ID: 953941539

View in Genome Browser
Species Human (GRCh38)
Location 3:47103132-47103154
Sequence CTAGGTGAAGACTGATATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953941533_953941539 17 Left 953941533 3:47103092-47103114 CCTTTTATTATGGTTATATATGA 0: 1
1: 0
2: 6
3: 39
4: 440
Right 953941539 3:47103132-47103154 CTAGGTGAAGACTGATATATGGG 0: 1
1: 0
2: 1
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953941539 Original CRISPR CTAGGTGAAGACTGATATAT GGG Intronic
904357491 1:29950039-29950061 CTATATAAACACTGATATATAGG + Intergenic
907131443 1:52100853-52100875 CTAAGTTAACACTGATATCTGGG - Intergenic
908504172 1:64778520-64778542 CTATATGAAGAGTGATATAATGG + Intronic
908722833 1:67145001-67145023 CTAGGTGAAGAGTGAAAAAGGGG - Intronic
908839641 1:68265959-68265981 CAAGGAGAAAACTGATATATTGG - Intergenic
908925914 1:69255086-69255108 CTAGGACAAGACTGAAAAATTGG - Intergenic
909070019 1:70982830-70982852 CTCGGTAAAGACTCATAAATAGG + Intronic
912609329 1:111027604-111027626 CTAGGAGATGACTGAATTATGGG + Intergenic
915263617 1:154697935-154697957 CAGGGTGATGACTAATATATTGG + Exonic
915646733 1:157277865-157277887 CTGGGTCTAGCCTGATATATAGG + Intergenic
916395375 1:164381130-164381152 CTAGGTGATGATTGTTTTATAGG - Intergenic
917208018 1:172597967-172597989 CAAAGAGAAAACTGATATATTGG - Intronic
918674754 1:187269413-187269435 CTTGGAGAAGACTGCTGTATTGG + Intergenic
919504400 1:198380044-198380066 CTAGGTGAAATCTGAAGTATAGG - Intergenic
1063405781 10:5793456-5793478 CTAGGTTAGGACTGATAATTGGG - Intronic
1067396198 10:45921453-45921475 CTAGGTTAGGGCTGATGTATTGG - Intergenic
1068974373 10:62992665-62992687 CTGGGTGAGTACTGAAATATCGG + Intergenic
1071461941 10:85905947-85905969 AAAGGTGAAGACTGTTATAATGG + Intronic
1078261262 11:9711318-9711340 GTAGGTGAAGACTGATCATTAGG - Intronic
1079676885 11:23239555-23239577 CTATGTGAAGCCTGTTTTATAGG + Intergenic
1080267222 11:30414162-30414184 CTAGTTGTAGACTGAGATAGTGG + Intronic
1090333700 11:125949397-125949419 CACGGTGAAGACCGATAAATAGG - Intergenic
1091730946 12:2879755-2879777 CTAGGTGGATACTGAAATACAGG + Intronic
1093556589 12:20483072-20483094 TGAGATGAAGACTGATATGTAGG - Intronic
1095840546 12:46687005-46687027 CTATGTTAACACTGATATTTGGG + Intergenic
1098556235 12:71822197-71822219 TCAGGTGAAAACTGATGTATAGG - Intergenic
1100130648 12:91489283-91489305 CCATGTGAAGAAGGATATATTGG - Intergenic
1100629583 12:96374364-96374386 CTAGGTGAAGAATGACCTGTTGG - Intronic
1105397396 13:20051631-20051653 CTACGTAAAGACTGATGTACAGG - Intronic
1109757149 13:66775873-66775895 TTAGATGAAGACTGACAAATGGG + Intronic
1111653681 13:91126560-91126582 CTTGAAGAAGACTGAGATATAGG - Intergenic
1113327916 13:109300500-109300522 CCTGGTGAGGTCTGATATATGGG + Intergenic
1115735676 14:36326712-36326734 GTAGGGGAATATTGATATATGGG - Intergenic
1118236871 14:64013711-64013733 CTAGATGCTGACTGATACATCGG - Intronic
1118518298 14:66551489-66551511 CTAGCTCAAGACTTAGATATAGG - Intronic
1120108312 14:80521846-80521868 GTAGGTGAACACTGATGTTTGGG - Intronic
1131028196 15:89163015-89163037 CTAAGGGAAGACTCACATATAGG - Intronic
1141108338 16:81251919-81251941 CTAGGTCAAGTTTGATATTTTGG - Intronic
1141349060 16:83276050-83276072 CTAGGCCAAGACTGATTTACAGG + Intronic
925780719 2:7379428-7379450 CTATGTGAAGACAGCTATGTGGG + Intergenic
927867670 2:26601644-26601666 ATAGGAGAAGACTCATAAATTGG + Intronic
928276668 2:29907173-29907195 CTAGGTGCAGACTCTTATACAGG - Intronic
938783083 2:134602920-134602942 CTAGGTGAGGACTGAGATACAGG - Intronic
940016873 2:149115747-149115769 ATAAGAGGAGACTGATATATTGG - Intronic
946449803 2:219770128-219770150 CTAGATGAAGCCTGATATTAAGG - Intergenic
