ID: 953930952

View in Genome Browser
Species Human (GRCh38)
Location 3:47005409-47005431
Sequence TGCTGTGGCTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 783}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953930952_953930962 15 Left 953930952 3:47005409-47005431 CCTTCTTCCCTCCAGCCACAGCA 0: 1
1: 0
2: 6
3: 95
4: 783
Right 953930962 3:47005447-47005469 CCATTCTCCCCACCTCACCTTGG 0: 1
1: 0
2: 3
3: 36
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953930952 Original CRISPR TGCTGTGGCTGGAGGGAAGA AGG (reversed) Intronic
900182599 1:1318912-1318934 GGCAGGGGCTGGAGGGGAGATGG - Intronic
900333585 1:2149533-2149555 TCCTGTGTCTGGAGGGAGGCCGG + Intronic
900514326 1:3074023-3074045 GGCTGTAGGGGGAGGGAAGACGG + Intronic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
901758458 1:11455560-11455582 TGCTGTGGATCCAGGGAAGACGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902082404 1:13829935-13829957 TACTGTGGCTGCAATGAAGAGGG - Intergenic
902092804 1:13916798-13916820 TCCTGTGGCTGGAGGCAATGTGG + Intergenic
902228032 1:15009075-15009097 AGCTAAGGCTGGAGGGAAGGGGG - Intronic
902950684 1:19880705-19880727 TGCTGAGGCTGTGGGGAAAAGGG + Intergenic
902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG + Intronic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
903573783 1:24325200-24325222 TTCTCTGGCTGAAGGGAAGTGGG + Intronic
903740882 1:25557684-25557706 TGCTGTGACTGGAGTGTGGAGGG + Intronic
903925766 1:26829393-26829415 TGACATGCCTGGAGGGAAGACGG - Intronic
903945298 1:26959256-26959278 TTCAATGGCTGGAGGGAAGTGGG - Intronic
903988152 1:27244440-27244462 GGCTGAGGCAGGAGGGAGGAGGG - Intronic
904200548 1:28816601-28816623 GCCTGTGGCTGGAGGGAATGAGG + Intronic
904286554 1:29456380-29456402 TGATGTGGGTGGTGGGAAAAGGG + Intergenic
904391545 1:30189333-30189355 TGCTATGGCTGGAAAGCAGAAGG - Intergenic
904997214 1:34640441-34640463 TGGTGTGGCAGGAAGGATGATGG - Intergenic
905005893 1:34710157-34710179 TGCTGTGGCTGTATGGACAAAGG - Intergenic
905347713 1:37322489-37322511 TGCTCTGGGTGGAAGGAAGCAGG + Intergenic
905751422 1:40467968-40467990 TGCTGGGGTTGGACGGAAGATGG - Intergenic
906158076 1:43625834-43625856 TGTGGTGGCTGGAGGGCAGGGGG - Intergenic
906588860 1:47004733-47004755 TGCCCTGGCTGGAAGGAGGAAGG + Intergenic
907342679 1:53748036-53748058 TGCTCTGGCTGTAGGGAGAATGG - Intergenic
907514089 1:54982228-54982250 TCCTCTGGCTGGAGGGAGGTGGG + Intronic
907670734 1:56472894-56472916 TGCTGTGGTTGAAGCGAGGATGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907748090 1:57234889-57234911 TGCTGTTGCTGGTTTGAAGATGG - Intronic
908056013 1:60287989-60288011 TGCTGTGGTTGGAAGGTAGAGGG + Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908174638 1:61542557-61542579 TGCTGTGGATGCAGTGAACAGGG - Intergenic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
908494351 1:64679641-64679663 TCCTGTGGCTGGAGGGATCATGG + Exonic
908518299 1:64915906-64915928 TTCTGGAGCTGCAGGGAAGAGGG - Intronic
908876010 1:68676663-68676685 GGCTGAGGCAGGAGGGAGGATGG - Intergenic
908992284 1:70106713-70106735 TGCTATGGCTGGAGTGCTGATGG - Intronic
910088342 1:83431286-83431308 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
910369906 1:86504270-86504292 CGCAGAGGCTGGAGGGAAGAAGG - Intergenic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
912382803 1:109256389-109256411 TGATGAGGCTGGAGGGTAGGTGG + Intronic
912680407 1:111725560-111725582 TGCTGTGTCTAGTGGGGAGAAGG + Exonic
913563478 1:120047124-120047146 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
913577100 1:120186947-120186969 TGATGTGGCTGCAGGGAATAGGG + Intergenic
913611368 1:120512686-120512708 TGCTGAGCCTGGTGGGGAGAAGG + Intergenic
913634645 1:120746453-120746475 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
913983423 1:143544136-143544158 TGCTGAGCCTGGTGGGGAGAAGG - Intergenic
914284072 1:146206488-146206510 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914300884 1:146376439-146376461 TGCCGGGGCGGGAGGGAAAAAGG + Intergenic
914517825 1:148388979-148389001 TGCCGGGGCGGGAGGGAAAAAGG - Intergenic
914545103 1:148657227-148657249 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914559012 1:148798383-148798405 TGATGTGGCTGCAGGGAATAGGG + Intergenic
914579824 1:149009553-149009575 TGCTGAGCCTGGTGGGGAGAAGG - Exonic
914613821 1:149331847-149331869 TGATGTGGCTGCAGGGAATAGGG - Intergenic
914621463 1:149413461-149413483 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
915049032 1:153048820-153048842 TCCTGTGGCCGTAGGTAAGATGG + Intergenic
915091007 1:153426193-153426215 TGCTGAGGCTGGAGTGCAGCAGG - Intergenic
915141442 1:153770980-153771002 TGCTGTGGCAGCAGGAAACAGGG - Intronic
915205000 1:154263556-154263578 TGCTGTGGATGAAGGGTGGAGGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916481621 1:165219435-165219457 TGTTGTGAGTGGAGGGAGGAGGG + Intronic
916563035 1:165949546-165949568 TCCTGTGGCTGGGGAGAGGATGG + Intergenic
916660964 1:166921826-166921848 TACTGGGGCAGGAGGGGAGAAGG + Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
916833342 1:168515273-168515295 TGGTGTGGCTGGAGTTGAGAAGG - Intergenic
917968305 1:180192235-180192257 TGCTGTGGCCGGAGGGAGGGAGG + Intronic
918103929 1:181400438-181400460 GGCCGTGGCTGCAGGGAAGAGGG + Intergenic
918117237 1:181507981-181508003 AGCTGGGGCAGGAGGGATGATGG - Intronic
919815521 1:201436075-201436097 TCATGTGGGTGGAGGGAGGAGGG - Intergenic
919819504 1:201464178-201464200 GGGCGTGGCTGGAGAGAAGAGGG - Intergenic
920303942 1:205006899-205006921 GGAGGTGGCTGGAGGGATGATGG + Intronic
920311275 1:205049867-205049889 TGCTCTGGCTGGAGTGGAGAAGG + Intronic
920339458 1:205266915-205266937 TGCTGTCACTGCAGGGAACAAGG + Intronic
920420883 1:205832561-205832583 AGCTGTGGCTGGAGGGAGGAGGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920703295 1:208233856-208233878 TGCTGTGGATGGAGGAAAGCTGG + Intronic
920748218 1:208649044-208649066 TCCTCTGACTGGAGAGAAGATGG - Intergenic
920914956 1:210251962-210251984 TCCTGGGGCGGAAGGGAAGAGGG - Intergenic
922773961 1:228206690-228206712 GGCTGTGGCAGGAGGGAGGGTGG - Intronic
922850315 1:228727726-228727748 TGCAGTTTCTGGAGGGAAGTAGG + Intergenic
923345391 1:233046640-233046662 TACTGTGGCTGGCAGGAAGAAGG + Intronic
923676998 1:236088703-236088725 GGCCGTGGCTGGAGGGGAGTGGG + Intergenic
924436106 1:244044507-244044529 TGCTGAGGCTTAAGGGCAGAGGG - Intergenic
1063123635 10:3122338-3122360 TGCTGTGGCTGCTGGGGAGCTGG + Intronic
1063458535 10:6201707-6201729 GGCTGTGATTGGAGGGAAGGCGG - Intronic
1064056709 10:12104007-12104029 TCCAGGGGCTGGAGGGAGGAAGG - Intronic
1064068399 10:12203560-12203582 TGCTGTGGGTGTAGGAAAGGAGG + Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064274637 10:13894434-13894456 TTCTGTAGCTGGAGGGTAGGGGG - Intronic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064640664 10:17412254-17412276 TGCAGTGGCTGGAGGTTGGAGGG - Intronic
1065495965 10:26328327-26328349 GGCTGTGGAGGGAGGGAACAGGG - Intergenic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1066260478 10:33724955-33724977 TTCTGAGGCAGGAGGGAGGAGGG - Intergenic
