ID: 953951363

View in Genome Browser
Species Human (GRCh38)
Location 3:47192919-47192941
Sequence AAGTGTGTGAAATGCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953951363_953951376 30 Left 953951363 3:47192919-47192941 CCCCCCATGCATTTCACACACTT No data
Right 953951376 3:47192972-47192994 CCCCTCAACCAAGAACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953951363 Original CRISPR AAGTGTGTGAAATGCATGGG GGG (reversed) Intergenic
No off target data available for this crispr