ID: 953931011

View in Genome Browser
Species Human (GRCh38)
Location 3:47005653-47005675
Sequence GTGTAGGGATGGAGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 639}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953931001_953931011 27 Left 953931001 3:47005603-47005625 CCTGGAGAACCAGAACGGTAGGT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG 0: 1
1: 0
2: 6
3: 70
4: 639
953931003_953931011 18 Left 953931003 3:47005612-47005634 CCAGAACGGTAGGTGTGAGGTGC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG 0: 1
1: 0
2: 6
3: 70
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953931011 Original CRISPR GTGTAGGGATGGAGAGCAGA TGG Intronic
900302798 1:1986396-1986418 GTGCAGCCATGGGGAGCAGAGGG - Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
900993456 1:6108236-6108258 ATGGAGGGATGGAGAGATGACGG + Intronic
901006686 1:6175131-6175153 GTGGATGGATGGATGGCAGATGG + Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
902151745 1:14448786-14448808 GTGCAGGGCTGGAGAGGTGAGGG - Intergenic
902359977 1:15937137-15937159 GTGTAGGGAAGGAAGGCAAAGGG - Intronic
902450038 1:16491092-16491114 ATGTGGGGATGGGGAGCTGATGG + Intergenic
902880368 1:19368255-19368277 GTGGTGGGATGGAGCGCAGGCGG + Intronic
903385766 1:22925162-22925184 GTGTAGGGCTGGGGGGCTGAGGG - Intergenic
903670272 1:25031262-25031284 CTGGAGGGATGGAGACTAGAGGG + Intergenic
904437711 1:30509528-30509550 CTGCAGGGAGGGAGACCAGATGG + Intergenic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906065145 1:42975222-42975244 GGGTAGGGAGTGAGATCAGAGGG + Intergenic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906949537 1:50323275-50323297 GAGCAGGGATGGAGCCCAGACGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908186225 1:61655323-61655345 TGGTAGGGAGGAAGAGCAGAGGG + Intergenic
908345596 1:63229122-63229144 GGGGAGGGATGGAAAGAAGAGGG - Intergenic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909046984 1:70722363-70722385 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
910441804 1:87260675-87260697 GAGTAGGGATGGAGAGGAAAAGG + Intergenic
910644424 1:89498076-89498098 GTGTAGGGGTGGAGGGTGGATGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
910810237 1:91228259-91228281 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
910965947 1:92808078-92808100 ATGGAAGCATGGAGAGCAGATGG + Intergenic
911693328 1:100860303-100860325 GTGTAGGGGGAGAGAGGAGAGGG + Intergenic
914530723 1:148522296-148522318 GGGTAGGGCGGAAGAGCAGACGG + Intergenic
915283593 1:154839005-154839027 GGGGAGGGAGGGAGAGCAGAAGG - Intronic
915288968 1:154870159-154870181 GGGCAGGGAGGGAGAGCAGGAGG + Exonic
915327612 1:155088772-155088794 GTGTGGGGTGGGAGAGCAGGTGG + Intergenic
915780028 1:158537812-158537834 GTGTAGGGAGAGAGGGCAGTGGG - Intergenic
915903529 1:159862596-159862618 GTGGAGGGAGGGGGAGCTGAGGG + Exonic
916740660 1:167644548-167644570 AGGGAGGGAAGGAGAGCAGATGG + Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917242133 1:172959926-172959948 ATGGTCGGATGGAGAGCAGAAGG + Intergenic
917288578 1:173447480-173447502 GTGTAGGGGTAGAGGGCATATGG + Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917844493 1:179009215-179009237 GGGTAGTGAAGGGGAGCAGATGG + Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918435156 1:184503505-184503527 ATGCAGGGATGTAGAGGAGAGGG - Intronic
918543551 1:185657636-185657658 GGGTAGGGGAGGAGAGGAGAGGG - Intergenic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
919748101 1:201021185-201021207 GGGCTGGGAAGGAGAGCAGATGG - Intronic
919902954 1:202057370-202057392 CTGTAGGGAAGGAAACCAGACGG - Intergenic
920187096 1:204166490-204166512 GTTTCCGGATGGGGAGCAGAGGG + Intergenic
920271182 1:204765226-204765248 GTGTAGGGAGGGATAGCATTAGG - Intergenic
920538495 1:206758626-206758648 CTGTAGGGATGTAGAGCGGTAGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921545557 1:216470655-216470677 GAGTAGGGCTGAAGAGGAGAAGG + Intergenic
922409694 1:225359984-225360006 TTGTAGGGAGGGAGAGCATCAGG - Intronic
922632256 1:227127944-227127966 GGATAGGGAGAGAGAGCAGAAGG - Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923081630 1:230662168-230662190 GTGGAAGGAGGGAGAGCATATGG - Intronic
923404496 1:233646597-233646619 GTGCAGGGAGTGAGAGCAGATGG + Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
1062776082 10:149220-149242 GTGCAGGGATGGAGATCCAAAGG - Intronic
1063699036 10:8366666-8366688 GTGAACGGCTGGAGAGTAGATGG - Intergenic
1063953143 10:11242792-11242814 GTGTAGGGAGGGAGAAGAGGTGG + Intronic
1064249781 10:13698066-13698088 GTATATGCATGGAGAGCTGATGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064657571 10:17570969-17570991 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065285745 10:24186037-24186059 GTGTTGGGAAGGGGAGGAGAAGG - Intronic
1065567337 10:27026625-27026647 GTGTAGAAATGAAGATCAGAAGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066048447 10:31614592-31614614 GTGAAGGGATGGATGGCTGATGG - Intergenic
1067284767 10:44899480-44899502 GAGGAAGGATGGAGAGCAGATGG + Intergenic
1067923852 10:50487342-50487364 GTGGAGGGAGAGAGAGCAGATGG + Intronic
1069701308 10:70428434-70428456 GTGTGTGGATGGATAGCAGAGGG + Exonic
1070558770 10:77550204-77550226 GTGAAGGGTTGGAGAAGAGAGGG + Intronic
1070918455 10:80169396-80169418 GTGGAGGGACGGAGTGCAGCAGG - Intronic
1071337294 10:84611399-84611421 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072621755 10:97084318-97084340 GTCTAGGGATGGAGAGAATGAGG - Intronic
