ID: 953934458

View in Genome Browser
Species Human (GRCh38)
Location 3:47028188-47028210
Sequence CTCATTTTGTCCCTTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953934458_953934460 -1 Left 953934458 3:47028188-47028210 CCTGAGACAAGGGACAAAATGAG 0: 1
1: 0
2: 1
3: 16
4: 322
Right 953934460 3:47028210-47028232 GGTAAGCCCTATGATTACCTTGG 0: 1
1: 0
2: 2
3: 8
4: 77
953934458_953934463 12 Left 953934458 3:47028188-47028210 CCTGAGACAAGGGACAAAATGAG 0: 1
1: 0
2: 1
3: 16
4: 322
Right 953934463 3:47028223-47028245 ATTACCTTGGCTTTTCTGCGTGG 0: 1
1: 0
2: 0
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953934458 Original CRISPR CTCATTTTGTCCCTTGTCTC AGG (reversed) Intronic
902260509 1:15221499-15221521 CTCTTTGTGTCTCATGTCTCTGG + Intergenic
904025844 1:27503245-27503267 ATCATTTTTTCTCTTGCCTCTGG - Intergenic
904595569 1:31642816-31642838 CTCATTTTAGCCCTTTTCACAGG + Intronic
904969234 1:34406059-34406081 CCCATTTTTTCCCTTGCCTGAGG - Intergenic
907984206 1:59514842-59514864 CTCCTTTTCTTCCTTGTCTCGGG + Intronic
909066371 1:70939866-70939888 GACATTTTCTCCATTGTCTCGGG + Intronic
909160780 1:72147218-72147240 CTCATTTTGTTCCCAGTTTCGGG - Intronic
909211039 1:72824049-72824071 CATAATGTGTCCCTTGTCTCTGG - Intergenic
910581937 1:88838035-88838057 GACATTTAGTCCCTTTTCTCTGG - Intergenic
911308584 1:96263443-96263465 CTTATTTTGTCCATTGTTTTAGG - Intergenic
912135596 1:106656974-106656996 CTCTTTTTTTCCCCAGTCTCAGG - Intergenic
919162531 1:193850091-193850113 CACATTTTTGCCCTTGTTTCTGG + Intergenic
920033495 1:203051031-203051053 CTCACTGTGTCCCTTCACTCTGG + Intronic
920089754 1:203443910-203443932 CTCATTTTGTCCTAAGCCTCAGG + Intergenic
920491746 1:206421192-206421214 CTCTTTTTCTCCCTTGTTGCTGG + Intronic
920869446 1:209781895-209781917 CCCATTTTGTCACCTGTCTTGGG - Exonic
921990991 1:221366757-221366779 CTAATTTTGTCCCTCATCACTGG - Intergenic
922232088 1:223696359-223696381 CACATTTTCTCCCTCCTCTCAGG + Intergenic
922871576 1:228906366-228906388 CTCACTTTGTCCCTGTCCTCTGG - Intergenic
923303175 1:232662279-232662301 CTCATTTGGTCCCTTTCTTCTGG + Intergenic
923389841 1:233503144-233503166 TTCAAATTGTCCCTTGTCACAGG - Intergenic
923687257 1:236161855-236161877 CTCTTTTTCTTCCTAGTCTCGGG + Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1066556732 10:36622670-36622692 CTCATTTTGTTCAGTGTGTCTGG - Intergenic
1067524703 10:47031255-47031277 CTCACTTTGACCCTTGTATTTGG - Intergenic
1068265973 10:54650608-54650630 CTCATATTTTACCTAGTCTCAGG - Intronic
1069816624 10:71200142-71200164 CTCATTTGTTCCCATATCTCAGG - Intergenic
1071439110 10:85674842-85674864 CTCACTATGTCCTTTATCTCAGG + Intronic
1072488140 10:95875660-95875682 CTCTTTTTGTTCCCAGTCTCAGG - Exonic
1073737512 10:106366671-106366693 CTTATTTTGCCCCTTGACACAGG - Intergenic
1073930704 10:108571217-108571239 CTCATTTTATTCCTTGTCTAGGG - Intergenic
1075303991 10:121351231-121351253 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1075509112 10:123055171-123055193 CTCTTTTTCTTCCTGGTCTCAGG - Exonic
1075543790 10:123338211-123338233 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1075588972 10:123677778-123677800 CTCATGCTGTCCCTTCTCCCTGG - Intronic