1067159616 10:43813254-43813276 TGATGTGGGTGCAGGGAGGAAGG + Intergenic
1067160486 10:43821213-43821235 TGCTGTGGAGGGAGGGGACAGGG - Intergenic
1067263307 10:44713757-44713779 TGCTGGGGCAGGAAGGAAGCAGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067564563 10:47327247-47327269 TGCTCTGGCTGGAGGTCAGAGGG - Intergenic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068600251 10:58949192-58949214 CGCAGTGGCAGGAGGCAAGATGG + Intergenic
1068620453 10:59176444-59176466 GGCAGTGGCTGGAGGGCAGGTGG + Intergenic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1069256410 10:66336361-66336383 TGCTGGGGGTGGAGCTAAGATGG - Intronic
1069296831 10:66856540-66856562 TGGTGAGGCTGTAGGGAAAAGGG - Intronic
1069436788 10:68391611-68391633 TGCCCAGGCTGGAGGGTAGAGGG - Intronic
1069494615 10:68891858-68891880 TGCTGAGGCTGGAGTGTAGTGGG + Intronic
1069706109 10:70459874-70459896 TGCGGCAGCTGGAGGGGAGAGGG - Intergenic
1069734746 10:70646583-70646605 TGCTGAGGTTGGAGAGAAGATGG + Intergenic
1069859976 10:71464498-71464520 TGCTCTGGCTCCAAGGAAGAGGG + Intronic
1070311076 10:75274384-75274406 TGCTGGGGCTGGGGGGAAGGAGG - Intergenic
1070487522 10:76944725-76944747 TGCTGTGCCTGCAGGGGACAGGG - Intronic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1070828669 10:79405657-79405679 TTCCCTGGCTGGAGGGAAGGTGG + Intronic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1071457147 10:85859746-85859768 TGCTGAGGTTGGAGAGAAGATGG - Intronic
1071508240 10:86245779-86245801 AGCTGTGGCTGGTGGGAAGCGGG - Intronic
1071562397 10:86654679-86654701 TGCTGAGGATGGAGGAAAGTTGG + Exonic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071949340 10:90684809-90684831 TGGGGTGGCATGAGGGAAGAGGG + Intergenic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072895706 10:99364866-99364888 TGCTGGGGGTGGATAGAAGAGGG + Intronic
1073032373 10:100536861-100536883 TTCTGTAGCTTGAGGGATGAGGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073748251 10:106494515-106494537 TGGTCTGGCTGGAGGCAATAAGG - Intergenic
1074001057 10:109373243-109373265 TGTTGTGGGGTGAGGGAAGAGGG + Intergenic
1074303075 10:112250462-112250484 TGGGGTGGCGGGAGGGGAGAGGG + Intergenic
1074575983 10:114669801-114669823 TGTTGTGGCGGGAGGGAAGGGGG + Intronic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075520330 10:123139859-123139881 GGCTCTGGTTGGAGGGAAGAAGG + Intergenic
1075702517 10:124478455-124478477 TCCTGAGGCTGGAGGGAGAATGG - Intronic
1075979523 10:126724722-126724744 TGCAGTGGCCGGAGGGTAGATGG - Intergenic
1075979537 10:126724772-126724794 TGCAGTGACTGGAGGGTAGATGG - Intergenic
1076103090 10:127798012-127798034 GGCTGTGGCTGTTGGGAAGCTGG + Intergenic
1076283786 10:129274205-129274227 TGCTGGAGCTGCAGGGAAAAGGG + Intergenic
1076311992 10:129515089-129515111 TGCAGTGGCTGGGGGCAGGAAGG + Intronic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1076750909 10:132542524-132542546 CGCAGTGGCTGGAGGAAACATGG - Intronic
1077077249 11:707267-707289 AGCTATGGCTTGAGGGAGGAAGG - Intronic
1077284532 11:1759791-1759813 TGCTCAGCCTGCAGGGAAGATGG + Intronic
1077503370 11:2919231-2919253 TGCTGAGGCGGGAGGGAGGTGGG + Intronic
1077627978 11:3790317-3790339 TGCTCTGGCTGAAGTGAAGAGGG + Intronic
1077838317 11:5944928-5944950 TGCTGTCAGTGGAGGGAGGACGG - Intergenic
1078252140 11:9624853-9624875 TGCTGTTGCTGGTTGAAAGATGG + Intergenic
1078860117 11:15239091-15239113 GGCTGTGGCTGGAGTGGAGTGGG + Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079661628 11:23044196-23044218 TGCTCTGGCTGGAGTGTAGTAGG - Intergenic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1079929794 11:26543599-26543621 TGGTGTGGCGGGAGGGAGGAGGG - Intronic
1080198756 11:29643774-29643796 TGGTGTGGATGTAGGGAAAAGGG + Intergenic
1080432478 11:32211577-32211599 TTCTGTTGCTGGGGGAAAGAGGG - Intergenic
1080460822 11:32453370-32453392 TGCTGTGGGTCGATGGAAGCAGG - Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080756825 11:35208554-35208576 TGCACTGGCTGGAGGAAAGATGG - Intronic
1080943156 11:36941877-36941899 AGCTGTGGCTAGAGGGAGCAAGG + Intergenic
1081139104 11:39475734-39475756 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081524810 11:43920100-43920122 TGATGTGGCTGTTGGGAAGATGG + Exonic
1081549183 11:44096210-44096232 CCCTGTGGCTGGCGGGAAGGTGG - Exonic
1082148343 11:48699974-48699996 TGCGGTGGGGGGAGGGGAGAGGG - Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083487423 11:62992340-62992362 TGCTGTGGCTGGAGGGAACCGGG + Intronic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1083747271 11:64743299-64743321 GGCTGTGGAGGGAGGGAAGCGGG - Intronic
1083776000 11:64894638-64894660 TTCTGTGTCTGGGGGGAGGAGGG - Exonic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083911390 11:65712249-65712271 GGCAGTGGAGGGAGGGAAGATGG + Exonic
1083923083 11:65790875-65790897 TCCTTTGGCTGCAGGGAGGATGG + Intronic
1084565540 11:69926421-69926443 TCCTCTGGCTGGTGGGAAGATGG + Intergenic
1084594376 11:70108265-70108287 TGCTGTGGCTGGAGAGGACCTGG - Intronic
1084616150 11:70237282-70237304 TTCCTTGACTGGAGGGAAGAAGG + Intergenic
1084873970 11:72117136-72117158 GGCTGTGGTTGGAAGGAATAAGG + Intronic
1085201915 11:74707018-74707040 TGCTCAGGCTGGAGGGGCGAAGG - Intronic
1085261258 11:75205925-75205947 TGCTGGGGGTGGGGGGAAGCTGG + Exonic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086406285 11:86501865-86501887 TGCAGTGGCTCAAGTGAAGATGG - Intronic
1086862643 11:91943429-91943451 TGCTGTGGGATGACGGAAGATGG - Intergenic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087005882 11:93470981-93471003 TGCAGGGGCTGGATGGAAGGGGG - Intergenic
1087844744 11:102960460-102960482 TGCTGTGCCTGGTGGAGAGAAGG + Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089197544 11:116703491-116703513 GGCTGTGGGGGAAGGGAAGAGGG - Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1089383481 11:118052656-118052678 GGATGTGGCTGGAAGGAAGGGGG - Intergenic
1089467821 11:118696957-118696979 GCCTGTGGCTGGAGGGAGGGTGG + Intergenic
1089710287 11:120309649-120309671 GGTGGTGGCTGCAGGGAAGAGGG + Intronic
1090336910 11:125975041-125975063 TGCTCAGGCTGGATGAAAGATGG - Intronic
1090780220 11:130001665-130001687 TCGCGTGGCTGGAGGGCAGACGG + Intronic
1091273954 11:134337539-134337561 TGCTGAGGGTGGAGAGAACATGG + Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1091555455 12:1570031-1570053 TGCTGTTGTTGCATGGAAGAGGG + Intronic
1091918246 12:4284432-4284454 TGCTTTGGTTGGAGGGGAGCTGG + Intronic
1092166387 12:6345278-6345300 TTCTGTCCCTGGAGGGATGATGG - Intergenic
1092706425 12:11290227-11290249 TGGTGAGGCTGGAGCCAAGACGG + Intergenic
1093305766 12:17515557-17515579 TGCTGTGGCTGGAGTTAAGGTGG - Intergenic
1093384547 12:18535953-18535975 TGCTGTGGGGTGGGGGAAGAGGG + Intronic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1094125824 12:27021631-27021653 TCCTGTGGCTGCGGGGAAGGTGG - Intergenic
1095551727 12:43449479-43449501 TGCTGAGGGTGGAGGGTAGGAGG + Intronic
1096394723 12:51257110-51257132 GGCTGTGACTGGAGGGGAAAGGG + Intronic
1096500299 12:52060580-52060602 AGCTGTGGATGGGGGGAAGCAGG + Intergenic
1096580242 12:52580423-52580445 TGAAGTGGCTGGAGGGGAGGTGG - Intergenic