1072968004 10:99991427-99991449 GCCTAGGGCTGGAGAGGAGAGGG - Intronic
1073639779 10:105240099-105240121 GTGCAGGGATGCAGGGCAAAGGG - Intronic
1073862489 10:107763816-107763838 GTATAGGGAGGGAGAGCATTAGG - Intergenic
1074438464 10:113454515-113454537 GAGAAGGGATCCAGAGCAGAAGG - Intergenic
1074650976 10:115524058-115524080 GTGTAGAGATCGAGATCACATGG + Intronic
1075651805 10:124132232-124132254 GTGGAGGGATGAAGAAAAGAGGG + Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076131299 10:128015829-128015851 GGGGAGAGCTGGAGAGCAGATGG + Intronic
1076291189 10:129347092-129347114 GAGTAGGGATGTGAAGCAGAAGG + Intergenic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077702818 11:4457480-4457502 GTGTAAGGATTGGGAGCAGCAGG - Intergenic
1078643721 11:13119068-13119090 GGGCTGGGATGGAGAGCATATGG + Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1080293107 11:30693475-30693497 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1080800033 11:35601889-35601911 GTGCAGGGATGGAGAGAATCTGG - Intergenic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1081831663 11:46120543-46120565 GGGGAGGGGTGGAGGGCAGAGGG + Intronic
1082230703 11:49762560-49762582 GTCTAGGGATGGATAGCATTAGG - Intergenic
1083743379 11:64722691-64722713 GGGAAGGGATGGAGAGAGGAGGG - Intronic
1084000620 11:66293551-66293573 GTCTTGGGGTGGGGAGCAGATGG - Intronic
1084006560 11:66326411-66326433 GTGGAGGGGTGGAGGGCGGAGGG + Intergenic
1084727167 11:70949457-70949479 GTGAAGGGAGGGTGAGCAGGTGG - Intronic
1084732049 11:71079919-71079941 GGGGAGGGAAGGAGAGGAGAGGG + Intronic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1084794023 11:71492125-71492147 GGGAGGGGAGGGAGAGCAGATGG + Intronic
1085326284 11:75609165-75609187 TTATAGGGCTGGAGAGTAGATGG + Intronic
1085948747 11:81304240-81304262 GTGGGGGGATGGAGAGCATAGGG - Intergenic
1085950336 11:81322881-81322903 GTGGGGGGACGGAGAGCATAGGG + Intergenic
1086188030 11:84042890-84042912 GTGCAGGGAGGGAGAGCAACAGG + Intronic
1086619346 11:88866413-88866435 GTCTAGGGATGGATAGCATTAGG + Intronic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1087454865 11:98372151-98372173 GGTTAGGGATGGGGAGCTGATGG + Intergenic
1087968251 11:104446779-104446801 GTGTGGGGAGGGAGAGCATCAGG - Intergenic
1088406476 11:109485405-109485427 ATGTTGGGATAGAGAGTAGAAGG + Intergenic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1089017772 11:115181119-115181141 GTCTAGGCATGGAGAGGAGGCGG - Intronic
1089371159 11:117959152-117959174 GAGTTGGGAAGGAGTGCAGATGG + Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1091038605 11:132256027-132256049 GTGCAGGGATAGAGAAGAGAAGG - Intronic
1091305093 11:134531588-134531610 CTGTAGGGAAGGAAACCAGAGGG - Intergenic
1091816415 12:3442398-3442420 GTGTAGGGAGGCAGAGAAAAGGG + Intronic
1093210776 12:16305898-16305920 GTGTAGGGAGAGAGAGCATCAGG - Intergenic
1093705592 12:22271776-22271798 GTGGAGGGATGCAGAGAACAAGG - Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094203555 12:27817321-27817343 GGGGAGGGGAGGAGAGCAGAGGG - Intergenic
1094489522 12:30950224-30950246 GTGGAGGGAGTGAGAGCTGAAGG - Intronic
1094567123 12:31609882-31609904 GTGCAGGGGGTGAGAGCAGAGGG - Intergenic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1094693629 12:32794871-32794893 GAGTGGGGCTGCAGAGCAGAAGG + Intronic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096186862 12:49587247-49587269 GTGTAGGGAGGGAGAGATGAGGG - Intronic
1096255738 12:50061124-50061146 GAGTAGGCATGGAGAGCAAAGGG - Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1096863809 12:54549526-54549548 GAGAAGGGAGGGAGAGCAGAGGG + Exonic
1096911592 12:54989739-54989761 GGGTAGGGAAGGAGAGGGGAGGG - Intergenic
1098448337 12:70590737-70590759 GGGTAGGGAAGGAGAGAGGATGG - Intronic
1098797052 12:74902918-74902940 GTGCAGGGATGCAGATGAGAGGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100169963 12:91963313-91963335 GTGTCAGAATGGAGAGCAGGAGG - Intergenic
1100689247 12:97021983-97022005 ATGGAGGGAGGGAGAGAAGAAGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101409642 12:104457695-104457717 GCGTCGGGATGGGGAGGAGAAGG + Intronic
1102004539 12:109580893-109580915 GTGGAGGGAGGGAGGGCAGGCGG + Intronic
1102547161 12:113665443-113665465 GTGTATGGATAGAGTGGAGACGG - Intergenic
1103012401 12:117467138-117467160 GAGTAGGGAGGGAGAGGTGACGG + Exonic
1104034841 12:125091163-125091185 AGGGAGGGATGGGGAGCAGAGGG + Intronic
1104134392 12:125923499-125923521 GTGAAGGGAGGGAGAGGAGAAGG + Intergenic
1105852776 13:24350396-24350418 ATGTAGGGCTGGAGAGTTGATGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1109016737 13:57025389-57025411 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1109113698 13:58354548-58354570 GTGAGGGGAGGGAGAGCATAAGG - Intergenic
1110303934 13:73962574-73962596 GTGTAGGGATGAGGGGTAGATGG + Intronic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1111930044 13:94503386-94503408 GGGAAGGGAAGGAGAGGAGAGGG + Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112076653 13:95921203-95921225 GTGTGGGGAGGGAGAGCATCAGG + Intronic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112441137 13:99426004-99426026 GTGTAGGGATCCAGGCCAGAGGG - Intergenic
1112708425 13:102099109-102099131 GAGAAGGGATGGGGAGCAGGAGG - Intronic
1112900491 13:104352266-104352288 GGCCAGGGATGGGGAGCAGAAGG - Intergenic
1112995338 13:105567925-105567947 GTGTAGTGAGGGAGAACAAAGGG - Intergenic