1076680242 10:132167989-132168011 CCCATTTTGTCCCTGCTTTCTGG - Exonic
1077064638 11:635593-635615 CTCATTGTTTCCATTGTTTCTGG + Intergenic
1077780770 11:5327046-5327068 CTCCTTTACTCCCTTGTATCTGG - Intronic
1078498677 11:11846461-11846483 TTCATTTTTTCCATTTTCTCTGG - Intronic
1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG + Intronic
1081077525 11:38695509-38695531 CTCTTTTTGTTCCTAGTTTCGGG - Intergenic
1082070329 11:47934422-47934444 CTCATTTTATTCCTTTTCTGAGG - Intergenic
1082900150 11:58239900-58239922 CTCATGTTCTTCCTTGTTTCTGG + Intergenic
1089164657 11:116466274-116466296 ATTAGTTTGTTCCTTGTCTCTGG + Intergenic
1089229621 11:116960937-116960959 CTCAATTTGTCCCTTGAATAAGG - Intronic
1090998351 11:131886968-131886990 CTCATTTTACACCTTGTCTAAGG + Intronic
1091682361 12:2536212-2536234 CTCATTTTCTCTCTTCTCTGGGG - Intronic
1092793831 12:12091689-12091711 CTCATTCTGTCCCATCTCCCAGG - Intronic
1093785639 12:23189023-23189045 CTGATTTTGTCACCTTTCTCAGG - Intergenic
1093906511 12:24699236-24699258 CTCTTTTTTTCCCTTGTATTAGG + Intergenic
1094457010 12:30646425-30646447 CTCATCTTGTTCCTGGTCTTAGG - Intronic
1094860473 12:34460654-34460676 CTCTTTTTGTCCATTCTCTGAGG - Intergenic
1095039340 12:37424103-37424125 CTCTTTTTGTCCCTGGACACAGG + Intergenic
1095211557 12:39500744-39500766 CACATTTTGACCCTTGACTCGGG + Intergenic
1095693110 12:45113443-45113465 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1097049095 12:56210233-56210255 CTCATTTATGCCCCTGTCTCTGG - Intronic
1099407781 12:82284477-82284499 CTCTTTTTGTTCCCTGTTTCAGG + Intronic
1102148878 12:110674784-110674806 CTCTTTTTCTTCCCTGTCTCAGG + Intronic
1102591881 12:113962457-113962479 CCCATTTTGTCCCCTTGCTCTGG - Intronic
1102732547 12:115125738-115125760 CTCATTTGCTCCCTTATTTCTGG + Intergenic
1103329591 12:120144835-120144857 CTCATTCTGTCCTTTGTTGCAGG - Exonic
1106749188 13:32741131-32741153 CTCACTTTGACCATTGTCTCAGG - Exonic
1107064074 13:36193662-36193684 CTCATTTTTTCCATTGTCAGTGG + Exonic
1107528062 13:41253515-41253537 CTCATTTTGAGCCTTATCTTGGG - Intronic
1108299379 13:49058997-49059019 CTCACTTTGTACCTTACCTCTGG - Intronic
1108459238 13:50648559-50648581 CTCATTTTCTCTCTTGCCACCGG + Intronic
1108773500 13:53734310-53734332 CTCATTTTGTCCTCTGTATCTGG + Intergenic
1108935843 13:55879075-55879097 CTTTTGTTTTCCCTTGTCTCTGG + Intergenic
1109219054 13:59622691-59622713 CTCCTTTTCTTCCTAGTCTCGGG - Intergenic
1109352349 13:61200593-61200615 CTCAGTTTATCTCTTGTCTAAGG + Intergenic
1109823736 13:67691364-67691386 CTCTTTTTCTTCCTGGTCTCAGG - Intergenic
1111313369 13:86518206-86518228 CTCTTTTTCTCCCCAGTCTCGGG - Intergenic
1112821385 13:103340749-103340771 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1113062691 13:106340394-106340416 CACAATGTGTCCCTTTTCTCTGG - Intergenic
1115192403 14:30759803-30759825 GTAATGTTCTCCCTTGTCTCTGG + Intergenic
1115767034 14:36633509-36633531 CTCATTTTTCCCCTTTCCTCTGG + Intergenic
1116000779 14:39240475-39240497 CTAATTTTGTCCCATGTCCTTGG - Intronic
1119009789 14:70972691-70972713 CTCATTTTGTCACATGATTCAGG + Intronic
