ID: 953933245

View in Genome Browser
Species Human (GRCh38)
Location 3:47017619-47017641
Sequence CAAGGTACTCCCCTTGCTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953933245_953933248 8 Left 953933245 3:47017619-47017641 CCAAAAGCAAGGGGAGTACCTTG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 953933248 3:47017650-47017672 ATGTTTAAAGTCTTCAGTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953933245 Original CRISPR CAAGGTACTCCCCTTGCTTT TGG (reversed) Exonic
901942713 1:12675957-12675979 AAATGCACTCACCTTGCTTTTGG + Intergenic
905814810 1:40941265-40941287 CAAGGTACTAGCTTTGGTTTGGG - Intergenic
906247031 1:44283547-44283569 CTACGCACTCCCCTGGCTTTGGG - Intronic
911735985 1:101337142-101337164 CCAGTTACTCCCATTGATTTGGG - Intergenic
913199496 1:116484410-116484432 AAAGCTGCTCCCTTTGCTTTCGG - Intergenic
917538437 1:175891375-175891397 GAAGGTATGCTCCTTGCTTTAGG - Intergenic
922248086 1:223819847-223819869 CAAGGCACTCCCCTTGAGCTGGG + Intronic
923462200 1:234217084-234217106 CAAGGTGGTCCCCATGCTGTGGG + Intronic
1065766770 10:29037632-29037654 CATTATACTCCCCTCGCTTTTGG - Intergenic
1067932484 10:50576506-50576528 TATGGGACTCCCCCTGCTTTTGG - Intronic
1068557925 10:58479914-58479936 CAAAGTAATTCCCTTTCTTTAGG - Intergenic
1070799610 10:79237528-79237550 CAAGGTTCTCTCCTCGCTTCTGG + Intronic
1074140716 10:110669855-110669877 AAAGGTACTCTACTGGCTTTTGG + Intronic
1075157672 10:119991674-119991696 CAAAATACACCCCTTGCTTTGGG - Intergenic
1075571841 10:123551932-123551954 CAAGGTACCCCACTTCCTGTAGG + Intergenic
1077640278 11:3875187-3875209 CAAGATACTAACCTTGCATTTGG + Intronic
1079973083 11:27059795-27059817 CCCTGTACTCCCCTTTCTTTTGG + Intronic
1081742007 11:45447485-45447507 CAAGCTCTTCCCCTTGCTGTGGG - Intergenic
1082111649 11:48283320-48283342 ATAGCTACTCCACTTGCTTTTGG + Intergenic
1082148761 11:48705251-48705273 CAAGGTACTCCCATATATTTGGG + Intergenic
1084600152 11:70140607-70140629 CACGGTCCTCCTCTTACTTTGGG - Intronic
1087364849 11:97205372-97205394 CAAGCAACCCCCATTGCTTTTGG + Intergenic
1087893030 11:103556555-103556577 CAAGGGACTCCCCTAACTCTGGG + Intergenic
1088616277 11:111632353-111632375 TCAGGGACTTCCCTTGCTTTTGG + Intronic
1091741595 12:2963641-2963663 GACGGTTCTTCCCTTGCTTTTGG + Intronic
1095869180 12:47007217-47007239 CAAGGTCTTCCTCTTGCTTTGGG - Intergenic
1100892854 12:99145434-99145456 CTAGGTGCTCCCCTTGCTCCAGG - Intronic
1102488936 12:113277187-113277209 CAGGCTACTCCCCTTCCCTTGGG - Intronic
1102556444 12:113729780-113729802 CCACCTACTCCCATTGCTTTTGG - Intergenic
1105016613 12:132789598-132789620 ACAGGTAATCCCCTTGCTTGTGG + Intronic
1106883781 13:34160365-34160387 CAAGGAAGTACCCCTGCTTTTGG - Intergenic
1107957332 13:45528253-45528275 CACGTTACTCCTCTTACTTTTGG + Intronic
1109862032 13:68212361-68212383 CAAAGTAATTCCCTTGCTTCAGG + Intergenic