1113042134 13:106115945-106115967 GTGTGGGGAGGGAGAGCATTAGG - Intergenic
1113112118 13:106834453-106834475 GTGTAGGTGTGGACTGCAGAAGG + Intergenic
1113310500 13:109127377-109127399 GTGCAGCGAAGGAGACCAGATGG - Exonic
1113455718 13:110447267-110447289 GTGTCGGGCTGGCAAGCAGAGGG - Intronic
1113963792 13:114140275-114140297 GGGCAGGGCAGGAGAGCAGAGGG + Intergenic
1115128739 14:30027244-30027266 GTGCAGGGAGGGAGAGCATCAGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1117987086 14:61397143-61397165 ATGTAGGGGTGGAGAGGAGGGGG + Intronic
1118322513 14:64761573-64761595 AGGTAGGGATGCAGGGCAGAAGG + Intronic
1118854274 14:69609429-69609451 GTGGAGGGATGGAGAGCATTTGG + Intergenic
1119730109 14:76946100-76946122 GTGTGGGGAGGGAGAGCATCAGG - Intergenic
1120993292 14:90397201-90397223 GCGAAGGGAGGAAGAGCAGAGGG - Exonic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121405274 14:93715902-93715924 GAGGTGGGTTGGAGAGCAGATGG + Intergenic
1121963898 14:98286824-98286846 GTGTAGGGAGGGAGAGGATCAGG + Intergenic
1122022002 14:98845792-98845814 GTCTAGGAAAGGACAGCAGAGGG + Intergenic
1122140948 14:99662747-99662769 GTGGAAGGATGGAGGGAAGAAGG + Intronic
1122170891 14:99874300-99874322 GTGTGCGGACAGAGAGCAGAAGG + Intronic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122811077 14:104288285-104288307 GAGTAGGGATGAAGAGCAAATGG - Intergenic
1122958302 14:105083041-105083063 GTGGAGGGGTGGAGAGAGGAGGG - Intergenic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1124342610 15:28899991-28900013 GTGGAGGGTCGGAGAGCAGGAGG + Intronic
1124626850 15:31312568-31312590 GTGGGTGGAGGGAGAGCAGAAGG + Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125953518 15:43774113-43774135 GTGTATGGATGGTTAGCAGGGGG + Intronic
1126176625 15:45741937-45741959 GTGTGGGGAGGGAGAGCATCAGG + Intergenic
1126379709 15:48033689-48033711 GTGTAGGGGTGGGGAGTATATGG + Intergenic
1126427066 15:48539176-48539198 ACGTAGTGATGGGGAGCAGATGG - Intronic
1127262350 15:57335557-57335579 AAGCAGGGCTGGAGAGCAGAGGG - Intergenic
1127461594 15:59204246-59204268 GCGCAGGGATGGAGAGCAGAGGG + Intronic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1128880495 15:71237781-71237803 GTGTAGGGAGGGAGACTGGATGG + Intronic
1129327591 15:74809369-74809391 GGGTAGGGAGGGAGAGCAGCTGG + Intergenic
1129327670 15:74809706-74809728 GTGAAGGGAGGAGGAGCAGATGG + Intergenic
1129652179 15:77498831-77498853 GTGGAGAGATGGAGATCCGAAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129804734 15:78446309-78446331 GTGGAGGGTTGGTGAGCACATGG - Intronic
1129884700 15:79030158-79030180 GTGGAGGGAGGGACAGCACAGGG - Intronic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130288106 15:82572109-82572131 GTTTGGGGGTGGAGAGCAGGGGG - Intronic
1130321770 15:82848153-82848175 GGGAAGGGAAGGAGAGCAGGAGG + Intronic
1130423142 15:83768392-83768414 ATGGAGGGAGGGAGAGAAGAAGG + Intronic
1131031153 15:89186933-89186955 GTGTCTGGAAGGAGAGCAGAGGG + Intronic
1131174627 15:90201886-90201908 GCGGAGGGAGGGAGAGGAGAGGG + Intronic
1131245599 15:90789495-90789517 TTCTAGTGATGGAGAGCAGGTGG - Intronic
1131319026 15:91368454-91368476 GGGTAGGGTTGCAGAGCAAAGGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1133434415 16:5766811-5766833 GGGGAGGGATAGAGAGCAGAGGG - Intergenic
1133449176 16:5889223-5889245 GTGTGGGGAGGGAGAGCATCAGG - Intergenic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1134112521 16:11524198-11524220 GTGGATGGATGGATAGGAGAGGG - Intergenic
1134112540 16:11524266-11524288 GTGGATGGATGGATAGGAGAGGG - Intergenic
1134187127 16:12093267-12093289 GTGTTGGGATGGAAAGAACATGG + Intronic
1134607123 16:15580056-15580078 GTGTGGGGAGGGAGAGCATCAGG - Intronic
1134633746 16:15776819-15776841 GTGGCAGGAGGGAGAGCAGAGGG + Intronic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1137281036 16:46976899-46976921 GGGTTGGGATGGAGAGGAGGTGG + Intergenic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138299862 16:55916993-55917015 GTGGAAGGAGGAAGAGCAGAAGG - Intronic
1138498400 16:57423071-57423093 GGGAAGGGATGGAGAGAGGAAGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138536817 16:57664524-57664546 GTGGTGGGATGGAAACCAGACGG - Exonic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1139004306 16:62551650-62551672 GTGAAGGGAAGGGGAGAAGAAGG - Intergenic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1139376716 16:66503284-66503306 GGGTAGGGAGACAGAGCAGAGGG - Intronic
1140092913 16:71852014-71852036 GTGTTGTGATGGGGAGCAGCAGG + Exonic
1141363924 16:83424854-83424876 GTGTAGGGCTGTAGAACAAAGGG - Intronic
1141519846 16:84571472-84571494 GTGCAAGGGTGGAGAGCAGTGGG - Intronic
1141641935 16:85346578-85346600 GTGGAGTGATGGTGGGCAGATGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142251459 16:88993800-88993822 GAGGAGGGAGGGAGAGAAGAAGG - Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142945455 17:3422709-3422731 TTTTAGGGATGAACAGCAGAGGG - Intergenic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144465529 17:15493771-15493793 GAGGAGGGAGGGAGAGAAGAGGG - Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144824580 17:18098601-18098623 GTGTTGGGGAGGAGAGCACAGGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145104041 17:20100157-20100179 GAATCGGGAAGGAGAGCAGAAGG - Intronic
1145279614 17:21457942-21457964 GTGCAGGGATGGTGGGCAGCAGG + Intergenic
1146500182 17:33357275-33357297 GTTTAGCGAGGGAGAGAAGAAGG + Intronic