1096596775 12:52700953-52700975 TGGCCTGGCTGGAAGGAAGAAGG - Intronic
1096612660 12:52813408-52813430 TCCCGTGGCTGGTGGGAAGGTGG - Intronic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1096870299 12:54588515-54588537 CGCTGCGGCGGGAGGGAAGGCGG + Exonic
1096884209 12:54700230-54700252 AGCAGTGGATGGAGGGAATAGGG - Intergenic
1097155649 12:57010370-57010392 TGCTGTGGCAGCAGGAGAGAAGG + Intronic
1097336302 12:58387511-58387533 TGCTATGCCTGGCGGAAAGAAGG - Intergenic
1098095527 12:66951391-66951413 TTCTGTGGCAGGAGGCAACAGGG + Intergenic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1099886446 12:88537012-88537034 TGGTGTGGCTGCAGAGAAAAGGG + Intronic
1099944147 12:89224875-89224897 TGTAGTGGCGTGAGGGAAGATGG - Intergenic
1100223971 12:92537898-92537920 TGCTGTGCATGAAGGGAAGCTGG - Intergenic
1100721419 12:97362802-97362824 TGCTGTTGCTGGCTTGAAGATGG - Intergenic
1100790488 12:98124915-98124937 TGCTGTGGCTAGCTTGAAGATGG + Intergenic
1101315526 12:103625505-103625527 TGTTGTGGGTGGGGGGAAGGAGG - Intronic
1101613031 12:106309464-106309486 TTCTGTGGCAGGATTGAAGACGG + Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1102037936 12:109782849-109782871 TGGTGTGGCTGTGGGGAAGGTGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1103619391 12:122177265-122177287 TGCTGTTGCTGGCTTGAAGATGG + Intronic
1103789069 12:123456503-123456525 TGCTGTGGGTGTTAGGAAGATGG - Intergenic
1104310930 12:127653779-127653801 AGCTGTGGCTCCAGGGACGAGGG + Intergenic
1104484410 12:129137719-129137741 ATCTGTGGCTGGAGGCATGATGG + Intronic
1104872168 12:132007714-132007736 TGCTATTGCTGCAGAGAAGAGGG + Intronic
1105472459 13:20705106-20705128 TGCTCCAGCTAGAGGGAAGACGG - Intronic
1105673950 13:22650272-22650294 TGGTGTGGCTGTAGGGAGGGTGG + Intergenic
1105820796 13:24079108-24079130 GGCAGTGGCAGAAGGGAAGAGGG + Intronic
1106359693 13:29019216-29019238 TGCAGGGACTGGTGGGAAGAGGG + Intronic
1106477484 13:30110948-30110970 TCCTGTGGGTGGAGAGAGGATGG - Intergenic
1106592441 13:31109488-31109510 TGCTGTGCATGGAAGGGAGAGGG - Intergenic
1106666315 13:31854491-31854513 TGGTGAGGCTGGTGGGTAGAGGG + Intergenic
1106894555 13:34285124-34285146 TGCTGTGGATGCAGTGAAAAGGG + Intergenic
1106942001 13:34790042-34790064 TGGTCTGGCTGGAGGCAACAAGG + Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107447588 13:40482379-40482401 TGCTGAGGCTGGTGGAAAGCCGG - Intergenic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1108594869 13:51940759-51940781 TGCTCTGTCTGCAGGGATGAAGG + Intronic
1109044705 13:57394589-57394611 TGCTGTTGCTGCTGGTAAGAGGG - Intergenic
1109400593 13:61822866-61822888 AACTGTGGCTCAAGGGAAGATGG + Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110086263 13:71384706-71384728 TGCTGTGGGTGGGGGGAGGGGGG - Intergenic
1110397206 13:75044826-75044848 TGGTGAGGCTGCAGGGAAAAGGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110942796 13:81370920-81370942 TCCTGTGGCTATAGGAAAGAAGG + Intergenic
1110974798 13:81817576-81817598 TGGTGAGGCTGGAGAGAAAAGGG + Intergenic
1111900768 13:94197111-94197133 TGCTAGGACTGTAGGGAAGATGG + Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112344413 13:98577446-98577468 TGGGCTGGCTGGCGGGAAGAGGG - Intronic
1113151542 13:107269283-107269305 TGATGTGGCTGGAGGAAAATGGG + Intronic
1113372281 13:109734299-109734321 TGCTGCGGCCGCTGGGAAGAGGG + Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113627281 13:111856588-111856610 AGCTGTGGCTGCAGGAAAGGTGG + Intergenic
1113683020 13:112257415-112257437 TGGTGAGGCTGGGGGCAAGAGGG - Intergenic
1113716034 13:112508496-112508518 TGCCGTGGCTAGGAGGAAGATGG - Intronic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1115141643 14:30178185-30178207 TGCTGGGGCCAGAGGCAAGAGGG - Intronic
1116734853 14:48676300-48676322 TGCTGAGGCTGTGGAGAAGAGGG + Intergenic
1117568596 14:57022566-57022588 TCCTGTGGCAGGAGAGAAGAAGG - Intergenic
1119193394 14:72699932-72699954 AGCTGTGGGAGGAGGAAAGAGGG + Intronic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1119790973 14:77349465-77349487 TGTTGTGGCTGGAGGGACCAGGG - Intronic
1120445042 14:84584787-84584809 TGGTGAGGCTGCAGGGAAAATGG + Intergenic
1120445233 14:84587125-84587147 TGCTGAGGTTTGAGGGAAGTGGG + Intergenic
1121704207 14:95979081-95979103 AGCTCTGGCTGGAGGGGAGCTGG - Intergenic
1122053437 14:99075687-99075709 TGGATTGGTTGGAGGGAAGAAGG - Intergenic
1122074528 14:99227592-99227614 TGCTGTGGGTGGAGTGAGCATGG - Intronic
1122325050 14:100876820-100876842 TGCTGTGGCTGGATGGGGCAGGG + Intergenic
1122580577 14:102769155-102769177 GGCTCTGACTGGAAGGAAGAGGG + Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122824529 14:104363175-104363197 AGCAGAGGCTGGTGGGAAGAAGG - Intergenic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124892235 15:33744020-33744042 GGAGGTGGCTGGAGGGCAGAGGG - Intronic
1125519647 15:40340694-40340716 AGCTGGGGCTGGGAGGAAGAAGG - Intronic
1125756757 15:42070088-42070110 TGCAGTGCCTGGTGGGGAGAAGG + Exonic
1125832912 15:42729119-42729141 AGCTGTGCCTGGGGGGAGGAGGG + Exonic
1126297435 15:47156180-47156202 TGAGGTGGGTGCAGGGAAGATGG - Intergenic
1126417906 15:48437809-48437831 TGCTGTGCCTTGAAGGGAGAAGG - Exonic
1126657334 15:50993168-50993190 TCCTTTGACTGGAGGGTAGAGGG + Intronic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1127292827 15:57585538-57585560 TGCTGTGGTTTGAAGGAAAAGGG - Intergenic
1128012914 15:64315649-64315671 TGGTGTGGCAGAAGGGAGGAGGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128691435 15:69727322-69727344 TGCTGTGTCTCCAGGGAAGTGGG - Intergenic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129194355 15:73955323-73955345 TGCTGGGTCAGGAGTGAAGATGG - Intergenic
1129220915 15:74131192-74131214 TGTTGTGGCTGTGGGGAAAACGG - Exonic
1129448343 15:75634539-75634561 TGCAGGGGCTTCAGGGAAGAGGG - Intergenic
1129589015 15:76898724-76898746 GGCTGTAGCTGGAGATAAGATGG + Intronic
1129692315 15:77720901-77720923 AGCCGTGGGTGGAGGGATGAGGG - Intronic
1130142089 15:81236168-81236190 TGCTGTGGTTGGAGAAAAGGTGG + Intronic
1130228177 15:82075933-82075955 TCCTGTGGCTGGGGAGAAGCAGG - Intergenic
1130232907 15:82110073-82110095 TGGTGTGGCTGCAGTGAAGGGGG - Intergenic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130903261 15:88223080-88223102 AGCTCTGGCTGGAGGGAGCAGGG - Intronic
1131040464 15:89260830-89260852 TACTGATGCTGGAGGTAAGATGG + Exonic
1131413598 15:92232192-92232214 GTCTGTGGCTGGAGGGAGGAGGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132826815 16:1909310-1909332 TGATGTGGGTGGAGGGGAAAGGG - Intergenic
1133026011 16:2989288-2989310 TGCTGTCACAGGAGGGTAGAGGG - Intergenic
1133479970 16:6160721-6160743 TGCAGTTGCAGGAGGCAAGATGG - Intronic
1134042528 16:11079433-11079455 TCCAAAGGCTGGAGGGAAGATGG - Intronic
1134529363 16:14970942-14970964 TGGTTTGGGTGGAGGGAACAAGG + Intergenic
1134884120 16:17774720-17774742 TGCCAAGGCTGGAGTGAAGAGGG - Intergenic
1135089766 16:19504005-19504027 TGCTCTGGCAGGAAGGAACATGG - Intronic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135586960 16:23678941-23678963 TGCAGTGACTGCAGGGAAGCTGG + Exonic
1135821524 16:25690899-25690921 AGCTGTGGCTGGGGGGCAAATGG + Intergenic