1111963082 13:94833165-94833187 CATGCCTCTCCCCTTGCTTTTGG - Intergenic
1116557639 14:46333063-46333085 TAAGGCACTCCACTTGATTTTGG - Intergenic
1118298986 14:64597776-64597798 CAAAATACACACCTTGCTTTAGG + Intergenic
1118386170 14:65257257-65257279 CAAGTGACTCCCCTGCCTTTGGG - Intergenic
1119866264 14:77977795-77977817 CAAGGTTCTGCCCATTCTTTTGG - Intergenic
1120093195 14:80357952-80357974 CAAGGCACTTCACTTGTTTTTGG + Intronic
1121285971 14:92736123-92736145 CATGGTCCTCCTCTTGCTTTTGG - Intronic
1122505072 14:102226994-102227016 GATGGTCCTCCTCTTGCTTTAGG + Intronic
1122505555 14:102229627-102229649 GACGGTCCTCCTCTTGCTTTAGG + Exonic
1202910219 14_GL000194v1_random:109938-109960 CATGTTACTCCCATTGTTTTGGG - Intergenic
1202882382 14_KI270722v1_random:72769-72791 CAGGGCACTCCCATTGTTTTGGG + Intergenic
1202882392 14_KI270722v1_random:72839-72861 CAAGACACTCCCATTGTTTTGGG + Intergenic
1124098157 15:26668708-26668730 CAATTTACTCCCCTTGATTAGGG - Intronic
1127151665 15:56082083-56082105 CATGTTCCTCCTCTTGCTTTTGG - Intergenic
1128444385 15:67744059-67744081 CAATCTACTCACTTTGCTTTAGG - Intronic
1133957266 16:10455400-10455422 CAAGGTACTGGCCTTCCTTCTGG - Intronic
1135223769 16:20637726-20637748 CAGGGTATTCCCCTGGCTGTGGG + Intronic
1140541367 16:75759360-75759382 GAAGGTGCTCCTCTTTCTTTGGG + Intronic
1140608470 16:76569748-76569770 CAAGAAACTGCCCTTTCTTTTGG - Intronic
1142822388 17:2480548-2480570 CAAGGAACTCCGATTCCTTTGGG - Intronic
1142956140 17:3524050-3524072 CCATGCACTCCCTTTGCTTTCGG - Intronic
1149051577 17:52311112-52311134 CATAGTACTCCCCTGGATTTGGG - Intergenic
1150979560 17:70126008-70126030 CATGTTCCTCCTCTTGCTTTTGG - Intronic
1151653978 17:75486861-75486883 CAAGCCACTCCCCTCCCTTTTGG - Intronic
1155026634 18:21946557-21946579 CAGGGTAGTCCCCTCACTTTTGG + Intergenic
1155350204 18:24898805-24898827 CATGCTTCTCCTCTTGCTTTTGG + Intergenic
1156369435 18:36459447-36459469 CAAGGTACTCCCCTCACCTAAGG - Intronic
1158513664 18:58113505-58113527 CAAGCTCCTCCCCTTCCTTTAGG - Intronic
1158572603 18:58609727-58609749 GAAAGTCCTCCCCTTGTTTTTGG + Intronic
1162034882 19:7933406-7933428 CAAGGTGATCCCCCTGCATTGGG - Intronic
1163027270 19:14519483-14519505 CCAGATCCTCACCTTGCTTTAGG - Intronic
1202631574 1_KI270706v1_random:4697-4719 CAAGTCACTCCCATTGTTTTAGG + Intergenic
1202631628 1_KI270706v1_random:5082-5104 CAAGTCACTCCCATTGTTTTAGG + Intergenic
926368966 2:12161484-12161506 CAAGGCAGTCCCCTCCCTTTGGG - Intergenic
930410367 2:51017610-51017632 TAAGGTAATCCCAGTGCTTTGGG - Intronic
932660025 2:73643771-73643793 CAATGTCCTCCCCTTGCTCTTGG - Intergenic
932666595 2:73703428-73703450 CAATGTCCTCCCCTTGCTCTTGG - Intergenic
935707767 2:105871354-105871376 CAAGGTGCTCCGCACGCTTTGGG + Intronic
946359058 2:219208049-219208071 CCAAGTCCTCCACTTGCTTTTGG + Intronic
946525978 2:220520833-220520855 CAAAGTCCTCCCCTTGCTGGAGG + Intergenic