1146937915 17:36824058-36824080 GTGCAGGGATGGAGGGCAGGTGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147426135 17:40346739-40346761 GTGTTGGAGTGAAGAGCAGACGG + Intronic
1147580417 17:41624539-41624561 GAGAAGGGCTGGAGAGGAGAGGG + Exonic
1148380536 17:47193654-47193676 GTGTAGGGTGGGTGAGAAGAAGG - Intergenic
1148974670 17:51516566-51516588 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1149443096 17:56691418-56691440 GGCTAGGGAAGGAGAGCAAAGGG + Intergenic
1150436214 17:65156358-65156380 GTGCAGGGAAGGAAAGCAGCTGG - Intronic
1151108596 17:71648780-71648802 GTGAAGGGAGGGAGAGCACCAGG + Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1151418250 17:73980881-73980903 TTGTAGGGAGGGAGAGCAACTGG + Intergenic
1151675455 17:75595145-75595167 GTGCAGGGATGGAGAGGTAAAGG + Intergenic
1151871927 17:76842271-76842293 GGGTAGGGGTGGAGAGCTGGGGG - Intergenic
1151973868 17:77473157-77473179 GCTCAGGGATGGAGAGCAGCTGG + Intronic
1152046591 17:77940663-77940685 GGGTAGGGATAAAGAGCAAAGGG + Intergenic
1152615399 17:81335667-81335689 GGGTAGGAAGGGAGAGGAGAAGG - Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1155045632 18:22100666-22100688 GTGTGGAGATGGACACCAGAGGG + Intergenic
1155172177 18:23275163-23275185 GTGCAGGGAGGGGCAGCAGAGGG + Intronic
1155420005 18:25645560-25645582 GTGGAGGGATGGGGAGAGGATGG + Intergenic
1155437341 18:25827001-25827023 GTGCTGGGATGGAGAGCGCAGGG + Intergenic
1156076784 18:33288363-33288385 GAGGAGGGGAGGAGAGCAGAAGG - Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156865369 18:41883459-41883481 GAGTGGGGATGGAAAGCGGAAGG + Intergenic
1157534736 18:48449958-48449980 ATGGAGGGATGGAGTGCAGGGGG - Intergenic
1157862534 18:51153909-51153931 GTGGAGGCATGGTGAGCAGCTGG - Intergenic
1158321656 18:56270535-56270557 GAGGAGGGGAGGAGAGCAGAGGG + Intergenic
1158830873 18:61277306-61277328 GTGAGGGGAAGTAGAGCAGAGGG + Intergenic
1160126243 18:76175054-76175076 GTAGAGGGATGGAGGGTAGAGGG - Intergenic
1160178301 18:76613499-76613521 GTGGAGGGAGGTAGAGCAGAAGG + Intergenic
1160181005 18:76636180-76636202 GTGTATCGAAGGAGAGGAGAGGG + Intergenic
1160555741 18:79723805-79723827 GTGCAGGGAGGGACAGCAGGTGG - Intronic
1160702741 19:516139-516161 CTGCAGGGAGGGAGACCAGAGGG + Intronic
1161026659 19:2040197-2040219 GGGCAGGGCTGGAGAGCAGCTGG + Intronic
1161329203 19:3678369-3678391 ATGGAGGGATGGAGAATAGATGG + Intronic
1161449051 19:4334499-4334521 GTGGATGGATGGTGGGCAGATGG - Intronic
1161698306 19:5782418-5782440 GTGAAGGGGTGGGGAGCACACGG - Intergenic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1162028472 19:7907263-7907285 GTGTTGGGAGAGAGAGTAGATGG + Intronic
1162311573 19:9910873-9910895 GTGAATGGATGGAGAGAAAATGG + Intronic
1162526473 19:11209569-11209591 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526497 19:11209665-11209687 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526504 19:11209697-11209719 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526545 19:11209840-11209862 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526704 19:11210511-11210533 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526724 19:11210575-11210597 GTGAAGGGATGGACAGGTGAGGG - Intronic
1162526729 19:11210591-11210613 GTGAAGGGATGGACAGGTGAAGG - Intronic
1163171668 19:15535699-15535721 GTGGATGGATGAATAGCAGATGG - Intronic
1163627331 19:18397640-18397662 GTGTCTGGGTGGAGTGCAGAGGG + Intergenic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164779122 19:30878577-30878599 GCATAGGGACGGGGAGCAGAAGG - Intergenic
1164800015 19:31068555-31068577 GTGATGGGATGGAGAGTTGAAGG + Intergenic
1165183055 19:33989429-33989451 GGGAAGGGATGAAGAGAAGATGG - Intergenic
1165214365 19:34259292-34259314 GTGTAGGGATAGAAAGCAAATGG - Intronic
1165712118 19:38019298-38019320 TGCTAGGGATGGTGAGCAGAAGG - Intronic
1165793518 19:38506020-38506042 GGGAAGGGATGGAGAGGAGAGGG + Intronic
1166128244 19:40729436-40729458 GGGCAGGGATGGAGGGCAGGGGG + Intronic
1166173377 19:41048194-41048216 TTGGAGGGATGGTGAGCAGAGGG - Intergenic
1166305266 19:41933984-41934006 GTGGAGGGGTGGGGGGCAGAGGG + Intergenic
1166409418 19:42546822-42546844 GGGAAGGGATGGAGAGGGGAGGG + Intronic
1166588740 19:43975543-43975565 GTGGAGGGAGGGAGAGCATCAGG + Intronic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167717262 19:51151676-51151698 GTGTAGGGAAGGTGAGCAGCTGG + Intronic
1167767481 19:51493210-51493232 GTGTAGGGAAGGTGAGCAGCTGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
1168490902 19:56808155-56808177 GGGCAGGGATGGTGATCAGAAGG + Intronic
925194448 2:1911960-1911982 GAGAAGGCATGGAGAGCAGCCGG + Intronic
925462554 2:4075854-4075876 GGGAAGGGAAGGAGAGGAGAAGG - Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926981965 2:18582427-18582449 GTGTGGGGAGAGAGAGCAGCCGG + Intronic
927272472 2:21227487-21227509 GTGAAGGGTTGGAGAGGAAATGG - Intergenic
928475442 2:31622102-31622124 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929460633 2:42100401-42100423 GTTTAGGGGTGCAGGGCAGATGG + Intergenic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929968242 2:46551455-46551477 GTGTAGGGAGGAACGGCAGAGGG + Intronic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
930602297 2:53456596-53456618 GTGTAGGGTTGTAGGGCAGGTGG + Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931829754 2:66038536-66038558 GTGTGAGGATGAAGAGCAGCAGG - Intergenic