1119860636 14:77933548-77933570 CACACTGTGGCCCTTGTCTCAGG + Exonic
1120104780 14:80481161-80481183 CTCTTTTTCTTCCCTGTCTCGGG - Intronic
1121881777 14:97507307-97507329 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1121895629 14:97644508-97644530 CACATTTTGTCCTTTGACACAGG - Intergenic
1121898928 14:97674533-97674555 CTCATGGTGTCCCTTGGCTAGGG - Intergenic
1122295701 14:100704601-100704623 CACATCCTGTCCCTTCTCTCTGG - Intergenic
1124255331 15:28136815-28136837 TTCATTTTGTCCTTTTTCTAGGG - Intronic
1124568984 15:30842805-30842827 TTCATTTTGTCCTTTTTCTAGGG + Intergenic
1124890017 15:33724246-33724268 CTCATTTCTTCCTCTGTCTCTGG + Intronic
1126069019 15:44849545-44849567 CTCTTTTTGTCTGTTGGCTCGGG - Intergenic
1126089799 15:45041228-45041250 CTCTTTTTGTCTGTTGGCTCGGG + Intronic
1126719674 15:51564743-51564765 CTCATTTTATCATTTGTATCAGG - Intronic
1126813032 15:52427773-52427795 TTTATTTTCTCCCTTTTCTCTGG - Intronic
1127362847 15:58260215-58260237 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1127576386 15:60296160-60296182 CTCTTTTTCTTCCCTGTCTCGGG - Intergenic
1127652540 15:61023260-61023282 CTCTTTTTTTCCCCAGTCTCAGG - Intronic
1127955410 15:63848559-63848581 CTCTTTTTCTTCCTAGTCTCGGG + Intergenic
1129241441 15:74254625-74254647 CTGATTTTCTACCCTGTCTCTGG + Intronic
1129469616 15:75743710-75743732 CTCTTTTTCTCCCCAGTCTCAGG + Intergenic
1129738688 15:77979410-77979432 CTCATTTAATCCCTTCTATCAGG - Intergenic
1130614253 15:85389391-85389413 CTCATTTGTTCCCTTCTCTTTGG + Intronic
1131483520 15:92801766-92801788 GTCCTTTTCTGCCTTGTCTCTGG + Intronic
1132113267 15:99117611-99117633 CTTATTTTGTGCCTTGCCTTTGG + Intronic
1133299999 16:4776589-4776611 CTGATTTTGTCACTTGGGTCTGG + Intergenic
1134835142 16:17355004-17355026 CTCATTTGGTTCCCTGTCTTTGG - Intronic
1138681861 16:58689656-58689678 CTTGTTTTGTTCCTTGTTTCAGG + Intergenic
1138743196 16:59334226-59334248 CTCAGTTTGACCCTTGACTTAGG + Intergenic
1138801471 16:60035672-60035694 CTCACTTTCCCCTTTGTCTCTGG - Intergenic
1140482331 16:75268206-75268228 CTATTTTTGTCCCTGGCCTCTGG + Intergenic
1140857035 16:78987320-78987342 ATCTTTTTGTACCTTGTATCGGG + Intronic
1141165566 16:81658615-81658637 CACATTTTGTTTCTTCTCTCTGG - Intronic
1144354015 17:14427131-14427153 ATCATTGTCTCCCTTGTGTCTGG + Intergenic
1144925525 17:18804116-18804138 ATTATTTTTTCCCTTGTCCCAGG + Exonic
1145378549 17:22374408-22374430 CTCTTTTTGTCCCTGGACACTGG - Intergenic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1146583193 17:34058416-34058438 CTCATTTGTTCTCTTATCTCTGG + Intronic
1148784730 17:50140523-50140545 CTCATTTTCTCCCCTGTGGCAGG - Intronic
1149110070 17:53018362-53018384 CTCTTTTTCTCCCCAGTCTCAGG - Intergenic
1149414916 17:56449106-56449128 TTCACTCTGTCCCTTGTGTCTGG - Exonic
1152272425 17:79332462-79332484 CTCTTTTTGTTCATTGACTCAGG - Intronic
1152481247 17:80554859-80554881 GTTATCTTGTCACTTGTCTCAGG - Intronic
1153012106 18:548562-548584 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1153552733 18:6279148-6279170 CTCATTTTGCACTTTTTCTCTGG - Intronic
1153931448 18:9883198-9883220 CTCACTTTGTCCATAGTGTCTGG + Intergenic
