ID: 953957885

View in Genome Browser
Species Human (GRCh38)
Location 3:47245600-47245622
Sequence ATGGGTGAGGCCCCTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953957880_953957885 1 Left 953957880 3:47245576-47245598 CCAAGTACTGGGGTTAAAAGTCA 0: 1
1: 0
2: 1
3: 11
4: 147
Right 953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG 0: 1
1: 0
2: 1
3: 4
4: 109
953957876_953957885 16 Left 953957876 3:47245561-47245583 CCACTGGGGCAAGAACCAAGTAC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG 0: 1
1: 0
2: 1
3: 4
4: 109
953957875_953957885 27 Left 953957875 3:47245550-47245572 CCATGCTGAATCCACTGGGGCAA 0: 1
1: 0
2: 0
3: 23
4: 241
Right 953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG 0: 1
1: 0
2: 1
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953957885 Original CRISPR ATGGGTGAGGCCCCTTGTGT GGG Intronic
901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG + Intronic
901759330 1:11460482-11460504 ATGGGTAAAGACCCTTGTGCAGG - Intergenic
902660849 1:17902291-17902313 AAGGGTGAGTACTCTTGTGTAGG + Intergenic
905455127 1:38083392-38083414 GTGGGTGGTGCCCCCTGTGTTGG + Intergenic
907044966 1:51295014-51295036 GTGGGTGAGGCCCCAGATGTGGG - Intronic
915355809 1:155254809-155254831 GTGGGTAAGGCCCCTGGTGCTGG + Exonic
921872223 1:220153321-220153343 GTGGGTGTGGCCTCTTCTGTGGG + Exonic
923010698 1:230085363-230085385 ATGAGCGAGGCCCTTTGTTTTGG + Intronic
923758168 1:236812888-236812910 GTGGGTGAGTCCCCTAATGTAGG + Intronic
1063587269 10:7363740-7363762 ATGGGTGAGTCCCCTTCTTGGGG - Intronic
1069639253 10:69944236-69944258 AGGGCTGAGACCCCTGGTGTTGG - Intronic
1070150491 10:73802086-73802108 ATGGGAGAGACCCCTTGCATGGG - Exonic
1070191538 10:74115981-74116003 ATGTGTGAGGAGCCCTGTGTGGG - Intronic
1072017223 10:91360100-91360122 AGATGTGAGGCCCCTTGTGAAGG - Intergenic
1074096443 10:110317815-110317837 AAGGGTGAGGTCCCTGGTGAGGG + Intergenic
1076426561 10:130371327-130371349 ATAGGTGAGGCCCCTTCTCTGGG + Intergenic
1076995064 11:293781-293803 AGGGGTGAGGCCCACTGCGTGGG - Intronic
1078415272 11:11159715-11159737 TTGGATCAGGCCCTTTGTGTTGG + Intergenic
1086449545 11:86902429-86902451 TTGGGTGAGGACCCTTATCTAGG - Intronic
1088112424 11:106277703-106277725 TTGGGTGTGCCCCCTTCTGTAGG - Intergenic
1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG + Intergenic
1097065156 12:56315482-56315504 ATAGGTGAGGCCCTAAGTGTTGG + Intronic
1097886479 12:64734077-64734099 ATGGGTGATGCATCATGTGTTGG - Intronic
1102921197 12:116792941-116792963 TTGGGTGAGCCACCTTGTCTAGG + Intronic
1108114377 13:47111048-47111070 ATGGGAGAGGCCCATTGATTCGG - Intergenic
1113288955 13:108884577-108884599 ATGGGTGAGAGCCCCTGTCTCGG - Intronic
1114548859 14:23522086-23522108 ATGGGTGGGCCCCCTTGAGGTGG + Exonic
1118137786 14:63046935-63046957 ATGGGTGCGTCCCCTTTTGCTGG + Intronic
1119728591 14:76937218-76937240 ATGGAAGAGACCCCTTGTGCCGG - Intergenic
1122245054 14:100396589-100396611 CTTTGTGAGGCCACTTGTGTTGG - Intronic