931940637 2:67248050-67248072 TTGAAGGGATGTAGAACAGATGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932377752 2:71253082-71253104 GTATAGGTAAGGAGAGGAGAGGG + Intergenic
934106352 2:88698589-88698611 GGGTAGGGAGGTAGAGGAGAGGG + Intronic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934561996 2:95318182-95318204 GCCCAGGGAGGGAGAGCAGATGG + Intronic
935109167 2:100076126-100076148 GGGTATGGATGCAGAGCAGCTGG + Intronic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935998333 2:108798690-108798712 GTGTAGGCGTGGAGAGGAGGAGG - Intronic
935998343 2:108798798-108798820 GTGTAGGTGTGGAGAGGAGGAGG - Intronic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
936945812 2:117929786-117929808 GTGCAGGAATGGGGAGCGGAGGG - Intronic
937065701 2:119015518-119015540 GTGTGGGGAGGGAGAGCACTGGG - Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937222642 2:120350618-120350640 GGGGAGGGAGGGAGAGAAGAGGG + Exonic
937259691 2:120577430-120577452 ATTTAGGGATGGTGAGTAGAAGG - Intergenic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
938994952 2:136668425-136668447 GTGTAGTGATAGAGCACAGATGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941639216 2:167969505-167969527 GTGTAGGGGTAGAGAGCTGGAGG - Intronic
941976998 2:171416257-171416279 GTGTAGAGATGACCAGCAGAGGG - Intronic
942100641 2:172579352-172579374 TTGGAGGGAGGGGGAGCAGATGG + Intronic
942349295 2:175036216-175036238 GAGGAGGGAAGGAGAGAAGATGG + Intergenic
942814794 2:180039829-180039851 GCCTTGGGCTGGAGAGCAGATGG - Intergenic
943507996 2:188786034-188786056 GAGTAGGGATGGCGAGTAGTGGG - Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
944562732 2:200957016-200957038 GTGGAGGGAGGGAGAGCATAAGG + Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946981401 2:225220085-225220107 GTGGAGGGAGGGAGAGCACTAGG - Intergenic
947534385 2:230931763-230931785 GTGGAAGGAAGGGGAGCAGAGGG - Intronic
947908960 2:233789408-233789430 GTGTAGGGAAGGAGGACAGTGGG + Intronic
948228595 2:236333300-236333322 GTGTAGCGATGGATGGCAGCCGG + Intronic
948545377 2:238724903-238724925 GTGTAGGCAGGAAGAGCAGCAGG + Intergenic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
1168958205 20:1849330-1849352 GAATAAGGAGGGAGAGCAGAGGG - Intergenic
1169178740 20:3543140-3543162 ATGAAGGGAAAGAGAGCAGAGGG - Intronic
1169265160 20:4162978-4163000 TTGTATGCCTGGAGAGCAGAGGG + Intronic
1169860035 20:10141528-10141550 GTTTAGGGATGGAGGGCCGAAGG - Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1170613762 20:17933555-17933577 GGGAGGGGATGGAGAGCAAAGGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1172113955 20:32562969-32562991 GTGGAGGGGTGGAGAGTGGAGGG + Intronic
1172650687 20:36499708-36499730 GCGGAGGGAGGGAGAGGAGAGGG - Intronic
1173373927 20:42465911-42465933 GTGTGGGGAGGGAGAGCATCAGG - Intronic
1173820830 20:46019266-46019288 GTGTGGGGATGGGGTGCAGCAGG + Intergenic
1175199659 20:57268277-57268299 GTGAATGGATGAAGAGCAGGTGG - Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1175434391 20:58932956-58932978 GAGTAGGGAGGGAGAGCATTAGG + Intergenic
1175458641 20:59134206-59134228 TGGTAGGGAGGGAGAGCAGGAGG - Intergenic
1175787387 20:61720493-61720515 GTGCAGGGATGCAGAGTGGAGGG + Intronic
1175934732 20:62509551-62509573 GTGGAGGGATGGAGGGTGGAGGG - Intergenic
1175935004 20:62510291-62510313 GTGAAGGGATGGAGACTGGAGGG - Intergenic
1175935041 20:62510398-62510420 GTGCAGGGATGGAGGGTGGAGGG - Intergenic
1175935117 20:62510605-62510627 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935122 20:62510621-62510643 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935130 20:62510644-62510666 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935175 20:62510753-62510775 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1179058365 21:37956481-37956503 GTGTGGGGAGGGAGAGCATCAGG + Intronic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180086050 21:45508370-45508392 GTGGATGGATGGTGGGCAGATGG + Intronic
1181329552 22:22079430-22079452 GTCTAGGCATGGACAGCAGAAGG + Intergenic
1181480752 22:23197831-23197853 GGGGAGGGATGGAGAGGACAAGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1184213947 22:43053911-43053933 GGGGAGGGAGGGAGAGCAAAGGG + Intronic
1184335493 22:43850597-43850619 GATGAGGGAGGGAGAGCAGAGGG - Intronic
1185104457 22:48859323-48859345 GTGGATGGATGGAGGGTAGAAGG - Intergenic
1185110205 22:48896397-48896419 GGGATGGGGTGGAGAGCAGAGGG + Intergenic
1185177426 22:49336074-49336096 GTGCAGTGATGGAGAGCAGCTGG - Intergenic
1185352759 22:50346529-50346551 GTGTAGGGTGGGGGAACAGAAGG - Intronic
949526316 3:4908117-4908139 GTGTTGGGGTGGACAGCAGGTGG + Intergenic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
951191155 3:19773049-19773071 ATGTAGGGAGGGAAAGAAGAAGG + Intergenic
951637274 3:24793530-24793552 GGGCAGGGTTGGAGAGGAGATGG + Intergenic
952218333 3:31300094-31300116 GTGTAAGGAGGAAGAGAAGAAGG - Intergenic
952503125 3:33982934-33982956 GTCTGGGGATGGGGAGCAAAGGG - Intergenic
952713499 3:36454590-36454612 GTTTAAGGATGGAGTGGAGAGGG - Intronic
953108378 3:39908195-39908217 GGGAAGGAAGGGAGAGCAGAGGG + Intronic
953349646 3:42205808-42205830 GGGTATGGAAGGAAAGCAGAGGG + Intronic
953726105 3:45400590-45400612 GTGCTGGGGTGGAGATCAGATGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954330193 3:49885694-49885716 GTGTAGGGAGGAAGAGGAGGAGG + Intergenic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955340157 3:58118994-58119016 GTGCCTGAATGGAGAGCAGATGG + Intronic