1155008013 18:21746665-21746687 TTCATTTTCTCCATTATCTCTGG - Intronic
1156673436 18:39498778-39498800 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1162084780 19:8241965-8241987 CTCATTTCCTCCCTTCCCTCAGG + Intronic
1164727855 19:30478755-30478777 CACATTTTGTCCCTTGGCCTTGG - Intronic
1166319473 19:42007443-42007465 CTCATTTTGTTTCTCTTCTCAGG - Intronic
1167466802 19:49654465-49654487 CTTCTTTTGTCCATTGCCTCGGG + Intronic
1167990454 19:53356598-53356620 TTCCTTTTGTCTCTTTTCTCAGG + Intergenic
925279516 2:2672967-2672989 CTGATTTTGTTCTTTGTCGCTGG + Intergenic
925469380 2:4142674-4142696 CTCATTTTGTTCCCTGTGCCTGG + Intergenic
925537506 2:4933268-4933290 CTCTTTTTGTTCCCAGTCTCAGG + Intergenic
925770760 2:7281005-7281027 CTCATTTTTGCCCATGTGTCAGG + Intergenic
925805742 2:7646027-7646049 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
927409104 2:22805150-22805172 CTCTTTTTCTTCCTTGTCTTGGG - Intergenic
927635763 2:24815338-24815360 CTCATTCTTCCCCTTGGCTCCGG - Intronic
927712551 2:25334636-25334658 CTAACTTTGTCCCCTGTCCCTGG + Intronic
929876289 2:45799718-45799740 CTCCTGTTGTCCCTAGTCTGCGG + Intronic
931344397 2:61432895-61432917 CTTATTTTCACCCTTGTTTCTGG - Intronic
931484852 2:62680347-62680369 CTCACTTTCTCCTTTGCCTCTGG - Intronic
932912406 2:75819259-75819281 CTCTTTTTCTCCCCAGTCTCAGG - Intergenic
934587766 2:95518610-95518632 CTTATTGGGTCCCTTGGCTCAGG + Intergenic
934880511 2:97972780-97972802 CTCCTTATGTGCCTTCTCTCTGG - Intronic
935619859 2:105119464-105119486 TTCATTATGTCCCTTGGCTGTGG + Intergenic
936972541 2:118188892-118188914 CTCATTTGCTCCCTTGGTTCAGG + Intergenic
937681992 2:124654072-124654094 CTCATCCTGTCCCTTCACTCAGG - Intronic
938099340 2:128487576-128487598 GTCCTTTTCTCCCTTCTCTCTGG - Intergenic
939325462 2:140682801-140682823 GCCATTCTGTCTCTTGTCTCAGG - Intronic
940027490 2:149223998-149224020 CTCATTTTATCCCTCCTCCCAGG + Intergenic
940064121 2:149607693-149607715 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
943072320 2:183154846-183154868 CTCTTTTTCTTCCCTGTCTCAGG - Intronic
943116855 2:183683504-183683526 CTCTTTTTCTTCCTGGTCTCAGG - Intergenic
943196409 2:184756883-184756905 CTCATTTTCCCAGTTGTCTCTGG - Intronic
944892287 2:204129899-204129921 TACATTTTTTTCCTTGTCTCAGG + Intergenic
946574123 2:221056331-221056353 CTCTTTTTCTCCCCAGTCTCGGG - Intergenic
947514451 2:230789880-230789902 CTCATTTGTTTCCTTCTCTCAGG + Intronic
948183926 2:236004157-236004179 CTCATTTTGTCTCCTGACTGTGG + Intronic
1169409134 20:5352325-5352347 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1169670087 20:8089813-8089835 CTCATTCTTTCCTTGGTCTCGGG + Intergenic
1170018571 20:11810630-11810652 CTCCTTTTTTCCTTTGTCACTGG + Intergenic
1170450678 20:16480216-16480238 TTCTTTTTGTCCCTTGTTTCTGG - Intronic
1171083617 20:22214637-22214659 CTCATTTGGTCCTTATTCTCAGG - Intergenic
1171220122 20:23388955-23388977 CTCATTCTGTGGGTTGTCTCTGG - Intronic
1171525253 20:25804070-25804092 CTCTTTTTCTTCCCTGTCTCGGG + Intronic
1171551574 20:26051814-26051836 CTCTTTTTCTTCCCTGTCTCGGG - Intergenic
1171573435 20:26275963-26275985 CTCATTTTCTTCCCTGTCTCAGG - Intergenic
