAGAGG - Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
962915998 3:139904280-139904302 CTGTGAGAACATAAAGAAAAAGG + Intergenic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963318421 3:143785791-143785813 CTGAGGGTACTGAAGAATAAAGG + Intronic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963690507 3:148495014-148495036 CTGTGGATACAACAGGGAAAGGG + Intergenic
963946146 3:151147519-151147541 CTGCGGCTACTGAAGGCAAATGG - Intronic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964423287 3:156527654-156527676 CTGAGAGGACAGGAGGAAAAGGG - Intronic
964967710 3:162518284-162518306 CTAGGGGTACAGAAGGAAGCTGG - Intergenic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
966571258 3:181446093-181446115 ATGTGGTTCCAGAAGGAAAGTGG + Intergenic
967213822 3:187193075-187193097 TTATGGGTACAGAAAGAAAAGGG - Intergenic
967708017 3:192675048-192675070 CTTTAGGTGCAGAAAGAAAATGG + Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
971498966 4:27298428-27298450 CTGTGGCTTCAGAAGGATAGGGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
971640553 4:29126570-29126592 GTGTGGGAACAGATGAAAAATGG + Intergenic
972388263 4:38588532-38588554 CTGGGGGTACAGCAATAAAAAGG + Intergenic
973891546 4:55372413-55372435 GTTTGGGCAAAGAAGGAAAAGGG - Exonic
973981772 4:56313989-56314011 CTGTGGGTGGAGAAAGCAAAAGG + Intronic
974466849 4:62268862-62268884 CTGTGAATACAAAAGGAAACAGG + Intergenic
975499289 4:75067492-75067514 TGAGGGGTACAGAAGGAAAAAGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
978315449 4:107430788-107430810 CTGGAGGTACAGGAGGGAAAGGG - Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
979266658 4:118711482-118711504 CTGTTGTTACAAAATGAAAAAGG + Exonic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
981417992 4:144515887-144515909 CTGATGGTTCAAAAGGAAAATGG - Intergenic
982167676 4:152629502-152629524 CTGTGGGCCCACCAGGAAAAAGG - Intronic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
982754159 4:159198817-159198839 ATGTGTGTACATAAAGAAAATGG + Intronic
983188837 4:164732819-164732841 CTGCGGGTAAAGTAGGAAGAAGG + Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
983876086 4:172875874-172875896 TAGTGGGTACAGGAGGTAAATGG - Intronic
984312932 4:178086543-178086565 CTGTTGGCACAGAAGGGAACAGG - Intergenic
984376499 4:178937645-178937667 CTTTGGTTTCAGAAGGGAAATGG - Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985980729 5:3460987-3461009 CTGTGTTTTCAGAATGAAAAGGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986953255 5:13117588-13117610 CTATGGGTACAGATGAAAAATGG - Intergenic
987833472 5:23129374-23129396 ATGTGTGTACAGCAAGAAAAGGG - Intergenic
988832274 5:34999448-34999470 GTGTGGGTGCAGCAGAAAAAGGG - Intronic
989233620 5:39117546-39117568 ATGTGGGTACAAAAGATAAAGGG - Intronic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
990446716 5:55899904-55899926 CTTTGGGTTCAGAAGGCAAGAGG + Exonic
990527324 5:56640825-56640847 GTGTGGGCACACAAGGAAAGAGG + Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
991690825 5:69223496-69223518 ATGTGGGCACAGAAGCAAATAGG - Intronic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
995408852 5:111832178-111832200 CAGTAGGTACAGAGGAAAAAAGG + Intronic
995429774 5:112061165-112061187 CTTTGGGTACAGAAAGCAAAAGG + Intergenic
995949366 5:117691053-117691075 CTGATGGAACAGAAGTAAAAAGG + Intergenic
996206756 5:120747590-120747612 TTGTGGGTACAGAATGCCAAGGG - Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996600511 5:125257550-125257572 CTGTGTGTATAGCAGGGAAAGGG - Intergenic
997364690 5:133318487-133318509 GTGGGGGTACAGAATGAAAGTGG + Intronic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
998031046 5:138868344-138868366 CAGTGAGTACAGATGGGAAAAGG - Intronic
