ID: 953957073

View in Genome Browser
Species Human (GRCh38)
Location 3:47239968-47239990
Sequence TGAACCACCTGTCCCAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953957070_953957073 5 Left 953957070 3:47239940-47239962 CCAGGAGTGTGAAGAACAGTGTG 0: 1
1: 0
2: 3
3: 28
4: 207
Right 953957073 3:47239968-47239990 TGAACCACCTGTCCCAGAGTTGG 0: 1
1: 0
2: 1
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953957073 Original CRISPR TGAACCACCTGTCCCAGAGT TGG Intronic
900897726 1:5495541-5495563 TGAATCACCTGGGGCAGAGTTGG - Intergenic
902057575 1:13615055-13615077 AAAACCGCCTGTCACAGAGTCGG + Intronic
902717451 1:18282328-18282350 GGAATCACCTGGGCCAGAGTGGG - Intronic
903397256 1:23011272-23011294 TAAACCACCTGGCACAGAGCAGG - Intronic
904836641 1:33342003-33342025 TGAAGGACCTCTCCCAGAGAAGG + Intronic
907797989 1:57736867-57736889 TGAACCACCTGTTTCAGGCTGGG - Intronic
908087299 1:60649692-60649714 TAAACCACCTGTCACAGAAGAGG - Intergenic
908877542 1:68695133-68695155 TGAACCTCCTGTGCCTGAGGTGG - Intergenic
913139748 1:115928892-115928914 GGTCCCACCTTTCCCAGAGTAGG - Intergenic
917743315 1:177983081-177983103 TAAAGCACCTGTCCCCGAATTGG + Intronic
922851756 1:228738661-228738683 TGAATCTGCTGTCCCAGAGTAGG - Intronic
1068297266 10:55088555-55088577 TGAGCCACCCCTCCCAGACTAGG + Intronic
1070335305 10:75449767-75449789 TGAACCACATCTCACAGAGCAGG - Intronic
1071111372 10:82161409-82161431 TGGACCACTTGCCCCATAGTCGG - Intronic
1075332825 10:121585463-121585485 TGAATTTCCTGGCCCAGAGTAGG - Intronic
1077162053 11:1118209-1118231 AGCACCACCTGCCCCAGAGGCGG - Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078358149 11:10648078-10648100 TGAGCCACCGGGCCCAGGGTAGG - Intronic
1080986988 11:37480422-37480444 TGGACCAACTGTCCCAGTGTGGG - Intergenic
1082119327 11:48361403-48361425 TGGACCACCTGGCCCAGACAAGG - Intergenic
1082254966 11:50023743-50023765 TGGACCACCTGGCCCAGACAAGG + Intergenic
1083653792 11:64219531-64219553 TCAACAAGCTGTCCCAGAGCGGG + Exonic
1083992747 11:66257220-66257242 TGAACCACCTCTGTCAGAGACGG + Intergenic
1091249728 11:134132887-134132909 GGAACCACCAGTACCAGAGTAGG - Intronic
1095174250 12:39072760-39072782 TGAAACACCTGCCTCAGAATTGG + Intergenic
1096056225 12:48654672-48654694 TGATCCTCATATCCCAGAGTAGG - Intronic
1096528831 12:52230987-52231009 TGTGCCACCTGGCACAGAGTGGG + Intergenic
1102419074 12:112789810-112789832 TGAACCACCTGCCTCAGTGGTGG - Intronic
1106342387 13:28842915-28842937 GGCAGCACCTGTCCCAGAGGGGG - Intronic
1106524503 13:30528087-30528109 TTAACAACCTGACCCAGAGCAGG + Intronic
1109078129 13:57864490-57864512 TGAACCACCTGCTCTGGAGTGGG + Intergenic
1113649304 13:112024317-112024339 TGAACAAACTGGCCCAGAGAAGG - Intergenic