1171792696 20:29543113-29543135 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
1171806619 20:29687063-29687085 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
1171837428 20:30169448-30169470 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1171855773 20:30341289-30341311 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1174399529 20:50268471-50268493 TCCATTTTCTCCCCTGTCTCAGG + Intergenic
1174928958 20:54792997-54793019 AACATTTTATCTCTTGTCTCTGG + Intergenic
1175615088 20:60391025-60391047 CTCACTTTGTCCACTCTCTCTGG - Intergenic
1177117401 21:17102863-17102885 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1177286823 21:19062365-19062387 CTCATTCTGTACCTTTTCTTAGG - Intergenic
1177989992 21:28025920-28025942 CTCATTTTCTCCCATATCACTGG + Intergenic
1178061371 21:28856709-28856731 CTCATTGTATCCCTTGGCTAGGG - Intergenic
1178708565 21:34894370-34894392 CTCATTTTTGCCCTTGTTTTTGG - Intronic
1179038801 21:37783546-37783568 CTCTTTTTCTTCCTAGTCTCGGG + Intronic
1180573265 22:16749149-16749171 CTCTTTTTGTCCCTGGACACAGG + Intergenic
1180573822 22:16753646-16753668 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1181473197 22:23153324-23153346 CTCATTTTGGTCATTGGCTCTGG + Intronic
1181795159 22:25302911-25302933 CTCACTTTCTGCCTGGTCTCAGG + Intergenic
1181835702 22:25606431-25606453 CTCACTTTCTGCCTGGTCTCAGG + Intronic
951089710 3:18558115-18558137 TTCATTTTATTCCTTGACTCTGG + Intergenic
951359059 3:21703120-21703142 CTCTTTTTCTTCCTGGTCTCTGG - Intronic
952739595 3:36722816-36722838 CTCCTTTTTTTCCTGGTCTCAGG + Intronic
953875596 3:46664905-46664927 GTCACTTTGTCCCTTGACTGTGG - Intergenic
953934458 3:47028188-47028210 CTCATTTTGTCCCTTGTCTCAGG - Intronic
954591732 3:51788954-51788976 CTCTTTTTGTTCCTAGTTTCGGG + Intergenic
954827631 3:53388882-53388904 CTCATTTTGTTCCCTTTCTTTGG - Intergenic
955130208 3:56158419-56158441 CTTATTTAGTTCCTTCTCTCTGG + Intronic
959053120 3:101543102-101543124 CTCCTTTTGTTGCTTTTCTCAGG - Intergenic
960743183 3:120857135-120857157 TTCATCTTGTCTTTTGTCTCGGG + Intergenic
961805905 3:129489135-129489157 CTCATTTTGTCCATATTCCCGGG + Intronic
962978127 3:140463886-140463908 CTCAGCTTCTCCCTTCTCTCAGG - Intronic
963716565 3:148810770-148810792 CTCTTTTTGTTCCTAGTTTCAGG + Intronic
963861474 3:150314886-150314908 TTCATATTGTCCCTTATCACTGG + Intergenic
964427565 3:156569304-156569326 CTCTTTTTTTTCCTAGTCTCGGG + Intergenic
964553049 3:157906378-157906400 TTCATTTTGACTCTGGTCTCTGG - Intergenic
968749961 4:2383472-2383494 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
969623931 4:8293035-8293057 CTCATGTTGTGCCTTCTCCCTGG - Intronic
969898840 4:10329818-10329840 CTCATTCTGTCTCTTCTCCCTGG + Intergenic
970023625 4:11596715-11596737 CTCATTTTGTACCTTATTTCTGG + Intergenic
970179566 4:13376322-13376344 CTCATTTTGTCTCTTTTGTTGGG - Intronic
970338994 4:15085274-15085296 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
970343526 4:15131023-15131045 CTGATCTTTCCCCTTGTCTCTGG - Intergenic
970548013 4:17149180-17149202 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
971021723 4:22543777-22543799 CACATTTTCTCCCTTGTATGTGG + Intergenic