946519417 2:220448988-220449010 ATAGGAGTAGACTGATATTTTGG + Intergenic
946524666 2:220505410-220505432 CTAGGTGAAGATTATTTTATGGG + Intergenic
1172433163 20:34909415-34909437 CTTGGTGAAGAATGATATCAAGG + Intronic
1172929060 20:38569693-38569715 CTAGGTTAAGACTGATGAACAGG + Intronic
1177593586 21:23206386-23206408 ATGGGTGAAGAAAGATATATAGG + Intergenic
1182029823 22:27149435-27149457 CTAGATGCAGAATGATATGTAGG + Intergenic
949797945 3:7871359-7871381 CTACGTAAAGACTGCTATTTAGG - Intergenic
953941539 3:47103132-47103154 CTAGGTGAAGACTGATATATGGG + Intronic
956500028 3:69872612-69872634 TTTGGAGAATACTGATATATTGG + Intronic
958837057 3:99158075-99158097 GTAGGTGATGACTGAATTATGGG + Intergenic
960178947 3:114551600-114551622 CAAAGTGAAGAATGATAGATTGG + Intronic
961960085 3:130845634-130845656 CCATGTGAAGACTGATATGCAGG + Intergenic
963306286 3:143657043-143657065 CTGGGTGCAGGCTGAAATATGGG + Intronic
971108928 4:23560567-23560589 CTAACTGAAGGCTGCTATATTGG + Intergenic
973322570 4:48825168-48825190 TAATGTGAAGACTGAGATATGGG + Intronic
974646714 4:64704201-64704223 CTATGTTAAGAATGAAATATAGG + Intergenic
975788813 4:77925019-77925041 CTAGGTGATGAGTAGTATATGGG - Intronic
976618664 4:87104944-87104966 CTATGTGAACACTGATCAATGGG - Intronic
976721509 4:88173214-88173236 CTAGTTGAAGATTGATACATAGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978506968 4:109468671-109468693 CTAGGTGAAGGATGATAACTTGG + Intronic
979811832 4:125046092-125046114 TCAGGAGAAGACTGATTTATTGG + Intergenic
980105436 4:128583898-128583920 CTAGGGGAAGAGGGATATAAAGG + Intergenic
984488177 4:180399009-180399031 CCAGCTGAGGACTGATAAATGGG - Intergenic
984614596 4:181882493-181882515 GAGGGTGAAGACTGATATACAGG + Intergenic
988389627 5:30610790-30610812 CCAGGTGAAGACTTGAATATGGG + Intergenic
993929844 5:93924425-93924447 CTTAATGAAGACTGGTATATGGG + Intronic
995346679 5:111128526-111128548 CTAGGTATAGAATTATATATTGG - Exonic
996463217 5:123770778-123770800 CCAGGTGAAGAGGGATAGATTGG + Intergenic
998544160 5:143011799-143011821 CTAGGTGGAGGCTGACATAGAGG - Intronic
998773716 5:145574630-145574652 CTAGGTGAAGAGTGCTGTAATGG - Intronic
1000784843 5:165530095-165530117 ATAGGAGAAGGCTGATATATGGG + Intergenic
1002539371 5:179895778-179895800 CTAGGTGAGGACTGAAAGGTGGG + Intronic
1005261003 6:24059804-24059826 CTAGATGAAATCAGATATATAGG + Intergenic
1007003595 6:38337881-38337903 CTGGTGGAAGACTGAAATATAGG + Intronic
1009212549 6:60879725-60879747 CTAGGTGTAAACTGATATGAAGG + Intergenic
1009247368 6:61255493-61255515 CTTGGTGAAGAATAATAGATGGG - Intergenic
1011049572 6:83129659-83129681 CTATGGGGAGATTGATATATTGG + Intronic
1014412649 6:121146054-121146076 CTAGTTGAAGACTGATGTGAAGG + Intronic
1018883128 6:167904909-167904931 CAGGGTGAAGACTGATATATGGG - Intronic
1019087458 6:169492861-169492883 CTAGGAGAAAACTGATATCCAGG + Intronic
1021301473 7:18978473-18978495 CTAGGAAAAGGCTGATATGTGGG + Intronic
1022168117 7:27793062-27793084 CTAGGACAAGACTGATACACTGG + Exonic
1029838799 7:103340877-103340899 CTATGTGAAGACTGAGGTTTTGG - Intronic
1030903258 7:115150252-115150274 GTATATGTAGACTGATATATGGG - Intergenic
1032862112 7:135890269-135890291 CTAGATGGAGATGGATATATGGG - Intergenic
1034818120 7:154192102-154192124 TGAGGTGAAGACTGATTTAAAGG + Intronic
1040807861 8:51414285-51414307 CTAGATGGAGAATGCTATATGGG - Intronic
1047363495 8:124191272-124191294 CCAGGTGAAGACAGAAATACTGG + Intergenic
1050989140 9:12124897-12124919 CTTGGTGAAGATTGAGTTATAGG + Intergenic
1187451055 X:19396700-19396722 CTGGGTGATTGCTGATATATTGG - Intronic
1193651769 X:84144172-84144194 TTTGGTGAAGTCTGATTTATAGG - Intronic
1201262967 Y:12178251-12178273 CTAGGTGTAGGCTGAACTATGGG - Intergenic