1115444699 14:33476631-33476653 AGAAACAACTGTCCCAAAGTGGG - Intronic
1118249968 14:64150121-64150143 TGAGCCACCGCGCCCAGAGTGGG - Intronic
1118275575 14:64383578-64383600 TGAGCCACCTCTCCCAGTTTAGG - Intergenic
1120689561 14:87577406-87577428 AGAACCACCTTTCCCAGCGTGGG + Intergenic
1121307017 14:92912875-92912897 TGAACCACTTGTCCTGGAGCTGG + Intergenic
1122631033 14:103107887-103107909 TGTTCCACCTGATCCAGAGTGGG - Intronic
1123837738 15:24212976-24212998 GGAACCACCTTTACCAGTGTGGG + Intergenic
1123847272 15:24315290-24315312 GGAACCACCTTTACCAGTGTGGG + Intergenic
1123866267 15:24522357-24522379 GGAACCACCTATACCAGTGTGGG + Intergenic
1123979680 15:25589312-25589334 TGAACCACCTTTTCCACACTGGG + Intergenic
1126425103 15:48518980-48519002 TGCTCCAACTGTCCCAAAGTAGG + Intronic
1126697166 15:51336097-51336119 TGAAGAGCCTGTCCTAGAGTTGG - Intronic
1127129138 15:55843834-55843856 AATACCACCTGGCCCAGAGTAGG - Intronic
1128866692 15:71119788-71119810 TGAACCTCCTTTCCCAGAATGGG + Intronic
1132730934 16:1361759-1361781 TGAAGCACTTGCCCGAGAGTCGG - Exonic
1133969754 16:10559153-10559175 TGAACCACCAGCCCCGGAGCAGG - Intronic
1134021626 16:10925039-10925061 TGCCCCACCTGACACAGAGTAGG - Exonic
1139517767 16:67461878-67461900 CCTACCACCTGTCCCAGAGCAGG - Intronic
1144796261 17:17893292-17893314 TGCTCCGCCTGACCCAGAGTTGG + Intronic
1148943961 17:51241912-51241934 TGATCATACTGTCCCAGAGTAGG + Intronic
1148993251 17:51684732-51684754 TCCACCACCTGGCCCAGAGTTGG + Intronic
1150577151 17:66440625-66440647 TTGACCACCAGTCCCAGACTAGG - Intronic
1151654951 17:75491489-75491511 TAAACAGCCTGGCCCAGAGTCGG - Intronic
1151881628 17:76899017-76899039 TGAACCCCCTGACCCACGGTGGG - Intronic
1156812884 18:41273968-41273990 TGCTCCACCTGTCCCTGAGTTGG - Intergenic
1157762120 18:50272901-50272923 AGAGCCACCTGACCCAGAGGAGG - Exonic
1160718850 19:589016-589038 GGAAGCACCTGTCTCAGAGCTGG + Intergenic
1162032800 19:7924762-7924784 TGCACCGCCTGTCCCGGAGACGG - Exonic
1163848776 19:19652036-19652058 TGAACAACCTGCCCCTGAGGTGG + Intronic
1164078702 19:21844128-21844150 TGATCCACCTGCCCCAGTCTGGG - Intronic
1164565225 19:29321228-29321250 TGCACCACCTGGCACACAGTAGG - Intergenic
1164790445 19:30973038-30973060 TGAACCACTTGTGCCAGGTTAGG + Intergenic
1165330430 19:35138802-35138824 TGGACCCCCTGGCCCAGAGCTGG - Intronic
1165378196 19:35458976-35458998 TGAACCCCCTGCCCCAAAGCAGG + Intergenic
1165817907 19:38654231-38654253 TTAACCACCTGACCCAGGGAAGG + Intronic
1167621589 19:50563849-50563871 AGAACCACTTCTCCCAGAGAAGG + Intronic
1167827130 19:51983953-51983975 TGGACCACTTGAGCCAGAGTTGG + Intronic
925721186 2:6829248-6829270 TGACCCACCTGTGCCAGGGTGGG + Intergenic