973056266 4:45663150-45663172 CTCAGTTTGGCCCTGGTCCCAGG + Intergenic
974136591 4:57825927-57825949 CTAATTCTGTCCCTTGACACTGG + Intergenic
974212794 4:58803357-58803379 CTCCTTTTTTCCCCAGTCTCAGG - Intergenic
974632326 4:64509559-64509581 CACATTTTCTCACTTTTCTCTGG - Intergenic
974753399 4:66171231-66171253 CTCTTTTTGTTCCTAGTTTCGGG - Intergenic
975186402 4:71409109-71409131 CTCATTTTCTTCCTAGTCTTGGG + Intronic
975387099 4:73770377-73770399 CTCACTTTGGCCATGGTCTCGGG - Intergenic
977101389 4:92820132-92820154 CTCATTAATTCCCATGTCTCAGG - Intronic
978005986 4:103617151-103617173 CTCATTTTGTTTCTTGACTATGG - Intronic
978376880 4:108083390-108083412 TACTTTTTATCCCTTGTCTCCGG - Exonic
979569197 4:122197006-122197028 CTCATTTTCTCCTTTATATCTGG + Intronic
980016823 4:127659365-127659387 TTCATTTTGTCTCTTCTCTCTGG - Intronic
980512409 4:133812031-133812053 CTCATTGTCTCCCTTGGCTGGGG - Intergenic
982647423 4:158041632-158041654 CTTATTTTGTTCCATTTCTCAGG - Intergenic
982924721 4:161321094-161321116 TTCCTTTTGTCCCTTTTGTCAGG + Intergenic
982962998 4:161864174-161864196 ATCATTTTGTGGCTTCTCTCAGG - Intronic
983258930 4:165433901-165433923 CTCATTTTGTACCTGTTCTTTGG + Intronic
983459284 4:168006864-168006886 TTCCTTTTGTCTCTTTTCTCAGG + Intergenic
984900785 4:184584602-184584624 CTCTTTTTGTCCCTGGACACAGG - Intergenic
984922675 4:184779421-184779443 CTCTTTTTGTTCCCAGTCTCAGG + Intronic
985224557 4:187746155-187746177 CTCATTTTCTCCCTTTTTCCTGG + Intergenic
985898268 5:2763581-2763603 CTGAGGTTGTCCCTTGCCTCCGG - Intergenic
986113770 5:4749593-4749615 CTCATTTTCTTCCCAGTCTCAGG - Intergenic
986397395 5:7344178-7344200 CTCTTTTTCTTCCTAGTCTCTGG + Intergenic
988683638 5:33506810-33506832 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
989029996 5:37109139-37109161 CCCATCTTGTCCCATGTCTTGGG - Intronic
989039158 5:37209060-37209082 CGCCTTCTGTCCCTAGTCTCCGG + Intronic
989985602 5:50693384-50693406 CTGATTGTGTCCATTGTCTTAGG + Intronic
990139422 5:52685749-52685771 CAAATTGTGTCCCTTGCCTCAGG + Intergenic
990633546 5:57697162-57697184 TTCATTTTCTCCCTTTTCTATGG - Intergenic
990755856 5:59069014-59069036 CACATTTTGTTCCTTCTCTCTGG - Intronic
990788873 5:59454533-59454555 CTCTTTTTCTCCCCAGTCTCAGG + Intronic
993421078 5:87701326-87701348 CTCACTTTCTCCCTTGGCTGAGG + Intergenic
994292532 5:98045684-98045706 CTAATTTATTCCCTTATCTCAGG - Intergenic
995241429 5:109889142-109889164 CTTAATTTGTCCTTTGTCACAGG + Intergenic
995256688 5:110054842-110054864 CTCTTTTTGTCCCTGGGCTTAGG + Intergenic
995867800 5:116710219-116710241 CTCATTCATTCCCTTCTCTCAGG - Intergenic
995965569 5:117903749-117903771 CTCTTTTTGCCTCTTGTCCCCGG + Intergenic
998654688 5:144164324-144164346 GTCATTTTGTCTCTTGTTTCAGG - Intronic
1001109574 5:168884357-168884379 CTCATTGTGTCCCTAGCCCCCGG - Intronic
1001116449 5:168944738-168944760 CCCAGTTTGTCCATTGTCTATGG + Intronic
1001795660 5:174500009-174500031 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1005134504 6:22552283-22552305 CTCATTTTTTCACTTGTTTGAGG - Intergenic
1005608397 6:27499017-27499039 CTCATTTTTTCCCTTTTCCCAGG - Intergenic