1124198946 15:27660152-27660174 AGGGATGAGCCCCCTTGGGTGGG - Intergenic
1129457405 15:75683183-75683205 ATGCGGGAGGCCCTTTGTGCAGG - Intronic
1129726386 15:77903762-77903784 ATGTGGGAGGCCCTTTGTGCAGG + Intergenic
1130175764 15:81568782-81568804 ATTGCTGAGCCCCCTTGTCTTGG - Intergenic
1131812041 15:96182786-96182808 ATCGGTGAGGCGATTTGTGTAGG - Intergenic
1136052372 16:27661036-27661058 ATGACTGAAGTCCCTTGTGTGGG - Intronic
1136223417 16:28843573-28843595 ATGGGCCATGCCCCTTCTGTTGG + Intronic
1136286682 16:29248299-29248321 ATGAGTGAGGCTCCCTGTGCAGG - Intergenic
1136299009 16:29320826-29320848 CTGGGTGAGGCCTCTTCAGTGGG + Intergenic
1136379468 16:29885786-29885808 AGGGGTGAGGCAGCTTGTGAGGG - Intronic
1141725798 16:85787514-85787536 ATGGATGTGGCCCCGTGGGTAGG + Intronic
1142058844 16:88017014-88017036 ATGGGAGAGGCTGCTTGTGGAGG + Intronic
1144323610 17:14155783-14155805 TTGGGTAAGGCTCATTGTGTTGG + Intronic
1145198083 17:20913473-20913495 ATGGGTGAGACCCCATGTTGTGG - Intergenic
1150612170 17:66742273-66742295 ATGTGTCAGACCCCCTGTGTGGG + Intronic
1151679526 17:75616144-75616166 ATGGGTGAGGGCACTTGGGGTGG + Intergenic
1151903871 17:77035239-77035261 GTGGGTGAGGCCCCACGTGGGGG + Intergenic
1152749442 17:82055868-82055890 ATGGGTCAGGCTGCTTCTGTAGG + Intronic
1156186672 18:34671188-34671210 ATGAGTGAGGCTCCGTGGGTGGG + Intronic
1157513423 18:48294697-48294719 AGGGGTGAAGCCCTCTGTGTGGG - Intronic
1160361881 18:78290234-78290256 GTAGGGGAGGCCCCTTGTGATGG - Intergenic
1160618364 18:80151106-80151128 ATGGGGGAGGGCACCTGTGTGGG + Intronic
1162309812 19:9899501-9899523 GTGGGTGAGCCCCATTATGTTGG - Intronic
1165798509 19:38533084-38533106 CTGGGTCAGGCACCTTGTTTGGG - Intronic
1167607103 19:50487350-50487372 CTGGGTGGGGCCCCTGGGGTTGG - Exonic
927174597 2:20396649-20396671 CTGGGCAAGGCCACTTGTGTGGG - Intergenic
927314392 2:21665140-21665162 ATTGGTGAGGCCCTATGTATAGG - Intergenic
927790014 2:26002383-26002405 ATGTGTGTGGCACCTTGGGTGGG + Intergenic
927943950 2:27123620-27123642 CTGGGGGAGGCCGCTTGTCTCGG + Intergenic
930226843 2:48802712-48802734 ACTCGTGAGGCCACTTGTGTTGG - Intergenic
936629864 2:114190628-114190650 ATTGTTGAGGCCACTTTTGTTGG - Intergenic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
938412129 2:131074012-131074034 ATGCCTGAGGCCCCCTCTGTTGG - Intronic
940044834 2:149398740-149398762 GTGGCTGAGTCCCCTTATGTTGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1172876695 20:38168728-38168750 AAGGGAGAGTCCCCGTGTGTGGG + Intergenic
1173665811 20:44762281-44762303 CTGGGGGAGGCCCCTGGGGTTGG + Intronic
1173720589 20:45254373-45254395 GTGGGTGTGTCCCCTTCTGTAGG - Intronic
1175197494 20:57254512-57254534 ATGAGTTGGTCCCCTTGTGTGGG + Intronic
1176081749 20:63276945-63276967 ATAGGTGGGTCCCCCTGTGTTGG + Intronic
1176385240 21:6135737-6135759 AAGGGTGAGGCCTCATGCGTGGG + Intergenic
1179738233 21:43402515-43402537 AAGGGTGAGGCCTCATGCGTGGG - Intergenic