926725371 2:15993467-15993489 GGAACCACCTGTCACATGGTGGG - Intergenic
930017853 2:46983248-46983270 TGGACCACTTGTGCCAGAGATGG + Intronic
930252504 2:49050704-49050726 TAAAACACCTGTCCCAGAATAGG + Intronic
932684448 2:73856401-73856423 TGTACCATCTGTTCCAGAATGGG + Intronic
933089570 2:78104148-78104170 TGACCCAGAAGTCCCAGAGTGGG - Intergenic
933851237 2:86368385-86368407 AGAGCCCCCTGTCCCAGAGAAGG + Intergenic
934766110 2:96881003-96881025 TGAACCACCTTGCCCAGCCTGGG - Intronic
937064800 2:119009878-119009900 TGTACCTCCTGTCCTAGAATGGG - Intergenic
937328196 2:121004864-121004886 TAAACCACCTATCCCAGAAGGGG - Intergenic
937869830 2:126778880-126778902 TGAACCAGCTGTCCCAGGTGAGG - Intergenic
938997808 2:136699077-136699099 TGAACTACCTCTCCCAAAATGGG + Intergenic
940620397 2:156105651-156105673 TCAACCACTTGCACCAGAGTGGG - Intergenic
941361151 2:164552924-164552946 TGAAAGAGCAGTCCCAGAGTTGG - Intronic
941828093 2:169922001-169922023 TGAACCACCAGGCCCAGCCTAGG - Intronic
945428263 2:209734712-209734734 CCAACCACCTGTGACAGAGTTGG - Intergenic
1168978795 20:1987851-1987873 TGAAGCACCTGGCACATAGTAGG + Intronic
1169125209 20:3122302-3122324 TGAGCCATCTGTCCCAGACAAGG - Exonic
1170002182 20:11626997-11627019 TGAACCACCTTGCCCAGAGATGG - Intergenic
1170970085 20:21107274-21107296 TACACCACCTCTTCCAGAGTTGG - Intergenic
1175546477 20:59781347-59781369 TGAGCCACCCGTCCCAGACCAGG + Intronic
1177150430 21:17450150-17450172 AGAACTACCTGTCTCAGACTGGG - Intergenic
1177612635 21:23471691-23471713 TGAACCAACAGTCCCAGAAAAGG + Intergenic
1178421082 21:32443820-32443842 TGAACCAACTTCCCAAGAGTTGG + Intronic
1180741695 22:18057560-18057582 CGAACCACCTCTCCCAGCCTAGG + Intergenic
1180920363 22:19518511-19518533 TGAACCCCCGTCCCCAGAGTGGG - Intronic
1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG + Intronic
1182077762 22:27506527-27506549 TGAAGCACCTGATCCAGGGTTGG - Intergenic
953957073 3:47239968-47239990 TGAACCACCTGTCCCAGAGTTGG + Intronic
954634989 3:52066365-52066387 TGACCCACCTGTGCCAGAGAAGG + Intergenic
956536318 3:70280810-70280832 TGAAACACCCATCCCAGAGACGG + Intergenic
957050365 3:75406992-75407014 TGAACCAACTTCCCAAGAGTTGG - Intergenic
961882670 3:130073436-130073458 TGAACCAACTTCCCAAGAGTTGG - Intergenic
964031924 3:152148053-152148075 TGAACCAACTGTCTGGGAGTTGG + Intergenic
966752306 3:183334036-183334058 TGCTCCAGCTGTCCCAGATTTGG - Intronic
980488302 4:133490093-133490115 TGAAACACATGTCCCACACTAGG + Intergenic
983934457 4:173491417-173491439 ACAACCACCTGCCACAGAGTGGG + Intergenic
984255079 4:177381484-177381506 TGAAAAACGTGACCCAGAGTGGG - Intergenic
992020514 5:72619378-72619400 TGAAGCACCTGGCAAAGAGTGGG - Intergenic
992557271 5:77916029-77916051 TGAACAATTTGTCCCAGAGCAGG - Intergenic