1008446438 6:51597884-51597906 CTCTTTTTCTCCCCAGTCTCAGG - Intergenic
1008971075 6:57368901-57368923 GTCATTTTGTCCCTGGACTCAGG + Intronic
1009160036 6:60270720-60270742 GTCATTTTGTCCCTGGACTCAGG + Intergenic
1009639285 6:66309972-66309994 CGCATTTGGTAACTTGTCTCAGG + Intergenic
1010411727 6:75568683-75568705 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1011240713 6:85268445-85268467 CTAACTTTGACCTTTGTCTCTGG - Intergenic
1011284393 6:85707594-85707616 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1011495972 6:87936952-87936974 CTCTTTTTGTTCCCTGTCTTGGG - Intergenic
1012161168 6:95887729-95887751 CTCTTTTTCTCCCCAGTCTCAGG - Intergenic
1013075988 6:106772281-106772303 TCCATTTTGCCCCTTGGCTCCGG + Intergenic
1013776385 6:113683251-113683273 CTCATTTTGTCATTTTTCTTAGG - Intergenic
1014754875 6:125291934-125291956 GTCAGGTTGTCCCTTGTCTTAGG - Intronic
1015490800 6:133823472-133823494 CTCTTTTTCTTCCTAGTCTCTGG - Intergenic
1018360964 6:163067386-163067408 CTAATTTTCTCCCTTGTATGTGG + Intronic
1019193821 6:170269555-170269577 CTCACTTTGTCTCTTGTGTGGGG + Intergenic
1019317976 7:400046-400068 CTCATTGCTTCCCTTCTCTCTGG + Intergenic
1020678961 7:11213434-11213456 ATCCTTATGTCCCTAGTCTCTGG - Intergenic
1020878525 7:13728706-13728728 CTCTTTTTCTTCCTGGTCTCTGG + Intergenic
1022163045 7:27731241-27731263 CTCTTTTTATCCCTGGTTTCAGG + Intergenic
1022805089 7:33813617-33813639 CTGATTTTGTCCTTTGTTTTTGG + Intergenic
1023307203 7:38842870-38842892 CTCACTTTGCTGCTTGTCTCTGG + Intronic
1023925639 7:44667523-44667545 TTCATTTTTTTCCTTCTCTCTGG + Intronic
1024155873 7:46624601-46624623 CTTATTTTTTCCCTTCCCTCAGG + Intergenic
1025285399 7:57656182-57656204 CTCTTTTTGTCCCTGGACACAGG + Intergenic
1025285936 7:57660677-57660699 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1026532438 7:71211430-71211452 CTCATTTTCTTCCTAGTCTTGGG + Intronic
1027922741 7:84416394-84416416 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1028577056 7:92363794-92363816 GTCATTTTGTCCACTGACTCAGG + Intronic
1029409692 7:100400973-100400995 CTCTTTTTCTCCCTTCTCTGGGG - Exonic
1030401214 7:109052729-109052751 CTCATGTTTTCCCTTCTCTTAGG + Intergenic
1030401241 7:109053184-109053206 CTCATTGTGTCTCTCCTCTCTGG + Intergenic
1031097681 7:117441068-117441090 CTCTTTTTCTGCCCTGTCTCAGG - Intergenic
1033582074 7:142747402-142747424 TTCATTTTGTCCCTTGTCATGGG - Intergenic
1033758054 7:144412159-144412181 CACATTTTATCCCTAGTTTCTGG - Intergenic
1034448413 7:151125085-151125107 CTCATTTGATCCCCTCTCTCCGG + Intronic
1034495243 7:151416972-151416994 CTCATTTTTTCCCGTCTCTTGGG - Intergenic
1034540194 7:151753237-151753259 CACATTTTGTGCCTTGTCTCAGG - Intronic
1035906694 8:3518924-3518946 CTCATATTGTCCCTTTTATTTGG + Intronic
1036053261 8:5224157-5224179 CTGATTCCGTCCTTTGTCTCAGG + Intergenic
1036487713 8:9194697-9194719 CTCCTTTTGTCTCCTGTCTGTGG + Intergenic
1037445640 8:18962986-18963008 CTCTTTTTATCCCCAGTCTCAGG - Intronic
1037935531 8:22912849-22912871 GTCATTTTATCCTTTGTCCCTGG - Intronic
1038708647 8:29920756-29920778 CTCATTTTTTCCCAATTCTCAGG + Intergenic
1038900482 8:31837639-31837661 CTCCTATTCTCCCTAGTCTCTGG + Intronic