955367987 3:58327778-58327800 GTGAAGGGCTGGGGAGGAGATGG - Intergenic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
955779811 3:62472544-62472566 GTGAAGAGGTGCAGAGCAGAGGG + Intronic
956040717 3:65142313-65142335 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956398520 3:68851348-68851370 GTGTAGGGAGGGAGAACATTAGG + Intronic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
958491003 3:94773086-94773108 GTGTAGGGAAAGAGAGAATATGG + Intergenic
958756268 3:98252904-98252926 CCGTAGGGAGGGAGAGCATAAGG + Intergenic
959428661 3:106224203-106224225 GTGGGGGGATGGAGAGCATCAGG + Intergenic
960473837 3:118099639-118099661 GTGTAAAGTTGGAGAGCAGGAGG + Intergenic
960785929 3:121372674-121372696 GGGAAGGCATTGAGAGCAGATGG - Intronic
960966732 3:123110828-123110850 GGGTAGGGATGGGGAGGGGAGGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961675926 3:128566629-128566651 GGATAGGGAAGGTGAGCAGATGG - Intergenic
964434732 3:156639664-156639686 CTGTAGGGAATGAGATCAGAGGG - Intergenic
965466035 3:169031739-169031761 ATGCAGGGATGCAGAGCAGCAGG - Intergenic
965725635 3:171712298-171712320 TTCTAGGGATGGAGACGAGAGGG + Intronic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
965985502 3:174748166-174748188 GTGGAGGGAGGGAGAGCATTAGG + Intronic
966131004 3:176639781-176639803 GTGCAGGGAGGGAGAGCATCAGG - Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
968107869 3:196015126-196015148 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968627623 4:1634308-1634330 GGGCAGGGATGGAGCTCAGAGGG - Intronic
968631979 4:1656525-1656547 GTGTAGGCAGGGAGAGCGGCCGG + Intronic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
970479319 4:16457714-16457736 GGGGAGGGAAGGAGAGGAGAGGG - Intergenic
970642971 4:18088126-18088148 GTGAAGGAATGGAGAGCATCAGG + Intergenic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
971088820 4:23315193-23315215 GTGCAGGGAAGGAGAGCATCAGG + Intergenic
971348535 4:25835176-25835198 GTGTAAGGATGGGTAGCAGAAGG - Exonic
971645801 4:29200856-29200878 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
972461020 4:39302418-39302440 TTGTAGGGATGGGGAGCAACAGG - Intronic
975110373 4:70616850-70616872 GAGGAGGGATGGAGAGTAGTAGG + Intergenic
975358651 4:73440194-73440216 GTGCAGGGAGGGAGAGCATTAGG - Intronic
975621342 4:76299884-76299906 GTGCAGGGATGGAGAACAGCAGG + Intronic
975674848 4:76816407-76816429 GTGCAGGGAAGGAGAGCACCAGG + Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976275419 4:83271833-83271855 GTGTAGGGGAGGGGAGCAGTGGG + Intronic
976391826 4:84513548-84513570 GTTTAGGGTAGGAGAACAGAGGG + Intergenic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977049845 4:92116097-92116119 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
977289034 4:95143471-95143493 GGGTAGGGAAGGGGAGCAAAGGG - Intronic
978596069 4:110378976-110378998 GGGAAGGCATTGAGAGCAGATGG + Intronic
978619292 4:110622776-110622798 GGGGAGGGAGGGAGAGAAGAAGG - Exonic
978684619 4:111424528-111424550 TTGCAGGGATGGAGAACAGGTGG - Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
979429109 4:120605438-120605460 GGGAAGGGAAGGAGAGAAGAAGG + Intergenic
980866657 4:138561087-138561109 GTTTAGGCTTGGAGGGCAGATGG - Intergenic
981312920 4:143314228-143314250 GTGTGGGGATGGAAAGCAACAGG + Intergenic
982190214 4:152846203-152846225 GAGTAGGGAGGGAGAGAAGGGGG + Intronic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
982916308 4:161213960-161213982 GTGTAGGGAAGTAGATAAGAAGG + Intergenic
983144464 4:164196802-164196824 GTGGAGGGAGGGAGGGCAGGAGG - Intronic
983275063 4:165606947-165606969 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984823355 4:183903849-183903871 GGGTAGGGTTGGAGAGCAGAAGG + Intronic
985211821 4:187603962-187603984 GGGGAGGGAAGGAGAGGAGAGGG - Intergenic
985390350 4:189486002-189486024 GTGAAGGGAGGGAGAGCATTAGG + Intergenic
985469805 5:33193-33215 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
985641305 5:1064660-1064682 GTGAAGGGATAGCGAGGAGACGG + Intronic
985937198 5:3106432-3106454 GGGAGGGGAGGGAGAGCAGAGGG - Intergenic
985999113 5:3616323-3616345 GTCTACGAATGGAGAGAAGAAGG + Intergenic
986152447 5:5140167-5140189 GTGCAGGGACAAAGAGCAGAGGG - Intergenic
986381107 5:7186981-7187003 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
986994145 5:13586928-13586950 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
987104399 5:14623177-14623199 GCAAAGGGATGGAGAGCATAAGG + Intergenic
987429871 5:17819756-17819778 GTTTAGGGATGGGGAGAAGCAGG - Intergenic
987431115 5:17834540-17834562 GTGTAGGGATGGGGAGGCAAGGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988581114 5:32469645-32469667 TTGTATGGGTGGAGAGCAGGAGG + Intergenic
989082496 5:37638167-37638189 GTATAGGGATACAGATCAGATGG - Intronic
989234785 5:39134093-39134115 GTTTAGTGATAGAGAGCAGTAGG + Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990080716 5:51910359-51910381 GCATAGGGAAGGAGAGCAAAAGG + Intergenic
992611143 5:78509731-78509753 ATGGAGGGATGGAGAGCTGCCGG - Intronic
992965409 5:81994525-81994547 GTGGAGGGTAGGGGAGCAGAAGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993354734 5:86892047-86892069 GTGTAGAGATGGAGTGTATAGGG - Intergenic
994028917 5:95118029-95118051 GTGGAGGGAGGGAGAGCATTAGG + Intronic
994096942 5:95855948-95855970 GTTCAGGGAAGGAGGGCAGAGGG - Intronic
994567222 5:101465605-101465627 GTGGAGGGAGGGGGAGCAGTGGG - Intergenic
