ID: 953925952

View in Genome Browser
Species Human (GRCh38)
Location 3:46982463-46982485
Sequence CAACTGGGGGCCTCATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953925946_953925952 -8 Left 953925946 3:46982448-46982470 CCTGGGGGCCCGGCTCAACTGGG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925927_953925952 21 Left 953925927 3:46982419-46982441 CCCAGGTTTAGACCCACCCACCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925936_953925952 4 Left 953925936 3:46982436-46982458 CCACCCCCTCCCCCTGGGGGCCC 0: 1
1: 0
2: 13
3: 170
4: 1469
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925930_953925952 9 Left 953925930 3:46982431-46982453 CCCACCCACCCCCTCCCCCTGGG 0: 1
1: 1
2: 13
3: 152
4: 1343
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925944_953925952 -7 Left 953925944 3:46982447-46982469 CCCTGGGGGCCCGGCTCAACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925932_953925952 8 Left 953925932 3:46982432-46982454 CCACCCACCCCCTCCCCCTGGGG 0: 2
1: 1
2: 17
3: 221
4: 1517
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925926_953925952 22 Left 953925926 3:46982418-46982440 CCCCAGGTTTAGACCCACCCACC 0: 1
1: 0
2: 1
3: 11
4: 128
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925939_953925952 0 Left 953925939 3:46982440-46982462 CCCCTCCCCCTGGGGGCCCGGCT 0: 1
1: 0
2: 3
3: 31
4: 401
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925940_953925952 -1 Left 953925940 3:46982441-46982463 CCCTCCCCCTGGGGGCCCGGCTC 0: 1
1: 0
2: 1
3: 28
4: 344
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925928_953925952 20 Left 953925928 3:46982420-46982442 CCAGGTTTAGACCCACCCACCCC 0: 1
1: 0
2: 1
3: 12
4: 143
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925943_953925952 -6 Left 953925943 3:46982446-46982468 CCCCTGGGGGCCCGGCTCAACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925942_953925952 -5 Left 953925942 3:46982445-46982467 CCCCCTGGGGGCCCGGCTCAACT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925941_953925952 -2 Left 953925941 3:46982442-46982464 CCTCCCCCTGGGGGCCCGGCTCA 0: 1
1: 0
2: 1
3: 24
4: 294
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925938_953925952 1 Left 953925938 3:46982439-46982461 CCCCCTCCCCCTGGGGGCCCGGC 0: 1
1: 0
2: 5
3: 64
4: 560
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
953925935_953925952 5 Left 953925935 3:46982435-46982457 CCCACCCCCTCCCCCTGGGGGCC 0: 1
1: 1
2: 10
3: 89
4: 794
Right 953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953925952 Original CRISPR CAACTGGGGGCCTCATAGTG AGG Intronic
904033583 1:27547734-27547756 CAGCTGGGGGAATCGTAGTGGGG + Exonic
904597584 1:31656530-31656552 CACCTGGGGGCCTCAGGCTGTGG - Intronic
910165855 1:84326568-84326590 CAAGTGGGGGCAACACAGTGTGG + Intronic
915506240 1:156358148-156358170 GAACTGGGGACCTGATTGTGTGG + Intronic
916980994 1:170136783-170136805 CAACTGGAGACCTCAAACTGAGG - Intergenic
1071753684 10:88511144-88511166 CAACGGTTGGCCTGATAGTGAGG - Intronic
1077519002 11:3020145-3020167 CTGCTGGGGGCCTGAGAGTGTGG + Intronic
1089486669 11:118851786-118851808 CAACAGGGGTCCCCAAAGTGTGG - Intergenic
1090867163 11:130711317-130711339 CAGCTGGGGGCCTCAGGGGGCGG - Intronic
1099490218 12:83279956-83279978 TAACTGGGGGCCTTAAAGTGAGG - Intergenic
1107974200 13:45674037-45674059 CAACTGGGTGTCCCATGGTGGGG + Intergenic
1116015054 14:39395976-39395998 CACCTGGGGGCCTCACACTTGGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120715432 14:87836214-87836236 AAACTGGGGTCTTCATACTGGGG + Intergenic
1124355382 15:28991483-28991505 CAAGGGGCGGCCTCACAGTGGGG - Intronic
1126704572 15:51395513-51395535 TTACTGGGGGCTTCATAGAGAGG + Intronic
1128736986 15:70058932-70058954 AGACTGGGGGCCCCACAGTGAGG + Intronic
1130336438 15:82960855-82960877 AATCTGGGGTCCTCATAGTGAGG + Intronic
1132222937 15:100118449-100118471 CTACTGGTGGCCCCATAGTGGGG + Intronic
1142207841 16:88792406-88792428 CACGTGGGAGCCTCAGAGTGAGG - Intergenic
1145018178 17:19412274-19412296 GACCTGGGGGCCTCAGAGTGGGG - Intronic