1039098420 8:33912940-33912962 CTCATTTGTTCTCTTTTCTCAGG + Intergenic
1039849002 8:41346218-41346240 CTCTTTCTGCCCCTTTTCTCTGG - Intergenic
1042283765 8:67083912-67083934 CTCATTTCTTCCTCTGTCTCAGG + Intronic
1044359750 8:91268701-91268723 GTCATTTTGTTTCTTGTTTCTGG + Intronic
1046066320 8:109201099-109201121 CTCACTTTCTGCCATGTCTCTGG - Intergenic
1046927216 8:119804684-119804706 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1046961248 8:120115413-120115435 CTCTTTTTATCCCATGGCTCTGG - Intronic
1047014413 8:120708415-120708437 CTCTTTTTGTGTCTAGTCTCTGG - Intronic
1047901504 8:129427423-129427445 CTTATTTTGTTCCATTTCTCAGG + Intergenic
1048139673 8:131781977-131781999 CTCATTTTATTCCTTCTGTCTGG - Intergenic
1050103388 9:2141645-2141667 TTCATTTTGCCCCATTTCTCTGG + Intronic
1050103515 9:2142735-2142757 TTCATTTTGCCCCATTTCTCTGG + Intronic
1050208661 9:3227938-3227960 CTCATTTTGCCCAGTGGCTCTGG + Intronic
1050411559 9:5371599-5371621 CTCTTTTTCTCCCCAGTCTCAGG + Intronic
1050825497 9:9940287-9940309 CTCATCTTCTCCCTTACCTCTGG + Intronic
1051382096 9:16469520-16469542 CTCTTTTTGTTCCTAGTCTCTGG + Intronic
1051902790 9:22060693-22060715 CTCTTTTTGTTCCTAGTTTCAGG - Intergenic
1053466315 9:38311287-38311309 CTCATTTTGAAGCTGGTCTCTGG - Intergenic
1053877525 9:42559235-42559257 CTCCTTCTGTCCATTGTTTCTGG + Intergenic
1053895128 9:42735442-42735464 CTCCTTCTGTCCATTGTTTCTGG - Intergenic
1054234169 9:62542487-62542509 CTCCTTCTGTCCATTGTTTCTGG - Intergenic
1055988578 9:82079993-82080015 CTGAGTTTATCTCTTGTCTCTGG - Intergenic
1058015846 9:100031217-100031239 CTCATTTTGTTCTATGTCTTTGG + Intronic
1058153325 9:101486137-101486159 CTCTTTCTGGCCCTTGGCTCCGG - Intronic
1060320537 9:122555331-122555353 CTCCTTCTGTCCCTTCTCTTTGG + Intergenic
1185491238 X:518583-518605 CTGATATTATTCCTTGTCTCTGG - Intergenic
1186266471 X:7839611-7839633 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1190958810 X:55225200-55225222 CTCATTTTTTCCCTCTTCTATGG + Intronic
1191225580 X:58039586-58039608 CCCATTTTTTCCTTTGTCTTTGG - Intergenic
1191720963 X:64228231-64228253 CACTTTTTGTCTCTTGTCACTGG - Intronic
1192309312 X:69996981-69997003 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1192887036 X:75346762-75346784 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1193346867 X:80413731-80413753 CTCATTTTGTTCCCAGTTTCGGG + Intronic
1193422249 X:81295515-81295537 CTCTTTTTCTCCCTCGTCTTGGG + Intronic
1193650724 X:84127898-84127920 CTCATTGTGTTCCAGGTCTCAGG - Intronic
1195112790 X:101664323-101664345 CTCATTTTGTGACTTGTCAAAGG + Intergenic
1196237389 X:113299321-113299343 CTCCTTTTGACCTTTGGCTCAGG - Intergenic
1197573356 X:128177773-128177795 CTCATTGTTTCCCTTGGCTGTGG - Intergenic
1198262024 X:134973519-134973541 CTCATTCTGTCTCTTGCCGCTGG - Intergenic
1198569051 X:137935527-137935549 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1198729751 X:139716752-139716774 CTCAGGTTGTCCTTTGCCTCAGG + Intergenic
1198893866 X:141429443-141429465 CTTACTTTTTCCCTTGCCTCAGG - Intergenic
1199113395 X:143960356-143960378 CTCTTTTTGTTCCTAGTTTCTGG - Intergenic