1169519410 20:6354995-6355017 TAAGGTAGTCTCCTTGGTTTAGG + Intergenic
1170521985 20:17195934-17195956 CAAGGTAACCCCCCTGGTTTCGG + Intergenic
1170715945 20:18830776-18830798 CAAAGTCCCCACCTTGCTTTGGG - Intergenic
1173268094 20:41505344-41505366 TGAGGAAATCCCCTTGCTTTGGG + Intronic
1176597944 21:8764594-8764616 CAAGTCACTCCCATTGTTTTGGG + Intergenic
1176629572 21:9124638-9124660 CATGTTACTCCCATTGTTTTGGG - Intergenic
1176643861 21:9331096-9331118 CAAGTCACTCCCATTGTTTTGGG + Intergenic
1177112356 21:17043712-17043734 AAAAGTACTCAGCTTGCTTTCGG + Intergenic
1180008720 21:45035395-45035417 CAAGCTGCTGCCCTTGCTGTGGG + Intergenic
1180369082 22:11968129-11968151 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1180369118 22:11968373-11968395 CAAGTCACTCCCATTGTTTTAGG - Intergenic
1180369176 22:11968793-11968815 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1180420513 22:12810314-12810336 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1180420547 22:12810561-12810583 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1184548119 22:45187093-45187115 CAAAATACACACCTTGCTTTAGG - Exonic
949893551 3:8752439-8752461 CAAGGTAATCCCCTTCTCTTAGG + Exonic
951436260 3:22668617-22668639 CAAGGTCCACCCATTGCTTTTGG + Intergenic
952609591 3:35192173-35192195 CAATGTCCTCCCCATGCTATTGG + Intergenic
953933245 3:47017619-47017641 CAAGGTACTCCCCTTGCTTTTGG - Exonic
957095952 3:75777661-75777683 CAAGTCACTCCCATTGTTTTGGG - Intronic
957096088 3:75778608-75778630 CAAGTCACTCCCATTGTTTTTGG - Intronic
957096300 3:75779972-75779994 CAAGTCACTCCCATTGTTTTGGG - Intronic
957096310 3:75780041-75780063 CACGTCACTCCCATTGCTTTGGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
1202743027 3_GL000221v1_random:73970-73992 CAAGTCACTCCCATTGTTTTGGG - Intergenic
969945933 4:10783163-10783185 CAAGGTATTCACCTGGCTTCTGG - Intergenic
970299990 4:14671108-14671130 CACAGTATTCCCATTGCTTTGGG + Intergenic
970515491 4:16825413-16825435 CAAGGTACCCTGCTTGCCTTGGG - Intronic
973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG + Intronic
973361228 4:49166702-49166724 CAAGTCACTCCCATTGTTTTGGG + Intergenic
973361262 4:49166949-49166971 CAAGTCACTCCCATTGTTTTGGG + Intergenic
975816774 4:78225261-78225283 CAAGATACTTACCTTGCTTATGG + Intronic
978582665 4:110247879-110247901 ACAGGTAATCCCCATGCTTTGGG - Intergenic
979282590 4:118884449-118884471 CAAGGAAATCTCCTTGATTTTGG + Intronic
981110992 4:140933255-140933277 CAAAGTTCTTCCCATGCTTTAGG - Intronic
984096759 4:175444408-175444430 CACGTTTCTCCCCTTACTTTTGG - Intergenic
1202758606 4_GL000008v2_random:88465-88487 CAAGTCACTCCCATTGTTTTGGG + Intergenic
985769103 5:1797856-1797878 CAAGGAGCTCCCCTTGCTAGAGG - Intergenic
989621672 5:43390470-43390492 AGAGGTGCTCCCTTTGCTTTGGG + Intronic
991916736 5:71613001-71613023 CCAGGTATTCCCCTGGCTTATGG + Intronic