994207975 5:97057279-97057301 AGAACCTCCAGTCCCAGAGCAGG + Intergenic
994283251 5:97931967-97931989 TCAATCAGCTGTCCCAGACTTGG + Intergenic
995169308 5:109088906-109088928 TGAACCACATGTCTCAGTGCAGG - Intronic
997424936 5:133796702-133796724 TGAACCACAGGCTCCAGAGTAGG - Intergenic
1000419042 5:161016001-161016023 CTAACCACCTGTTCCAGAGAAGG - Intergenic
1002836940 6:872932-872954 TGAACCACCTGCCCCAGGGTGGG - Intergenic
1003385706 6:5665606-5665628 AGAACCACATATCCCAGAGCAGG + Intronic
1005081179 6:21958177-21958199 TGCACCACCTATCACAGAGTGGG - Intergenic
1005855953 6:29863599-29863621 CCAGCCACCTGTCCCAGAGCTGG - Intergenic
1010793242 6:80089378-80089400 TGAGCCACCTCGCCCAGACTGGG + Intergenic
1012600839 6:101094695-101094717 GGAACCACCTCACCCAGAGATGG - Intergenic
1013255512 6:108380592-108380614 TGGAACACCTGCTCCAGAGTTGG - Intronic
1013488069 6:110617299-110617321 TGAGACTCCTGTCCCAGAGGGGG + Intronic
1013779506 6:113714457-113714479 TGAGCCACCACTCCCGGAGTTGG + Intergenic
1014473550 6:121845391-121845413 TAAACTACCTTTCCAAGAGTTGG - Intergenic
1014804186 6:125811112-125811134 TAAACCACCTGACCCAGGGCAGG + Intronic
1016317501 6:142806951-142806973 TGCAGTACCTGTCACAGAGTAGG - Intronic
1018457269 6:163963383-163963405 AGAAGCACTTGCCCCAGAGTGGG + Intergenic
1025092902 7:56078052-56078074 TTTACCACCTGTCCCAAAGCAGG - Intronic
1027882997 7:83866706-83866728 TGAACTGACAGTCCCAGAGTAGG + Intergenic
1029645522 7:101853172-101853194 TGGGTCACCTGTCCCAGAGAGGG - Intronic
1032933650 7:136703478-136703500 TGAACCACCTTTCCCAGAAATGG - Intergenic
1034675644 7:152891037-152891059 TGAGCCACCTGGCCCAGCCTGGG + Intergenic
1036079749 8:5542214-5542236 GCAACCACCTGTCCCTGAGTGGG - Intergenic
1042736488 8:71995170-71995192 TGAAGTGCCTGCCCCAGAGTTGG - Intronic
1043500380 8:80848559-80848581 TGAACCACCTCACCCAGTCTAGG - Intronic
1047588015 8:126295126-126295148 TGAATCACCTGTCTGAGAGAAGG - Intergenic
1053840222 9:42184207-42184229 TGAGCCACCTGCCCCAGAAAGGG - Intronic
1054958336 9:70939090-70939112 TGTACCACCTTTCACAGAGGAGG - Intronic
1054989922 9:71313100-71313122 TCAACCACCTGCGCCAGAGGAGG - Intronic
1056860317 9:90175153-90175175 TGGGCCACCTCTCCCACAGTGGG + Intergenic
1056942983 9:90971174-90971196 TAAGCCACCTGTCCCATAGCAGG - Intergenic
1061254021 9:129443256-129443278 CGAACCACTTATCCCCGAGTTGG + Intergenic
1062405069 9:136392365-136392387 TCAAGCACATGTCCCACAGTCGG - Intronic
1189557036 X:42155785-42155807 TGAAGCACAGGTCCCAGAGAGGG - Intergenic
1192153073 X:68724005-68724027 GGAACAACCTGTGCCAGAGTCGG + Exonic
1193127336 X:77883824-77883846 TGAACCACCTTGCCCCGACTGGG + Intronic
1199716640 X:150511624-150511646 TGCACCACCTGTCAAAGGGTGGG + Intronic