994784048 5:104132867-104132889 GGGAAGGCATTGAGAGCAGATGG - Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995835203 5:116394010-116394032 GTGAAGGGATGAATAGAAGAAGG + Intronic
996117116 5:119631293-119631315 GAGTAGGCATGGAGAGCAGGGGG + Intronic
997517337 5:134499895-134499917 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
997906561 5:137822979-137823001 GTAGAGGGAGGGAGAGCAGCTGG - Intergenic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
999323139 5:150626923-150626945 GACTAGGGGTGGAGAGAAGATGG - Intronic
999383902 5:151140885-151140907 GAGCGGGGCTGGAGAGCAGAGGG - Intronic
1001019464 5:168170718-168170740 GTGGAGGAACAGAGAGCAGACGG - Intronic
1001095750 5:168774236-168774258 GTGTCTGGATGGACTGCAGAGGG + Exonic
1001313000 5:170624678-170624700 GTGGAGGGGAGGAGAGGAGAGGG + Intronic
1001795042 5:174495048-174495070 GGGGAGGGAGGGAGAGCAGAAGG - Intergenic
1001996960 5:176169743-176169765 GGGAAGGGAGGGAGAGCAGGGGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002587190 5:180256598-180256620 GGGTGGGGATGGTGAGCAGGAGG + Intronic
1003302464 6:4896525-4896547 GAGGAGGGAAGGAGAGCAGGAGG + Intronic
1004328808 6:14702270-14702292 GTGTAAGGAGAGAGAGGAGAGGG + Intergenic
1004479017 6:16001160-16001182 GTGTAGGGGTGGAGAAGAAAAGG - Intergenic
1005698819 6:28379000-28379022 ATTTAGGGATGTACAGCAGAGGG + Exonic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1006224027 6:32521492-32521514 GTTTAGGGGAGGAGAGCTGAGGG - Intronic
1006575886 6:35045513-35045535 GTGTAGGGGTGGAAAGAACAAGG - Intronic
1006627803 6:35409972-35409994 GAGCAGGGAGAGAGAGCAGAAGG + Intronic
1007049847 6:38816214-38816236 GTGAAGGGAGGGAGAGCATCAGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007472222 6:42098472-42098494 GTGCGGGGAGGGAGAGCAGCAGG + Intergenic
1007669679 6:43541076-43541098 GTGTAAGGATGGTTAGCAGAGGG + Intronic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010128738 6:72466315-72466337 GTGTAGGGAGAGTGAGTAGAGGG + Intergenic
1011992651 6:93542287-93542309 GTGCAGGGAGGGAGAGCATCAGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013629037 6:111967342-111967364 GTGAAGGATGGGAGAGCAGACGG - Intergenic
1013665770 6:112346767-112346789 GTGTCTGTATCGAGAGCAGAAGG - Intergenic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1014731656 6:125038969-125038991 GTGGAGGGAGGGAGAGCATTAGG - Intronic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1015863196 6:137701855-137701877 GAGTTGGGATGAAAAGCAGAGGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016251213 6:142045235-142045257 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1016624757 6:146153644-146153666 GTGCAGGGAGGGAGAGCATCTGG + Intronic
1017032786 6:150238687-150238709 GTGCTGAGATGCAGAGCAGAAGG - Intronic
1017356379 6:153514174-153514196 GTGGGGGGCTGGAGAGCAGGTGG - Intergenic
1017832177 6:158140507-158140529 GGAGAGGGATGGACAGCAGATGG - Intronic
1018441921 6:163821424-163821446 GTTGAGGGAGGGAGAGGAGATGG + Intergenic
1019268641 7:133745-133767 GTGGTGGGCTGGACAGCAGAAGG + Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019606448 7:1912579-1912601 GTGCAGGGATGGGGAGCACAGGG - Intronic
1019908578 7:4083592-4083614 GAGAAGGGAGGGAGAGAAGAAGG - Intronic
1020525801 7:9256855-9256877 GTGAAGGGAGGGAGAGCATTAGG + Intergenic
1020815817 7:12904190-12904212 GTGCAGGGAAGGAGAGCATCAGG + Intergenic
1021172095 7:17411363-17411385 GGGTAGGGAGGGAGAGCATTAGG + Intergenic
1021286556 7:18788006-18788028 AGGGAGGGATGGAGAGCTGAAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021792554 7:24220038-24220060 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1021980985 7:26055433-26055455 GGGTAGGGAAAGAAAGCAGAAGG + Intergenic
1022365838 7:29715132-29715154 GTGTGGGGAGGGAGAGCATCAGG + Intergenic
1022519400 7:30996291-30996313 GTGTAGGGAGGAAGAGGAGGAGG - Intergenic
1022580260 7:31545880-31545902 GGATAGGGAGGGAGAGCAGAAGG + Intronic
1024994273 7:55260264-55260286 GTGAAGGGAGGAAGAGCAGAAGG + Intergenic
1026198810 7:68196251-68196273 GCGATGGGATGGAGAGCAGCAGG - Intergenic
1026239708 7:68562301-68562323 GAGCAGGGCTGGAGAGCACACGG - Intergenic
1026699403 7:72626732-72626754 GACTAGGGCTGGAGAGCAGTGGG - Intronic
1029148765 7:98465498-98465520 GCAAAGGGATGGAGAGAAGAGGG - Intergenic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032662695 7:134003297-134003319 GAGTAGGGATTGACTGCAGAGGG + Intronic
1032998881 7:137480937-137480959 AGGTAGGGATGGAGAACAGAAGG - Intronic
1033654333 7:143362730-143362752 GGGGAGGGATGGAGAGGGGAGGG - Exonic
1034487570 7:151375591-151375613 AGGAAGGGATGGAGAGCAGGTGG - Intronic
1035142781 7:156780810-156780832 GGGTAGGGGTGGAAAGCACAGGG - Intronic
1035241620 7:157534292-157534314 GAGTAGGGAGGGAGAGGAAAGGG - Intergenic
1036117383 8:5972779-5972801 GTGGATGGATGGTGAGGAGATGG - Intergenic
1036703810 8:11031627-11031649 GGGAAGGAATGGAGAGCAAATGG + Intronic
1037481315 8:19308351-19308373 GTCTCTTGATGGAGAGCAGATGG - Intergenic
1037587304 8:20286910-20286932 GTGTCAGGATGGGGAGCAGCAGG + Intronic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038419290 8:27422148-27422170 GAGCAGGGATGGAGAGCACGAGG - Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039431042 8:37525249-37525271 GGGTAGGGATGCAGAGAAGCTGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040996592 8:53408663-53408685 GTGTAAGGGTGGAGAGCAGGAGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041609908 8:59833491-59833513 GAGTAGGGAGGGAGAGGAGGAGG + Intergenic