998041639 5:138954309-138954331 CTGTGGGTACGGCAGGACCATGG + Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003466032 6:6380898-6380920 ATGTGAGGACACAAGGAAAAAGG + Intergenic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1004270374 6:14189973-14189995 CTGAGGGGACATAAGGTAAAAGG - Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005109076 6:22258851-22258873 ATGTGGGTAATGAAGGAAAAAGG + Intergenic
1005423026 6:25672522-25672544 CTGAGGGTACAGGAGGCACAAGG + Intronic
1007051840 6:38839259-38839281 CTGTTGGTCCAGATGGTAAATGG - Intronic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1008149967 6:47938447-47938469 CTGTGGCTACAGATGCTAAAAGG + Intronic
1008620793 6:53269871-53269893 TTGTGGGCACAGAAGAAGAAAGG + Intronic
1009042478 6:58195873-58195895 CTGAGGCTGCAGAAAGAAAATGG - Intergenic
1009218318 6:60950095-60950117 CTGAGGCTGCAGAAAGAAAATGG - Intergenic
1010354260 6:74911899-74911921 GTGTGGTTACAGAAGTAGAAAGG - Intergenic
1010486452 6:76420348-76420370 CTGAGGATATAGAAGTAAAAGGG + Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011045434 6:83076662-83076684 CTGTTGGTAGAGATGTAAAATGG + Intronic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1013302505 6:108817831-108817853 CTGTGGCTCCAGCATGAAAATGG + Intergenic
1013855703 6:114569518-114569540 CTGTGGGTAGAAATGTAAAATGG - Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015623914 6:135160188-135160210 GTGTGTGTACAGGATGAAAAGGG - Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016408090 6:143752650-143752672 CTGTTTGTTCAGAAGGCAAATGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017569927 6:155732995-155733017 CTGTGGGGACTCAAGGAAACTGG - Intergenic
1018037195 6:159891822-159891844 CTATGGGTGCAGCAGTAAAAAGG + Intergenic
1018207263 6:161447097-161447119 GTGTGGGGTGAGAAGGAAAATGG - Intronic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018923958 6:168193979-168194001 CCGTGGGGACTGAAGGAAAATGG - Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1021300227 7:18963682-18963704 CTATGGATAAAGAATGAAAAAGG + Intronic
1021410012 7:20319870-20319892 GAGTGGGTAGAGAAGGAAACTGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1023896054 7:44433898-44433920 TTGTGGGAGCAGGAGGAAAAAGG - Intronic
1024140450 7:46457916-46457938 CTGAGGTTACAGAAAGAAGAGGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024896238 7:54265462-54265484 CTGAGGGTTAAGAAGGAAAAGGG + Intergenic
1026202841 7:68230535-68230557 CTGTTGGTACAAATGTAAAATGG + Intergenic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1028496337 7:91464847-91464869 CTGTGTCTAGAGAAAGAAAATGG - Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1029913815 7:104184977-104184999 CTGAGGTTACAGAAAGAAAATGG - Intronic
1032536308 7:132667564-132667586 CTATGGGTACAGGAGAAAGACGG + Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1032868322 7:135952575-135952597 ATGTTGGTACAGAAAGAGAATGG - Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033503268 7:141975289-141975311 CTGTGTGTACATAAGTCAAATGG - Intronic
1033683024 7:143614971-143614993 CTGTGGGTATATCAGTAAAAAGG + Intergenic
1033701588 7:143842667-143842689 CTGTGGGTATATCAGTAAAAAGG - Intergenic
1034410465 7:150938752-150938774 CTGTGGGAGGACAAGGAAAAAGG + Intergenic
1035759714 8:2060888-2060910 CTCTGAGTACAGCAGGAAAGTGG + Intronic
1035849246 8:2898046-2898068 TTGTGGATACAGAATGAAAGAGG + Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037591632 8:20317147-20317169 ATGTGGGTACATAAGCAACAAGG - Intergenic
1037710315 8:21350358-21350380 CTGTGAGTACAGCAGGGAACAGG + Intergenic