996064510 5:119066674-119066696 CAGCATACTCCCCTTGATTTAGG + Intronic
1001654274 5:173337360-173337382 CAAGCTTTTCCCCCTGCTTTAGG + Intergenic
1005876525 6:30014098-30014120 CAAGGTACTCAACCTGCTCTGGG + Intergenic
1007714800 6:43849565-43849587 CAACTTCCTCCCCTTGCTCTGGG + Intergenic
1015336006 6:132039691-132039713 CAAGGTACTTCCCTTTATGTCGG + Intergenic
1017164538 6:151395123-151395145 CAAGGAACTCCCTATGCTTTAGG + Intergenic
1027930816 7:84532459-84532481 GAAAGTACTCCTCTTGCTTGAGG - Intergenic
1028903280 7:96124912-96124934 CAAAGTCCTCCCCTTGCTGGAGG - Intronic
1031670252 7:124533998-124534020 ATAGGAACTCCCCTTGCCTTAGG - Intergenic
1032794622 7:135267851-135267873 CAAGATCCTCCCTTTCCTTTAGG + Intergenic
1036112036 8:5914138-5914160 CAAGGTACTATCCTTGGTGTTGG - Intergenic
1037695625 8:21221528-21221550 CAAGGTTCTCCCCTGGCACTTGG - Intergenic
1040417491 8:47207995-47208017 CATGTTCCTCCTCTTGCTTTTGG - Intergenic
1044018053 8:87070737-87070759 AAAGGTAATTACCTTGCTTTTGG + Intronic
1044694094 8:94905607-94905629 CAAGGTACTCCTCTGTCTCTTGG + Intronic
1050277375 9:4013950-4013972 AAAGGCACTCCCCTGTCTTTGGG - Intronic
1051133148 9:13885416-13885438 CAAGATGCTCCCTTTGCCTTTGG - Intergenic
1055514351 9:77020907-77020929 CAAGGAGCCGCCCTTGCTTTCGG - Exonic
1059654985 9:116349437-116349459 CAAGATACAGCCCTTGCCTTAGG + Intronic
1060839464 9:126782363-126782385 CAAGGGAATCCTCTGGCTTTGGG - Intergenic
1061700089 9:132409445-132409467 CCATGTAATCCCATTGCTTTGGG - Intergenic
1203690389 Un_GL000214v1:36636-36658 CAAGTCACTCCCATTGTTTTGGG + Intergenic
1203752409 Un_GL000218v1:92317-92339 CATGTTACTCCCATTGTTTTGGG - Intergenic
1203711661 Un_KI270742v1:103896-103918 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1203539399 Un_KI270743v1:73373-73395 CAAGTCACTCCCATTGTTTTGGG + Intergenic
1203555314 Un_KI270743v1:202519-202541 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1203555348 Un_KI270743v1:202766-202788 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1203555391 Un_KI270743v1:203046-203068 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1203645906 Un_KI270751v1:67555-67577 CAAGTCACTCCCATTGTTTTGGG - Intergenic
1186887182 X:13925574-13925596 TAAGGTAATCCCAGTGCTTTGGG - Intronic
1188405612 X:29805479-29805501 AAAAGCACTCCACTTGCTTTGGG + Intronic
1189526195 X:41824609-41824631 CAAGGTACTCTCCTTGTTACTGG + Intronic
1195685114 X:107578323-107578345 CCAAGTATTCCCCTTGCTCTGGG + Intronic
1195910001 X:109879519-109879541 GAAGGTGCTCACCTTTCTTTCGG - Intergenic
1196167828 X:112555037-112555059 GAAGGAAGTCACCTTGCTTTTGG - Intergenic
1197164846 X:123365785-123365807 GAATGTAATCACCTTGCTTTGGG + Intronic
1197772004 X:130095092-130095114 CAAGTTGCTCCCCCTGCTTCGGG + Intronic
1199596371 X:149509437-149509459 AAAGGGAGTCCCCTTGCTCTTGG + Intronic
1201166068 Y:11209963-11209985 CATGTTACTCCCATTGTTTTGGG - Intergenic