1041625464 8:60020910-60020932 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1041779660 8:61563854-61563876 TGGAAGGGATGGGGAGCAGATGG - Intronic
1041930180 8:63277795-63277817 GTGGAGGCATGAAAAGCAGAAGG - Intergenic
1043252288 8:78089741-78089763 GAGTAGGAGTGAAGAGCAGAGGG - Intergenic
1044289110 8:90446948-90446970 GTGGAGGGAGGGAGAGGAGAAGG - Intergenic
1044413347 8:91909622-91909644 GGGTAGGGGTGGAGAGCCCAAGG + Intergenic
1045252648 8:100494471-100494493 GTGCAGGGATGGAGAATACAGGG + Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1045703875 8:104897669-104897691 GTGGAGGGAGGGAGAGCATTAGG + Intronic
1046145256 8:110150009-110150031 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1046256070 8:111697439-111697461 GTGTAGAGTTGGGGAGAAGAGGG + Intergenic
1046307897 8:112394499-112394521 GTTTAGAGAGGCAGAGCAGAGGG - Intronic
1046323226 8:112605617-112605639 GTGAAGGGTGGGAGGGCAGAGGG + Intronic
1046773792 8:118142440-118142462 TGGTAGGGATGGACAGGAGAAGG - Intergenic
1047309826 8:123682731-123682753 GGGTAGGGATGGGGTGCACAGGG + Intronic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048726594 8:137392572-137392594 GTGTAGGGAGAGAGAGTATATGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049364296 8:142229267-142229289 GTGGATGGATGGATGGCAGATGG + Intronic
1049609881 8:143549985-143550007 GGGGAGGGGAGGAGAGCAGAGGG - Intergenic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1050033756 9:1413684-1413706 GTGTAGGGCTGGAGACGAAATGG + Intergenic
1050811844 9:9758402-9758424 GGGTAGGGATGGGTAGGAGAAGG + Intronic
1051251122 9:15159871-15159893 GTTTAGGGATTGACAGCAAAGGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051968340 9:22857153-22857175 GTGGAAGAATGGAGAGAAGAGGG - Intergenic
1052490076 9:29154795-29154817 TTGTAGGGAAGAGGAGCAGAGGG + Intergenic
1053435995 9:38074959-38074981 GTGGAGGGTGGAAGAGCAGAAGG + Intergenic
1054703260 9:68435425-68435447 GCTTAGGGATGGAGAGGTGATGG - Intronic
1055379863 9:75694569-75694591 AGGTAGGGATGGAGAGCATGAGG - Intergenic
1055893045 9:81143481-81143503 GTGTCTGGATGGAGAAGAGATGG + Intergenic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056084642 9:83134173-83134195 GAGTAGGGAGGGAGAGAAGAGGG - Intergenic
1056554195 9:87675652-87675674 GGGTCAGGATGGGGAGCAGAGGG + Intronic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1056897272 9:90562697-90562719 GAGAAGGGAGGGAGAGAAGAAGG - Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1058375191 9:104314797-104314819 GTGTTGGGGTGGATAGTAGAGGG - Intergenic
1058592936 9:106584580-106584602 GTGCAGGGATGAGGGGCAGATGG + Intergenic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058929814 9:109708050-109708072 GTGGAGGGAGGGAGAGGAGTGGG - Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1060054702 9:120403458-120403480 GTGCAGGGAGGGAGAGAACAGGG + Intronic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1061724962 9:132577252-132577274 GGGGAGGGATGGAGAGAGGAAGG + Intergenic
1062201301 9:135304239-135304261 GTGGATGGATGGATGGCAGATGG + Intergenic
1062201380 9:135304575-135304597 GTGGAGGGATGGAGGGCTGATGG + Intergenic
1062281298 9:135752963-135752985 GTGGATGGATGATGAGCAGATGG + Intronic
1062480348 9:136748127-136748149 GTGTAGGGTTGGAGAACTGGAGG - Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1186868654 X:13747561-13747583 GTGAAGGGAAGCAGAGGAGAGGG + Intronic
1187286365 X:17907978-17908000 GAGTAGGGAGGGAGAGCATCAGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187584668 X:20646875-20646897 GTGGGGGGATGGAGAGCATCAGG + Intergenic
1188977611 X:36694006-36694028 TTGTAGGCATAGAGAGCAAAAGG + Intergenic
1189187341 X:39065578-39065600 GTGGAGGGAGGGGGAGCAGAGGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1190915685 X:54809512-54809534 GTGGAGGGAGGGAGAGAAGGTGG + Intronic
1191741893 X:64445150-64445172 GTAGAGGGATGGAGAGGAGAGGG - Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192494904 X:71609667-71609689 GTGTAGGACTGGATACCAGAGGG + Intronic
1192544118 X:71998583-71998605 GTGAAGGGCTGGAGAGAAGGGGG + Intergenic
1192659807 X:73030375-73030397 GGGAAGGCATTGAGAGCAGATGG + Intergenic
1192961291 X:76133778-76133800 GTGAAGGGAGGGAGAGCATCAGG + Intergenic
1192996904 X:76521362-76521384 GGGAAGGCATTGAGAGCAGAGGG - Intergenic
1195216070 X:102704224-102704246 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1195305895 X:103583706-103583728 GGGCAGGGAGGGAGAGCATAAGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1198179896 X:134196392-134196414 GTGTGGGGAGGGAGAGCATCAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199655933 X:149995516-149995538 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1200413971 Y:2889283-2889305 GGGGAGGGGAGGAGAGCAGAGGG - Intronic
1200965440 Y:9031859-9031881 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201292227 Y:12432098-12432120 GTGTGGGGAGGGAGAGCATCAGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1201737185 Y:17280581-17280603 ATGGAGGGAGGGAGAGCATAAGG + Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic
1201862238 Y:18611582-18611604 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201863127 Y:18621406-18621428 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201870196 Y:18698972-18698994 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201871085 Y:18708798-18708820 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1202147664 Y:21816929-21816951 GTGAAGGGAAGCAGAGGAGACGG - Intergenic