1136683056 16:31978996-31979018 TGCAGGGGCTTGAAGGAAGAAGG + Intergenic
1136783695 16:32922552-32922574 TGCAGGGGCTTGAAGGAAGAAGG + Intergenic
1136886093 16:33931254-33931276 TGCAGGGGCTTGAAGGAAGAAGG - Intergenic
1137303148 16:47173221-47173243 TACTGTGGGTGGGAGGAAGAGGG - Intronic
1137765825 16:50976914-50976936 TGCTATGGCTGGTGGGAAGTGGG + Intergenic
1138090454 16:54169600-54169622 GGCTGGGGCAGGAGGGGAGAGGG - Intergenic
1138433451 16:56983861-56983883 TTCTGTGGCTGGCGGGTAGAGGG + Intergenic
1138698282 16:58836038-58836060 TGGTGAGGCTGTAGAGAAGAGGG - Intergenic
1139023298 16:62780212-62780234 GGCAGTGGCTGTAGGGAGGAGGG + Intergenic
1139490449 16:67283224-67283246 TCCTGTGGCAGGATGGAGGACGG + Intronic
1140206314 16:72936638-72936660 TGCTGTGGCTGCAGTGTAGGGGG + Intronic
1140266513 16:73426017-73426039 TGGGTTGGCTGGAAGGAAGAAGG - Intergenic
1140474107 16:75230022-75230044 AGCTGGGGCAGGAGGGAAGCAGG + Exonic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1142158526 16:88545088-88545110 TGCAGTGGCTGGAGGGAGCTGGG + Intergenic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142218308 16:88840716-88840738 GGCTGTGACTCGAGGGATGACGG + Intronic
1203029528 16_KI270728v1_random:562951-562973 TGGGGTGGCGGGAGGGAGGAGGG + Intergenic
1203042193 16_KI270728v1_random:771480-771502 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1203086346 16_KI270728v1_random:1186553-1186575 TGCAGGGGCTTGAAGGAAGAAGG + Intergenic
1142683585 17:1563880-1563902 TGCAAAGGCTGGAGGCAAGAGGG + Intergenic
1142858315 17:2745791-2745813 TGCTGTGTCGGGGGGAAAGATGG - Intergenic
1143155751 17:4834883-4834905 GGATATGGCTGGAGGGGAGAGGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143868401 17:9940592-9940614 TTCTGGGGCTGGAAGGGAGAGGG - Intronic
1144124180 17:12185937-12185959 TGCTGTAGCTGGATGGAGGAGGG + Intergenic
1144292656 17:13841514-13841536 TCCTGTGGCAGGAGGTAGGATGG - Intergenic
1144385889 17:14748847-14748869 AGCTGTGGCTGCAGAAAAGACGG - Intergenic
1144466083 17:15498863-15498885 TGCTGAGTCTAGAGGGAAAATGG + Intronic
1144493492 17:15733301-15733323 TGCTATGGATGGAGGCAAGGAGG - Intronic
1144763835 17:17722444-17722466 TGCTGGGACTGCAGCGAAGAGGG + Intronic
1144995283 17:19263878-19263900 TGTGGTGGCTGAAGGAAAGAGGG + Intronic
1145108544 17:20141071-20141093 TGCAGTGGCAGGAGGAGAGAAGG - Intronic
1145711446 17:26982535-26982557 TGCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1146326190 17:31888329-31888351 TCCTGTGGTTGGAAGGAATAGGG - Intronic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1146972429 17:37083657-37083679 TGCTTAGGGAGGAGGGAAGAAGG + Intergenic
1147143965 17:38474705-38474727 TGCAGGGGCTTGAAGGAAGAAGG + Intronic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147589058 17:41669545-41669567 TGGTGTGGCTGGAGTGGGGACGG + Intergenic
1148203354 17:45764392-45764414 TGCTCTGCCTTGAGGGGAGATGG + Intergenic
1148216104 17:45834794-45834816 AGCTGTGGCTGGGGGGATGACGG + Exonic
1148318118 17:46722291-46722313 GACTGAGGCTGGAGGTAAGAAGG - Intronic
1148331338 17:46815598-46815620 GGCTGGGGCTGTAGGGTAGATGG - Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148675365 17:49441763-49441785 TGGTGTGGCTGCAGGGAGGGAGG - Intronic
1149199474 17:54165872-54165894 TGCTGTGGGGTGGGGGAAGAGGG + Intergenic
1150006634 17:61473874-61473896 TGCTGTGGCAGAAGGCAGGAAGG + Intronic
1150613652 17:66752697-66752719 TGCTGGGGCTGGAGGGCCCAAGG + Intronic
1150667333 17:67153674-67153696 TGCTGTGGGTGAAGGGAAGTGGG - Intronic
1150935348 17:69629064-69629086 GGCTGGGGCTGAAGGGAAGGGGG + Intergenic
1151251331 17:72837868-72837890 TGCAGGGGCTGGAGGGAGGGAGG + Intronic
1151905969 17:77049568-77049590 TGCCGAGGCTGGAGTGAAGCCGG - Intergenic
1151966627 17:77434873-77434895 TGCCATAGCTGGAGGGAAGAGGG + Intronic
1151991226 17:77575902-77575924 TGCTGTGGCCTGAGGGCAGGGGG - Intergenic
1153393978 18:4596744-4596766 TGATTTGCCTGGAGGAAAGAAGG + Intergenic
1153493181 18:5670841-5670863 TGGAGTGGGTGGAGTGAAGAGGG + Intergenic
1154327292 18:13400740-13400762 TGCTGTTGGTGTAGGGATGACGG + Intronic
1154504712 18:15024292-15024314 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
1156126933 18:33917322-33917344 TGCTGTGTTTGGATGGATGAAGG + Intronic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157362565 18:47033197-47033219 TGCTCTGGCTGGAGGGAGTGTGG + Exonic
1157886885 18:51377291-51377313 AGTAGTGGGTGGAGGGAAGATGG + Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160131745 18:76231492-76231514 CCCTGAGGCTGGAGGTAAGAAGG - Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160569558 18:79807618-79807640 TGCTGCGGCGGGAGGGAGGAAGG - Intergenic
1160782545 19:884290-884312 TCCTGGGGCTGGAGCGAAGCAGG - Intronic
1160916835 19:1500799-1500821 TCCTGTGGCTGGAGCAGAGAAGG + Intergenic
1161989493 19:7676648-7676670 AGCTGAGGCTGGAGGGAGGAAGG + Exonic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162299319 19:9835326-9835348 CGCTGCGGCAGGAGGGAAGATGG + Exonic
1162510230 19:11113514-11113536 TGCTGAGGCAGGAGGAGAGAAGG - Exonic
1162539327 19:11284693-11284715 TGCTGCGCCTGGCGGGAAGGGGG - Intergenic
1163912913 19:20213659-20213681 AGTTGAGGCTGGAGGGTAGAAGG + Intergenic
1164394432 19:27850966-27850988 TGCTGAGGGTGGAGGGTAGTGGG - Intergenic
1164435146 19:28222336-28222358 TGGTGAGGCTGCTGGGAAGATGG - Intergenic
1164591424 19:29509663-29509685 TGCTGTGCAGGGAAGGAAGATGG + Intergenic
1164870573 19:31640113-31640135 AGCTGTGGCTAGAGGAAAGAAGG + Intergenic
1164870741 19:31640701-31640723 GGCTCTGGAAGGAGGGAAGATGG + Intergenic
1165076228 19:33281359-33281381 GGCTCTGGCTGGAGGGAGGCTGG + Intergenic
1165277692 19:34769309-34769331 TGCTGAGGCTGCAGGGATCAGGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165832695 19:38737117-38737139 AGCTGAGGCTGGAGGGAACCCGG - Intronic
1166030961 19:40127367-40127389 TGCTGAGGGTGTAGAGAAGAAGG + Intergenic
1167463043 19:49636307-49636329 TGCTGGGGCTGGTGGGAGGTTGG + Intronic
1167471771 19:49679640-49679662 AGCTGTGGCTGGAGAGATGGTGG - Intronic
1167503491 19:49859919-49859941 TGCCGTGGTTGGAGGGATGCTGG + Intronic
1167777383 19:51568003-51568025 GGCTTTGGCTGGAGGAATGAAGG - Intergenic
1168127393 19:54293374-54293396 AGCAGGTGCTGGAGGGAAGAGGG + Intergenic
1168172964 19:54601474-54601496 AGCAGGTGCTGGAGGGAAGAGGG - Intronic
1168512506 19:56984311-56984333 TGGTGAGGCTGGGGGGAAAAAGG - Intergenic
925085281 2:1102778-1102800 TGCTGTAGGTGGAGAGGAGAAGG + Intronic
925266335 2:2569074-2569096 GGCTGGGGCTGGACGGAAGAGGG + Intergenic
925402503 2:3585677-3585699 TGCTGAGGCAGGAGGCCAGAGGG + Intergenic
925448002 2:3944181-3944203 TGCAGTGGCTTCAGGGACGAGGG - Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
926452616 2:13024089-13024111 TGCTGTGGAAGGAGGGAGGAAGG + Intergenic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927050118 2:19319829-19319851 TGCTGGGGCAGGAAGGAAGGAGG + Intergenic
927107351 2:19839624-19839646 TGGTGTGGGTGGAGAGAAGGGGG - Intergenic
927246435 2:20960385-20960407 TCCTGAGGCTGGAGGGTGGAAGG - Intergenic
927278213 2:21279648-21279670 TGCTGGGGCTGGAGGGAGGGCGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927721778 2:25387729-25387751 TGCTGGGGCTGGAGGTGAGAAGG - Intronic