1151765738 17:76132418-76132440 CACCTGGGAGCCACAGAGTGGGG + Intergenic
1153624955 18:7014723-7014745 AAACTGGAGGCCTCATGGTTTGG + Intronic
1154166178 18:12016010-12016032 CTACTGGGGGCCACATAAAGGGG - Intronic
1160442511 18:78903220-78903242 AACCTGGGGGCCTCAAGGTGGGG + Intergenic
1161300239 19:3538991-3539013 CAACTGGGGGTGACACAGTGTGG - Intronic
1165437840 19:35806433-35806455 TGACTGGTGGCCTCATAGTCAGG + Exonic
1167354261 19:48993542-48993564 GAGCTGGAGGCCTCAAAGTGGGG + Exonic
1167612118 19:50512655-50512677 CAGCTGGGGGCCTCCGGGTGAGG - Exonic
1168414135 19:56158331-56158353 CACCTGGGGGCCTCTCTGTGGGG + Intronic
930555156 2:52886052-52886074 CCACTGGGTGCCACAGAGTGTGG - Intergenic
931977575 2:67659857-67659879 CTACTGGAGTCCTCAAAGTGGGG - Intergenic
936239629 2:110776486-110776508 CAGGTGGGGGCCTCATGATGAGG + Intronic
939362000 2:141184509-141184531 CAACTGGGGGAAACTTAGTGAGG - Intronic
946707340 2:222471325-222471347 AAACTGGGAACCTCTTAGTGAGG + Intronic
1170355579 20:15488582-15488604 CCACTGGGGGGCTCCTAGCGTGG + Intronic
1174723120 20:52834770-52834792 CAACGGGAGGCCTGACAGTGCGG - Intergenic
1179309885 21:40185962-40185984 CAACTGGGGGCCTAGAAGTGAGG - Intronic
1180590388 22:16932217-16932239 CTAATGTGGACCTCATAGTGTGG + Intergenic
1183063545 22:35349311-35349333 TAACTGGGGACCTCTTAGAGGGG + Intergenic
1185176205 22:49328365-49328387 CAGTTGGGGGCATCAGAGTGGGG + Intergenic
949695461 3:6689006-6689028 CACATGGGGGTCTCCTAGTGTGG - Intergenic
951509250 3:23483696-23483718 TCACTGAGGGCCTCAAAGTGTGG - Intronic
952067816 3:29593218-29593240 CAACTATTGGCCTCATAATGTGG + Intronic
952966679 3:38625409-38625431 CAGCATGGGGCCTCAGAGTGGGG - Intronic
953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG + Intronic
954131990 3:48565558-48565580 CAACTGGGGTCCTCTCAGGGGGG - Intronic
959600031 3:108171386-108171408 CAACTGGCTACCTGATAGTGAGG + Intronic
965256673 3:166423251-166423273 TAACTGGGAGCCTCATCATGTGG + Intergenic
971589557 4:28450097-28450119 CAAATGGTGGCATCCTAGTGGGG + Intergenic
975942774 4:79668104-79668126 CAACTGGGAGGCTCATGGTCTGG + Intergenic
981933822 4:150218098-150218120 GAACAGGGGGCCTCGTTGTGGGG - Intronic
982418267 4:155162953-155162975 TACCTGGGGGCCTCTCAGTGAGG - Intergenic
986772739 5:10988479-10988501 CAACTGGGGACCACATCCTGGGG + Intronic
988520950 5:31945232-31945254 CAACTGGTGGCTTCACAGGGTGG + Intronic
990380282 5:55216230-55216252 CAACAGTGGGTCTCAAAGTGTGG + Intergenic
991303873 5:65155814-65155836 CAACTTGGAGCATCATAGTCAGG + Intronic
993685584 5:90933674-90933696 CAAGTAGAGGCCTAATAGTGAGG - Intronic
998694996 5:144629240-144629262 CTACTGGGGGCCTCCCAGTTAGG + Intergenic
999182023 5:149676432-149676454 GAACTTGGGACCTCACAGTGGGG + Intergenic
1002922157 6:1580533-1580555 GAACTGGGGGCCACAAAGGGAGG + Intergenic
1008018823 6:46552719-46552741 CAACAGAGGTCCTCAAAGTGTGG + Intronic
1016465949 6:144325645-144325667 CAACTGGTGGGCTCAAAGTAAGG - Intronic
1016864390 6:148750788-148750810 TAAATGGAGGCCACATAGTGGGG - Intronic
1026914617 7:74112362-74112384 CATCTGGGGGCCACAGAGTGGGG + Intronic
1037908987 8:22732391-22732413 CAACTGGAGGGCCCATGGTGGGG + Intronic
1040342169 8:46446582-46446604 AATCTGGGAGCCTCCTAGTGAGG - Intergenic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1051467742 9:17399864-17399886 AAACTGGGGGACACTTAGTGTGG - Intronic
1051609641 9:18948660-18948682 CATCTGGGGGCCTCAGAGCTAGG + Intronic
1056541714 9:87577168-87577190 CAACTGTGGTTCTCAAAGTGTGG + Intronic
1057546985 9:96026296-96026318 CAACAGGGGGCCCCAGAGGGCGG - Intergenic
1059359804 9:113733370-113733392 TAACTTGAGGGCTCATAGTGTGG + Intergenic
1060918889 9:127406731-127406753 CCACCGGGGGCCTCAGGGTGGGG + Intronic
1062189493 9:135240531-135240553 CAACGTGGGGCCCCAGAGTGGGG + Intergenic
1194552547 X:95319749-95319771 CAACTGGGGGGCTCTTAGGCAGG + Intergenic
1197182779 X:123553977-123553999 CAACTGAGGTCCTCACAGAGTGG - Intergenic
1197718270 X:129726186-129726208 CAACTGGGGACCCCAGAGGGTGG - Intergenic
1199657656 X:150012931-150012953 AAACTGTGGGCTTCATACTGTGG - Intergenic