1184404288 22:44291494-44291516 ATGAGTCAGGCCCCTTGTGTTGG + Intronic
952164203 3:30728402-30728424 ATGGCTGGGGCCACCTGTGTGGG + Exonic
953397801 3:42586924-42586946 ACTGGTGATGCCCCTTATGTAGG - Intronic
953880792 3:46690377-46690399 ATGGGTGGGGGCCCTTGGGGTGG + Intronic
953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG + Intronic
955033709 3:55245640-55245662 ATGGGTGAGGCCTCATAGGTTGG + Intergenic
955478799 3:59368077-59368099 ATGGTTGATGCCTGTTGTGTGGG + Intergenic
964476715 3:157104212-157104234 ATGAGAGAGGCCCCTTGACTTGG - Intergenic
968970988 4:3793773-3793795 ATGGGAGGGGCCCCTTGTGCTGG - Intergenic
970230394 4:13904135-13904157 TTGAGAGAGGCGCCTTGTGTGGG + Intergenic
985558038 5:567756-567778 ATCGGTGATGCCCCTTGAGCTGG + Intergenic
988804996 5:34732055-34732077 ATGGGAGTGGCCCCTGGAGTTGG + Intronic
990881543 5:60544545-60544567 ATGGGAGAGGCTCCTTCAGTTGG - Intergenic
993168058 5:84383194-84383216 ATGCGGGCGGCCCCTTGTGAGGG - Intronic
995333047 5:110966891-110966913 TGGGTTGAGGCTCCTTGTGTTGG - Intergenic
998548826 5:143056678-143056700 ATGGGTCAGGCCTCTTGTAAAGG + Intronic
1003285968 6:4734249-4734271 CTGGGAGGGTCCCCTTGTGTGGG + Intronic
1004246327 6:13980152-13980174 ATGGGTTAGGTCCCCTTTGTTGG - Exonic
1005920939 6:30400826-30400848 ATGAGTGAGGACCCTTGCCTTGG + Intergenic
1006845368 6:37057736-37057758 AAAGGTGAGGCCCGTTCTGTAGG + Intergenic
1008171552 6:48213872-48213894 AATGGTGGGGGCCCTTGTGTAGG + Intergenic
1009619281 6:66051729-66051751 ATGGATGAGGCTGCTTGTGGGGG - Intergenic
1011090490 6:83592981-83593003 ACAGGAGAGGCCCCTTGTGGTGG + Exonic
1011376036 6:86687828-86687850 ATGTGTGTGGACCCATGTGTTGG + Intergenic
1014836801 6:126168863-126168885 ATGGGTGAGTCTACTTGTGGTGG + Intergenic
1017202630 6:151772571-151772593 ATGATTGAGGCCCCTTTTGAGGG + Intronic
1018618256 6:165708297-165708319 ATGGGGGAGGCCCGGTGTGACGG - Intronic
1020127445 7:5541007-5541029 ATGGGTGAGGCCCCCTTGGAGGG + Intronic
1022310453 7:29192125-29192147 ATGGGGGAGGCCCAGTCTGTCGG - Intronic
1022497970 7:30865115-30865137 ATGGGTCAGGCTCCTGGTCTGGG - Intronic
1023848896 7:44139710-44139732 CGGGGTGAGGCCCCTAGTGAGGG - Intronic
1024006471 7:45228111-45228133 AGGGGTGAGGTCCCCTGTGGAGG + Intergenic
1027701553 7:81476213-81476235 AAGGGTGAGGACCCTTTTCTGGG + Intergenic
1030877203 7:114828695-114828717 ATGGGGGAGGCTGCATGTGTGGG + Intergenic
1030877242 7:114829747-114829769 ATGGGGGAGGCTGCATGTGTGGG + Intergenic
1037763175 8:21755816-21755838 ATGGCTGAAGGCCCTTGTCTTGG - Intronic
1048565216 8:135588886-135588908 AAGAATGAGGCCCTTTGTGTTGG - Intronic
1048971410 8:139647041-139647063 GCGGGAGAGGTCCCTTGTGTAGG - Intronic
1049322170 8:142002352-142002374 ATGGGCGGGGCCTCTTGGGTGGG + Intergenic
1049981666 9:909394-909416 TTGGGTGAAGCCCTTTGCGTAGG + Intronic
1054914255 9:70481259-70481281 AAAGGTAAGGCCCCTTGTGCTGG + Intergenic
1055549220 9:77414921-77414943 GTGGGAGAGGCCCCTAGTTTGGG - Intronic
1060081638 9:120652728-120652750 ATGGGTAATGACCTTTGTGTTGG + Intronic