927912962 2:26914592-26914614 TGATGAGGCTGAAGGGAGGAGGG + Intronic
927967893 2:27283020-27283042 TGTTGTGGCTGGAGAGCAGAAGG + Intronic
928914851 2:36459732-36459754 AGCTGTGGCTGGAGTGATAAGGG + Intronic
929027217 2:37616168-37616190 TGCTGTGACTGCAAAGAAGAAGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929779426 2:44948362-44948384 TTCATTGGCTGGAGGGCAGAAGG + Intergenic
929820735 2:45271469-45271491 TGCTGTTGCTGGTGGCAGGAGGG + Intergenic
929884729 2:45868446-45868468 GCCTGTGGCAGGAGGGAAAAAGG - Intronic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
930704506 2:54490880-54490902 TGCTGTGGCTGGAATAAAGAGGG + Intronic
930941567 2:57020656-57020678 TGGTGAGGCTGCAAGGAAGAGGG - Intergenic
931037406 2:58258940-58258962 TGGGGTGGCTGGAGTGAGGAAGG + Intergenic
931220395 2:60283897-60283919 TGATGTGGCTGCAGGAAACATGG - Intergenic
931818720 2:65930325-65930347 TCCTGGGGCTGGAGCCAAGATGG - Intergenic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
932580200 2:72988392-72988414 TGCAGTGGCTTGTGGGAGGAGGG + Intronic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
933566361 2:83955175-83955197 TGTTGTGGCTGGAATCAAGATGG + Intergenic
933941009 2:87245310-87245332 TGGTGTGGCTGGGGGCAGGAGGG - Intergenic
934705595 2:96476224-96476246 TCCTGGGGCTGGAGGGAGCATGG - Intergenic
934970779 2:98762426-98762448 TACTGTGGAAGGAGGGATGAAGG - Intergenic
936352130 2:111720702-111720724 TGGTGTGGCTGGGGGCAGGAGGG + Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
936658855 2:114519674-114519696 TGCTGTTGTTTGAGGAAAGATGG - Intronic
937341682 2:121095414-121095436 TGGAGAGGCTGGAGGGAGGACGG - Intergenic
937369345 2:121286673-121286695 ACCTATGGCTGGAGGGAGGAGGG - Intergenic
937539114 2:122926472-122926494 TGCTATGGCTGGAGTAAAGATGG - Intergenic
938503902 2:131854500-131854522 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
938573888 2:132586049-132586071 TGCTGCCGCTGGTGGGAAGCTGG + Intronic
938907377 2:135850904-135850926 TGCTTTGGTTGAAGCGAAGATGG + Intronic
939070557 2:137535929-137535951 TGGTGTGGCTGGAGTGGATAAGG + Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940061631 2:149577381-149577403 TGTTGTGGCTGGAGTGCAGAGGG + Intronic
940307591 2:152243283-152243305 TGCTCAGGCTGGAGGGAGGGAGG - Intergenic
941918397 2:170827115-170827137 GGCTATTTCTGGAGGGAAGAAGG - Intronic
942190613 2:173465318-173465340 TGCCATGGCTGGAGGCCAGATGG + Intergenic
942265815 2:174224533-174224555 GGCTGAGGCAGGAGGGAGGATGG + Intronic
942541685 2:177021718-177021740 GGCTGAGGCTGGAGAGATGAAGG - Intergenic
942829207 2:180219195-180219217 TGCTGAGGATGAAGGGAATATGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
943979722 2:194532834-194532856 TCCAGTGGCTGGAGGAAAAATGG + Intergenic
944085995 2:195848760-195848782 TTCTGTGGTTGCAAGGAAGAAGG + Intronic
944688578 2:202139501-202139523 GGCTGTGGCAGGAAGGAAGGTGG - Intronic
945167831 2:206965009-206965031 TGCTGTGGCCAGAGGCTAGAAGG + Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946174429 2:217913743-217913765 TGGAGTGGCTGGAGGGAGAAGGG - Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946248942 2:218401626-218401648 TGCTGTGTCTGCCGGGATGATGG + Exonic
947150763 2:227112729-227112751 GCCAGTGGCTGCAGGGAAGAGGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947834524 2:233166087-233166109 TACTGTGGCAGGAAGGAAGGGGG - Intronic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948376855 2:237526374-237526396 TGCTGTGGCTTGGGGAAAGCTGG - Intronic
948571886 2:238922821-238922843 TTCCCTGGCTGGAGGGAGGACGG + Intergenic
948710448 2:239821866-239821888 GGCTCTGGCTGGAAGGCAGAGGG + Intergenic
949033702 2:241807290-241807312 GGCTGAGGCGGGAGGGAAGGTGG - Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169315086 20:4583815-4583837 GGCGGTGGGTGGAGGGTAGAAGG + Intergenic
1170614643 20:17938875-17938897 TGATGTGTCTGGAAGGAAGTTGG - Intergenic
1170815027 20:19706581-19706603 TTCTGTGGCTGGGGGGAGTATGG + Intronic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1171866102 20:30488437-30488459 TGCAGTGCGTGCAGGGAAGAGGG - Intergenic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172410470 20:34718150-34718172 TACTGTGGTTGGTGGGGAGAAGG + Intronic
1172779027 20:37424859-37424881 TGCGGTGGCAGTAGGGAAGAAGG + Intergenic
1172823253 20:37757769-37757791 TGGTGAGGCTGGAGTGAATAAGG + Intronic
1173361253 20:42346581-42346603 TGGTTTGGCTGGAGGGATGAGGG + Intronic
1174343745 20:49914927-49914949 TGCTAGGGCTGGAGTGGAGATGG - Intronic
1174595119 20:51677734-51677756 TACTGTGTCTGGAGGATAGAAGG - Intronic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175293162 20:57891597-57891619 TGCTGTGGCTTGTGGGAGGCGGG + Intergenic
1175372197 20:58499602-58499624 TGAGGTGGATGGAGGGAGGAAGG - Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175468747 20:59210648-59210670 CCCTGAGGCTGAAGGGAAGAAGG - Intronic
1175526781 20:59639710-59639732 TGCTGAGGGAGGAGGGGAGAAGG + Intronic
1175653319 20:60748008-60748030 TGCTGTGGCTGGGGGTAAAGTGG - Intergenic
1175853615 20:62107109-62107131 TCCCGTGGCAGAAGGGAAGATGG - Intergenic
1176042941 20:63075090-63075112 TGCTGAGGCTTGAGGGAGGGGGG - Intergenic
1176275423 20:64263644-64263666 TGCTGTGGCTGGAGTTTATATGG - Intronic
1176316377 21:5248479-5248501 TGTTGTGGGTTGGGGGAAGAGGG - Intergenic
1176551631 21:8225330-8225352 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1176570540 21:8408329-8408351 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1176578449 21:8452496-8452518 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177284325 21:19029152-19029174 TACCTTGGCTGGATGGAAGAGGG - Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178169154 21:30019397-30019419 TGCTGGGGCTGGAGGCAGGATGG + Intergenic
1178580007 21:33830513-33830535 AGCTGTGCCGGGAGGGAGGAGGG + Intronic
1179098305 21:38335109-38335131 GGCTGTGGCTGGAGAAAAGCTGG + Intergenic
1179404105 21:41111246-41111268 TGCTCTGGCTGTAGTGCAGAGGG + Intergenic
1179561719 21:42219671-42219693 AGCTTGGGCCGGAGGGAAGAGGG + Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180385177 22:12172715-12172737 TGGCGTGGCTGGAGGGTAGCTGG + Intergenic
1180987659 22:19914889-19914911 TTCTGAGGCTGAAGGGAAAAGGG + Intronic
1181539366 22:23565320-23565342 GGCTGTGGCTGGCAGGCAGAGGG + Intergenic
1181640569 22:24195225-24195247 TGGGGTGGCGGGAGGGGAGAGGG + Intergenic
1181715833 22:24727409-24727431 TGCTATGGCTGGTTGGAAGATGG + Intronic
1182124116 22:27804124-27804146 TTCTGTGTCTGGAGGAAATAGGG + Intergenic
1182320877 22:29478140-29478162 TGCGCTGGGAGGAGGGAAGAGGG - Intergenic
1182800683 22:33029573-33029595 TCCTAAGGCTGGAGGGAGGATGG - Intronic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183027331 22:35075464-35075486 TGCCTTGGATGAAGGGAAGATGG + Intronic
1183248352 22:36711005-36711027 TGATTTGGCTGGAGGGAGGAAGG - Intergenic
1183266287 22:36827973-36827995 AGCGGGGGCTGGAGGGAAGGAGG + Intergenic
1183317270 22:37143569-37143591 TCCTGTGTCTGGAGCCAAGATGG - Exonic
1183740776 22:39667317-39667339 TGCTCTGGATGGTGGGAAGGAGG + Intronic