1037822643 8:22142327-22142349 CAGTGGGTCCAGGAGGGAAAGGG + Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038428169 8:27478824-27478846 CTGTGGTTACAGAAGAAAACAGG + Exonic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039781122 8:40786807-40786829 CTGTGCTTACAGAAGAAAATTGG + Intronic
1041083307 8:54233943-54233965 CCGAGGTTACAGAAGGAATAGGG - Intergenic
1041351481 8:56951856-56951878 TTGAGGGCTCAGAAGGAAAAAGG - Intergenic
1041740998 8:61156305-61156327 CTGAGGTTACAGAATGAATAGGG - Intronic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041911040 8:63088328-63088350 CTGAGGTTACAGAAAGAATAGGG + Intergenic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1043601185 8:81940391-81940413 CTGTGGTTAGAGAAAGAATAAGG + Intergenic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1044265778 8:90179559-90179581 CAATGGATACAGTAGGAAAATGG - Intergenic
1044324455 8:90844022-90844044 AGGTGGGTAGAAAAGGAAAATGG + Intronic
1044325288 8:90851564-90851586 TTGTGGGTATAGAAAAAAAAGGG + Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046401118 8:113704410-113704432 CTTTTGTTACAGAAGGAAAATGG + Intergenic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1047347074 8:124038920-124038942 GAGTGGGTAAAGAAGTAAAAAGG + Intronic
1047765912 8:127989764-127989786 CTGAGGGTGCAGGAGGTAAAGGG + Intergenic
1047982651 8:130198962-130198984 CTGTGGGTTGAGAAGCCAAAAGG - Intronic
1048390782 8:133962482-133962504 CAGTGGGTTCATCAGGAAAATGG - Intergenic
1048750091 8:137663033-137663055 CTGTGGGTAGATAAGGACATCGG + Intergenic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051857175 9:21581856-21581878 CTGAGGGAACAAAAGGAGAAAGG - Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055161821 9:73139077-73139099 CTGAGGGTACAGAATGGGAAGGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1058195572 9:101970891-101970913 GTGTGTGTCCAGGAGGAAAAGGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062306759 9:135911754-135911776 CTGCTGCTACAGGAGGAAAAAGG - Intergenic
1185952233 X:4450017-4450039 TTGAGGTTACAGAAGGAAAGGGG + Intergenic
1186123647 X:6389188-6389210 CTGAGGGGACAGAATGAAATGGG - Intergenic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1186243460 X:7594346-7594368 AAGTGCCTACAGAAGGAAAAAGG + Intergenic
1186763187 X:12744327-12744349 CTGAGGTTACAGAAAGAATAGGG - Intergenic
1189033926 X:37477121-37477143 CTGAGGTTACAGAAAGAATAGGG - Intronic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189996746 X:46646418-46646440 CAGTGGGTGCAGGAGAAAAATGG + Intronic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1190967442 X:55314040-55314062 CTTTGGGGACTCAAGGAAAAGGG - Intergenic
1191133603 X:57040900-57040922 CTGTGGGTGCAGAAGTAAGCAGG + Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1192959248 X:76109967-76109989 CTGTAGCTACAGAAATAAAATGG + Intergenic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1194927870 X:99848296-99848318 CTGAGGGTGGAAAAGGAAAAAGG + Intergenic
1194957399 X:100197032-100197054 GTGAGGGCTCAGAAGGAAAAGGG + Intergenic
1195357287 X:104050904-104050926 CAGCGGGTGCAGGAGGAAAAAGG + Intergenic
1195921814 X:109991151-109991173 CTGAGGCTACAGAAGTAAAAGGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196371613 X:114985467-114985489 CAGTTGGTACAGGAGAAAAAAGG - Intergenic
1197013592 X:121596928-121596950 CTGTGGGTAGAAGAGGAAAGAGG + Intergenic
1197163456 X:123349582-123349604 CTTTTTGTAAAGAAGGAAAACGG - Intronic
1197245418 X:124161754-124161776 CTGTAGGTCCAGAAGCAAATAGG + Intronic
1200828468 Y:7667126-7667148 CACTCAGTACAGAAGGAAAAAGG + Intergenic
1201316896 Y:12656271-12656293 TTGGGGGAACAGAAGGAATAAGG - Intergenic
1201403921 Y:13631579-13631601 CTATGAGTACAGAAGCCAAATGG + Intergenic
1201504981 Y:14688332-14688354 CTGTGGACAGAGAAGGCAAAGGG + Intronic
1201605343 Y:15778175-15778197 CTGAGGGGACAGAATGAAATGGG - Intergenic