1183958936 22:41399260-41399282 TGATGTGGTGGGAGGGAAGCCGG + Exonic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184676352 22:46045331-46045353 ACCTTTGGCTGGAGGGAAGGAGG + Intergenic
1184751585 22:46489406-46489428 TGCTGAAGCTGGGGAGAAGAAGG + Intronic
1184839367 22:47043572-47043594 TGCTGAGGACGTAGGGAAGATGG + Intronic
1184916410 22:47571954-47571976 TGCAGTGGCAGGAGGGAGGCAGG - Intergenic
1185128060 22:49022719-49022741 GGCTGTGGCTGGGGGGAACCAGG - Intergenic
1185399348 22:50607913-50607935 GCCTGTGCCTGGAGGGAAGCTGG - Intronic
1203256653 22_KI270733v1_random:142250-142272 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
949379692 3:3431025-3431047 TGATGTCGCAGGAGGGAAAAAGG - Intergenic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950224630 3:11223652-11223674 TGCTGTAGCTGGAGTGGAGTGGG - Intronic
950260985 3:11543402-11543424 GGCTGAGGCAGGGGGGAAGATGG - Intronic
950533231 3:13565219-13565241 TGCTGTGGGTGGGGGGACCAGGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950905705 3:16536089-16536111 TGCTGAGGCTGCAGGGAAGCTGG - Intergenic
950930238 3:16781831-16781853 TGCAGTGGCGGGAGTGAGGAGGG + Intergenic
951508379 3:23474741-23474763 TGCTGTGACAGGAAGGAAGGAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952500152 3:33954103-33954125 AGCTAAGGCTGGAGGGAAAATGG - Intergenic
952682095 3:36105415-36105437 TGGTGTGGCGGGAGGGGGGAGGG + Intergenic
953405134 3:42656189-42656211 TGCAGTGGCTCTAGGGAGGAGGG + Intronic
953849656 3:46455937-46455959 TGCCGTGGCTGTGGTGAAGAAGG - Exonic
953896759 3:46809108-46809130 TGCTCTGGCTGGTGGGAAGGAGG - Intronic
953899240 3:46830018-46830040 TGCTCTGGCTAGTGGGAAGGAGG - Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954421730 3:50422406-50422428 GGCTGAGGCTAGAGGGAAGGAGG - Intronic
954557948 3:51532997-51533019 GGCAGTGGCTGGAGGGAACCTGG + Intergenic
954654600 3:52186280-52186302 TGGTGTAGCTGGTGGGAAGGGGG - Intergenic
955409361 3:58645864-58645886 TGCTGTGGCTGGAGCTGTGAAGG - Intronic
955419709 3:58724164-58724186 TGCTGGGGCTGGCTGGAGGATGG + Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956974274 3:74562116-74562138 TGATGTGGCTGGTGGAAATATGG - Intergenic
957072911 3:75580072-75580094 GGCTGTTGCTGGAGGGAGGGGGG - Intergenic
957321020 3:78630204-78630226 TGTTGTGGCTAGAGGTTAGAAGG + Intronic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
957941738 3:87014568-87014590 TCCTGTGGTTGGAGAGAATATGG - Intergenic
958195731 3:90239946-90239968 GGCTGAGGCAGAAGGGAAGAAGG + Intergenic
958764961 3:98356754-98356776 TTCTGTCTCAGGAGGGAAGATGG + Intergenic
959189969 3:103098245-103098267 TGCTGCTGAAGGAGGGAAGAGGG + Intergenic
959431713 3:106262221-106262243 TGATGAGGCTGCAGGGAAAAGGG + Intergenic
959500472 3:107101094-107101116 TTCTGTGGCTAGAGAGTAGAGGG - Intergenic
959667013 3:108933688-108933710 TGGTGAGGCTGCAGAGAAGAAGG + Intronic
959881337 3:111447876-111447898 TTCTAAGGCTGGAGGCAAGATGG + Intronic
960594919 3:119399484-119399506 AGCTGTGGCTAGAGGAAGGATGG - Intronic
961219347 3:125187502-125187524 TGCTGTGGGAGGAGGGGAGGTGG - Intronic
961488181 3:127232151-127232173 TGCTGTGGCTGTGGTGAAGAGGG + Intergenic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
961646818 3:128397184-128397206 TCCTGTGGAAGGAGGGAGGATGG - Intronic
961817214 3:129557295-129557317 TTATGTGGCAGGAGGGATGAGGG - Intronic
962241489 3:133754514-133754536 TGCTGTTGCTGTGGTGAAGAAGG + Exonic
962417837 3:135200063-135200085 TGCTCTGACTGGAGGAGAGATGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
964059727 3:152506211-152506233 TGCTGTGGTAGGTGGGAGGACGG + Intergenic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964668468 3:159199596-159199618 TGATGTGGCGGGAGGAAAGCTGG + Intronic
964815065 3:160708307-160708329 TGAAGTGGCTGGAGAGAAGAGGG - Intergenic
965254689 3:166390790-166390812 TGCTGTGGATGTAGGGGAAAAGG - Intergenic
966323209 3:178724118-178724140 TGGTGAGGCTGGAGAGAAAAGGG - Intronic
966459489 3:180160377-180160399 TGCAGAGGCTGCAGAGAAGAGGG - Intergenic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967246519 3:187492172-187492194 TGGAGTGGCAGTAGGGAAGAAGG - Intergenic
967304401 3:188046470-188046492 TACTGTGGCTGTAGGGTTGAGGG - Intergenic
967718697 3:192791998-192792020 TGTTGAGGCTGGAAGGAACAAGG + Intergenic
967969015 3:194985573-194985595 TTCTGTGGCTGAAGGGGCGAAGG - Intergenic
968153344 3:196357368-196357390 TGCTGTGGCTGGAGATAATTAGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968896908 4:3409656-3409678 TGCTGCCGGTGGAGGGGAGATGG - Intronic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
969058352 4:4415771-4415793 TGCCGAGGTGGGAGGGAAGAGGG + Intronic
969240683 4:5895026-5895048 TGCGGTGGGTGGAAGGTAGATGG - Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
970360982 4:15308557-15308579 TCCCGAGGCTGCAGGGAAGAGGG + Intergenic
970563230 4:17303832-17303854 TGCTGTAGCTGAAGGCAAAAGGG - Intergenic
970705958 4:18802817-18802839 TGCTCTGAATGGAGGAAAGATGG + Intergenic
971067795 4:23054326-23054348 TTCTGTGGCTGGAAAGAACATGG + Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
972256644 4:37363163-37363185 TGGTGAGGCTGTAGGGAAAAGGG + Intronic
972994686 4:44865326-44865348 TGGTGTGGCTGCAGAGAAAATGG - Intergenic
973104960 4:46324105-46324127 TGCGGTGGGTGGAGGCAAGTGGG - Intronic
973231031 4:47838565-47838587 TGCTGAGGCTGCAGGGACAAGGG + Intergenic
975331750 4:73123788-73123810 TGCTATGACTGGGGGGAAGTGGG + Intronic
975423818 4:74202560-74202582 TGCTGTGGGAGGAGGGCACAAGG + Intronic
975694563 4:76998880-76998902 TGCTCAGCCTGGGGGGAAGATGG + Intronic
975733414 4:77359043-77359065 TGCCATGGAGGGAGGGAAGAAGG - Intronic
975995781 4:80312290-80312312 TGCTTTGGTTAAAGGGAAGATGG - Intronic
976220217 4:82750963-82750985 TGCTGTGAGAGGAGGGAACACGG - Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976454044 4:85224893-85224915 TGGTGAGGCTGCAGGGAAAAGGG - Intergenic
976539891 4:86262260-86262282 TCCTGTGGCTGAAGGCAAAAGGG - Intronic
977354982 4:95934077-95934099 TCCTATGGCAGGAGGGCAGAGGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977790030 4:101088720-101088742 TGCATTGGGTAGAGGGAAGAGGG + Intronic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979971787 4:127144621-127144643 TACTGTGTCTGAAAGGAAGATGG - Intergenic
980094848 4:128478972-128478994 TGGAGTGGGTGGAGGGAAGTAGG - Intergenic
980129326 4:128803688-128803710 TGATCTGCCTGGTGGGAAGAGGG - Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981511031 4:145558593-145558615 TGAGGTGGGTGGGGGGAAGAGGG + Intergenic
982080158 4:151781754-151781776 TGCTGAGGCTGGAGGGCACAGGG + Intergenic
982131642 4:152233994-152234016 TGCAGCAGCTGGTGGGAAGAAGG + Intergenic
982134144 4:152257972-152257994 GGCTGGGGCAGGAAGGAAGAAGG + Intergenic
982268242 4:153559960-153559982 ACCTGTGGCAGGAGGGAAAACGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982614367 4:157622353-157622375 TGTTGTGGGCGGAGGGGAGAGGG - Intergenic
983151822 4:164293753-164293775 TGCTGTGCCTGTAGGCATGAAGG + Intronic
983252863 4:165364700-165364722 TGCTGTAGCTAGAGGAAAGTTGG + Intronic
983625511 4:169798004-169798026 TGTTGTTGGTGGAGGGGAGAGGG + Intergenic
983907326 4:173197734-173197756 GGCTGTGGTTGGAGAGAAGTGGG + Intronic
984850761 4:184150548-184150570 GGCTGAGGCTGGAGGGAACCAGG + Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985519140 5:363113-363135 TGCTGTGGCAGGTGGGAGGCTGG + Intronic
986813035 5:11380281-11380303 TGCTGTGTCTGAAGCAAAGATGG + Intronic
987848756 5:23322273-23322295 TGGTGAGGCTGCAGAGAAGAGGG + Intergenic
989120761 5:38002319-38002341 TGGGGTGGCTGGAGGGATGTAGG + Intergenic
989156195 5:38347074-38347096 TGGGGTGGCTGGAGGGAGGTGGG + Intronic
992000853 5:72434892-72434914 TGCTGAGGCTGGCAGGAACATGG - Intergenic
992955884 5:81907616-81907638 TTCTGGGGCTGGAGGAAACAAGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993508831 5:88746038-88746060 AGCAGTGGCAGAAGGGAAGAAGG + Intronic
993592488 5:89811525-89811547 TGCAGTGGGGGGAGGGAGGAGGG - Intergenic
993875020 5:93296293-93296315 TGCTGAGCCAGGAAGGAAGATGG + Intergenic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
995588002 5:113669371-113669393 TGCTGTGGATGTAGTGAAAAGGG + Intergenic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997292219 5:132746078-132746100 TGGTGAGGCTGCAGGGAAAAGGG - Intergenic
997407535 5:133663757-133663779 TGCTGTGCCTTGAGGCAACATGG + Intergenic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
997630923 5:135368511-135368533 TGATCTGGCTGGAGGCCAGAAGG + Intronic
997750090 5:136336007-136336029 AGATGTGGCAGGAGGGAAGTTGG - Intronic
997865065 5:137454504-137454526 TGCTGAGGCTGGAGGGGAGGGGG + Intronic
997890876 5:137675688-137675710 TGCTGTGTCTGGCGGGGAGTAGG - Intronic
997980495 5:138465153-138465175 GGCTCTGGGAGGAGGGAAGAAGG + Intergenic
998227649 5:140339302-140339324 TCCTGTGGCTGGAGGAAAACTGG - Intronic
998844942 5:146299431-146299453 TGGTGTGGATGTAGGGAAAAGGG - Intronic
998867656 5:146521496-146521518 TGCTGTGGATGCCTGGAAGAGGG + Intergenic
998879329 5:146630778-146630800 TGTTATGGTTGGAGTGAAGATGG - Intronic
999058326 5:148606119-148606141 TGCAGAGACTGGAGGGAAAAAGG + Intronic
999151757 5:149430820-149430842 GGCTGTCCCTGGAGGTAAGAGGG + Intergenic
999410722 5:151347502-151347524 TGCTCTGGAAGGAGGGAAGCAGG + Exonic
999495259 5:152090493-152090515 TGTGGTGGTGGGAGGGAAGAGGG + Intergenic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000856667 5:166406381-166406403 TGATGTGGCTGGAGGTAGTAAGG + Intergenic
1001202425 5:169730296-169730318 TGCGATGGCTGGATGGGAGAAGG + Intronic
1001268158 5:170290219-170290241 TGCTGTGGGTGTTGAGAAGAGGG + Intronic
1001396469 5:171422033-171422055 TGCTGTGCCTGGGGGCAGGAGGG + Intronic
1001635041 5:173203793-173203815 TCCAGGGGCTGGAGGGAGGAGGG - Intergenic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1001971197 5:175956399-175956421 AGATGTCGCTGGAGGGAAGAGGG - Intronic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1002246245 5:177887378-177887400 AGATGTCGCTGGAGGGAAGAGGG + Intergenic
1002470576 5:179432883-179432905 AGCAGAGGCTGGAGGGATGAGGG - Intergenic
1002825058 6:764968-764990 TGCTGTTGATGGAGGGTATAGGG + Intergenic
1002892426 6:1347162-1347184 TCCTGTGGGTCAAGGGAAGAAGG - Intergenic
1003148674 6:3530453-3530475 AGCTGTGGCTGGAAGGAAGAGGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1004178223 6:13359179-13359201 TCCTGTGCCTGGCGGGGAGAAGG + Exonic
1004180560 6:13377507-13377529 TGCTGTTGCTGGCTTGAAGATGG - Intronic
1004565913 6:16797540-16797562 GGCTGAGGCTGGAGAGAAGCTGG + Intergenic
1005511184 6:26512974-26512996 GGCTGGAGCTGGAGGGAAAAAGG - Intergenic
1005589519 6:27310125-27310147 TCCTGTGGCTGGGGTGAAGTCGG + Exonic
1005994730 6:30924287-30924309 AGCAGTGGCTGTAGGGAGGAGGG + Intronic
1006370641 6:33641685-33641707 TGGTGTGGTTGCAGGGAAGTGGG - Intronic
1006446084 6:34080549-34080571 TGCAAAGGCTGGAGGGCAGAAGG + Intronic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1007126887 6:39433012-39433034 TGCTTAAGCTGCAGGGAAGAAGG + Intronic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007322452 6:41037499-41037521 TCCTGAGGTTGGAAGGAAGAAGG - Intronic
1007398018 6:41588185-41588207 GGCTGAGGCTGGAGGGGAGCAGG - Intronic
1007509124 6:42362028-42362050 TACTGTGCCTGGAAGGAAGAGGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1008969520 6:57350661-57350683 TGCTGTTGCTGGAAAAAAGAAGG - Intronic
1009158492 6:60252497-60252519 TGCTGTTGCTGGAAAAAAGAAGG - Intergenic
1009965940 6:70578207-70578229 TGGTGAGGCTGTAGAGAAGAGGG - Intronic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1012250102 6:96970390-96970412 TCCTGTGGCAGGAGGGAGCATGG - Intronic
1012526036 6:100178793-100178815 TGCTGGGCCTGCAGGGAAGGAGG + Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1013819080 6:114134022-114134044 GGCGGTGGCTGGAGAGAAAAAGG + Intronic
1014860309 6:126458378-126458400 TGCTGTGGTTTGAGGAGAGAGGG - Intergenic
1015138966 6:129908520-129908542 TGCTGAGGGTGAAGGGAATAGGG - Intergenic
1015613904 6:135054915-135054937 TGCTGTGCATGGCGGGACGAGGG + Intronic
1015842987 6:137493274-137493296 TGCCGGGCCGGGAGGGAAGAGGG - Exonic
1016191667 6:141275990-141276012 TACTGTGGCTGGAGGCTACAGGG - Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016519755 6:144933634-144933656 TGCTGGGGCAGGAGGGAGGATGG - Intergenic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1018608942 6:165627576-165627598 TGCCGTGACTTGGGGGAAGAGGG + Intronic
1019024296 6:168944141-168944163 AGCTGAGGCTTGAGTGAAGACGG + Intergenic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1019117596 6:169777772-169777794 AGCTGTGGGTGGGGGGAAGGGGG - Intronic
1019310976 7:360503-360525 TGCTGGCGCTGGCGGGAAGGAGG - Intergenic
1019410095 7:902962-902984 TGATGTGCCTGGAGGGAAAGGGG - Intronic
1019862269 7:3670329-3670351 GGCTGTGGCTGGACGTCAGAGGG - Intronic
1020261301 7:6532012-6532034 TGCTCTGCCAGGAGAGAAGAGGG + Intronic
1021638257 7:22712558-22712580 TGCTGTGGCAGGAGAAGAGAGGG - Intergenic
1023497207 7:40810400-40810422 TGGTGAGGCTGCAGAGAAGAAGG - Intronic
1024044307 7:45576445-45576467 GGCAGGGGCGGGAGGGAAGAAGG + Intronic
1024921050 7:54554776-54554798 AGCTGTGGCTGGAGGAAGGCTGG - Intronic
1025042712 7:55662207-55662229 TGCTGCCGCTGGAGGGGACAGGG - Intergenic
1025803053 7:64805596-64805618 GGCTGTGTCTCAAGGGAAGATGG + Intronic
1026275056 7:68869340-68869362 TGTTGTGGCTGGAGGGTGGGAGG - Intergenic
1026462049 7:70623008-70623030 TGCTATGGCAGGAGGGCACACGG - Intronic
1026592504 7:71709193-71709215 TGATGAGGCTGCAGAGAAGAAGG - Intronic
1026645247 7:72161768-72161790 GGCAGTGGCGGGTGGGAAGAGGG + Intronic
1027305209 7:76887718-76887740 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1028155900 7:87429154-87429176 TGGTGAGGCTGGAGAGATGAGGG - Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028566450 7:92237709-92237731 TCCTCTGGATGGAGAGAAGATGG - Exonic
1028597761 7:92565189-92565211 TGCTGAGGCTGGAGTGCAGTGGG + Intronic
1028892838 7:96007989-96008011 TACAGTGGCTGGAGGGTATATGG - Intronic
1029479053 7:100802084-100802106 GGCTGTGGGGGAAGGGAAGAAGG - Intergenic
1030265465 7:107616311-107616333 TTCTTGGGCTGGAGGGATGAGGG - Intronic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1032291059 7:130590928-130590950 TGGTGTGGCTGCCGGGCAGAGGG - Intronic
1032459727 7:132101755-132101777 GGCTGGGGCTGGAGAGATGAAGG + Intergenic
1033220327 7:139523373-139523395 TGCTGTGGCTCCAGGGCAGCCGG + Intergenic
1033430237 7:141282360-141282382 TGCAGTGGTTGGAGAGAGGATGG + Intronic
1033629135 7:143140008-143140030 AGCTGTTGCTGGAGGGCAGTGGG - Intergenic
1033767584 7:144510976-144510998 TGCTGTTGCTGGACTGAAAAGGG + Intronic
1033831211 7:145255559-145255581 TGATGAGGCTGGAGAGAAAAAGG - Intergenic
1033842054 7:145386732-145386754 TCCTGTTGCTGGAGGGAGGCAGG + Intergenic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034088540 7:148342756-148342778 TGCAATGGCTTGAGGGAAAAAGG + Intronic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1034470592 7:151252345-151252367 TGCTGGGGGTGTAGGGAAAAGGG - Intronic
1034758353 7:153645607-153645629 TGCATTGGCTGCAGGGAAGGAGG + Intergenic
1035908764 8:3542720-3542742 TGCTGTAGGTTGAGGTAAGAAGG + Intronic
1036649463 8:10633125-10633147 ATCTGTGGCTGGAGGGATGAGGG + Intronic
1036980676 8:13466620-13466642 TGATGGGGCTCCAGGGAAGATGG - Intronic
1037372438 8:18194282-18194304 TGATGTGTCTGTAGGGGAGAGGG + Intronic
1038007517 8:23445271-23445293 TGCTGTGGCAGGCTGGCAGAGGG - Intronic
1038177651 8:25195530-25195552 TGGTGTGGCTGGAATGCAGAAGG - Intronic
1038621504 8:29147794-29147816 TGCTTTTTCTGCAGGGAAGATGG - Intronic
1039349262 8:36743453-36743475 TGGGGTGGCGGGAGGGGAGAAGG - Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1040655867 8:49506765-49506787 GGCTGAGGCTGGAGGGTAGCTGG - Intergenic
1040848143 8:51867804-51867826 GGCTGGGGCAGGAGGGTAGATGG + Intronic
1040968984 8:53113604-53113626 TGCTGTGCCAGGAGAGAACACGG + Intergenic
1041214119 8:55583007-55583029 TGAGGTGGCTGGAGTGGAGAAGG - Intergenic
1041469207 8:58190294-58190316 GGCTGTGGCTGAAGGGAATGGGG + Intronic
1041581630 8:59466165-59466187 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1041904084 8:63012767-63012789 TGCAATGGAGGGAGGGAAGATGG + Intergenic
1042274145 8:66985690-66985712 TGCTCTGGTTGGGAGGAAGAAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042818532 8:72904861-72904883 TGCAAAGGATGGAGGGAAGAAGG - Intronic
1043488673 8:80725176-80725198 TACTGTGGTAGGAGGGCAGAAGG + Intronic
1043506584 8:80908836-80908858 TGATGTTGCTGGAGGGTAAAAGG + Intergenic
1046155383 8:110283036-110283058 TGGTTTGGCAGGTGGGAAGAGGG - Intergenic
1046352097 8:113028671-113028693 GGCTTTGGCTGAAGGGAATATGG - Intronic
1047370805 8:124254249-124254271 GGCCGGGGCTGGAGTGAAGATGG + Intergenic
1048523270 8:135177179-135177201 TGCTGCGGCTGGAGGGAGCCTGG + Intergenic
1049021560 8:139960791-139960813 TGCAGTGGCAGGAGTGCAGAAGG - Intronic
1049021902 8:139962852-139962874 TGCAGAGGCTGGAGGGAGGCTGG + Intronic
1049052579 8:140210422-140210444 TGCTGCTGCTGGAGGGAAGTGGG + Intronic
1049339485 8:142104471-142104493 TGCTGTGGCAGGAGGCAGGCTGG - Intergenic
1049655141 8:143793932-143793954 TGGAGCAGCTGGAGGGAAGATGG - Exonic
1050396049 9:5197002-5197024 TGGTGAGGCTGCAGGGAAAAGGG - Intergenic
1050607924 9:7320417-7320439 TGCTGTGGCTGGTGGTAGGCTGG + Intergenic
1050716382 9:8531366-8531388 TGATGTTGCTGGGGGGAAAAAGG + Intronic
1051105015 9:13569515-13569537 GGCTGGGGCTGGAGGGAGAAAGG - Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051966764 9:22837012-22837034 TGCAGTGGCTGGTGGGAGGATGG + Intergenic
1052296776 9:26905496-26905518 TGCTGTAGCAGTGGGGAAGAGGG - Exonic
1052383799 9:27801599-27801621 GGCTGGGACTGGAGGGAATAAGG - Intergenic
1052392817 9:27900977-27900999 TGCTGTGGCTGAAGAGAGGCAGG - Intergenic
1053138480 9:35666624-35666646 TGCTTTGGGTGGGTGGAAGAGGG + Intronic
1053168544 9:35861762-35861784 TACTGAGGCTGGATGGAGGATGG + Intergenic
1053420013 9:37971399-37971421 TACTGTCGCTGGAGGGAAAGTGG - Intronic
1054921853 9:70551316-70551338 TGCTGTGGCTGGGTGGAAAAGGG - Intronic
1055003014 9:71474785-71474807 TTCTGTGGATGGAGGTAACAAGG + Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057817666 9:98307468-98307490 TGCTGAAGCCGAAGGGAAGAGGG - Intronic
1057919279 9:99083207-99083229 TGCTGTGGCTGAGGGGCAGAAGG + Intergenic
1058093553 9:100833029-100833051 TGTTGTGGGTGGGGGGAAGGAGG + Intergenic
1058233597 9:102461698-102461720 TGCTGTGGCTGCTGTGAAAATGG - Intergenic
1059533681 9:115061346-115061368 TGGTGTGCCTGGAAGTAAGAGGG - Intronic
1059993169 9:119884354-119884376 TTCTGTGGCAGGAGGCAAAATGG - Intergenic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1061233531 9:129328703-129328725 GCCTCTGGCTGGAGGGAAGTGGG + Intergenic
1061275508 9:129567828-129567850 GGCTGTGGCTGGCAGGCAGAGGG + Intergenic
1061440576 9:130600534-130600556 TGCTGAGGCTGGAGTGCAGTGGG + Intronic
1061803544 9:133126158-133126180 AGCTGGGGCAGGAGGGAGGAAGG - Intronic
1061963549 9:134000210-134000232 TGCTGTGGCTAGAGGACAGCTGG - Intergenic
1061986698 9:134134434-134134456 TGCTTTGCCTGGAGGGCTGAAGG + Intergenic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062166999 9:135112868-135112890 GGCCATGGCAGGAGGGAAGAGGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1203472810 Un_GL000220v1:123954-123976 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1186470735 X:9820313-9820335 GGCTGTGGCTGGAGCAAAGAGGG - Intronic
1186942846 X:14529583-14529605 TGGAGTGGGTGGGGGGAAGAGGG - Exonic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1188514669 X:30972434-30972456 TACTGTGGCCGGAGAGAATAAGG + Intronic
1188583383 X:31743205-31743227 TGCTGACGCTGTAGAGAAGAGGG + Intronic
1192015670 X:67327119-67327141 TGACGTGGCTGGAGCCAAGATGG - Intergenic
1192025916 X:67451260-67451282 TGGGGAGGCTGGAGGGGAGAAGG + Intergenic
1192188792 X:68978263-68978285 GGCAGTGTCTGCAGGGAAGAGGG - Intergenic
1192200069 X:69061014-69061036 TGCTGTTGCAGGAGGGAGGTGGG + Intergenic
1192318462 X:70069028-70069050 TGCTATGGCAAGAGGGGAGAGGG - Intergenic
1192507704 X:71699070-71699092 TGCGGAGGCTGGAGGCAAGAAGG - Intergenic
1192518992 X:71782482-71782504 TGCGGAGGCTGGAGGCAAGAAGG + Intergenic
1192596593 X:72414743-72414765 TGCAGTGGCTGGAGAGCAGAAGG + Intronic
1192608370 X:72543384-72543406 GGCTGTGGCTGGAGAGCAGGTGG + Intronic
1192674194 X:73177354-73177376 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1193216343 X:78868752-78868774 TGAAATGGCTGGAGGAAAGAGGG - Intergenic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1194874240 X:99166033-99166055 TACTGTAGTTTGAGGGAAGAGGG - Intergenic
1195222962 X:102763838-102763860 TGCCATTGCTGGATGGAAGAAGG + Intergenic
1196019068 X:110970592-110970614 TGCTGTGGGTGGGGGGAAAGAGG + Intronic
1196519361 X:116654935-116654957 TGCAATGGCTGTAGGGAATAGGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197046561 X:122004549-122004571 TCCATTGGCTGGAGGGAGGAGGG + Intergenic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1198052254 X:132960531-132960553 TGCCTTGGGTGGAGGGAAGGGGG + Intronic
1199071319 X:143478352-143478374 TGCTGTGGGTGGAGAGAACATGG - Intergenic
1200000673 X:153058295-153058317 TGCTATAGCTGTGGGGAAGACGG + Exonic
1200147527 X:153934468-153934490 TCCTCTGGCTGCAGGGAAGGAGG + Exonic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
1201557181 Y:15274853-15274875 TGCTCAGGCTGGAGTGAAGTGGG - Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic