ID: 953958221

View in Genome Browser
Species Human (GRCh38)
Location 3:47247516-47247538
Sequence AACCTGAGCCCACAGGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953958221 Original CRISPR AACCTGAGCCCACAGGGGAG TGG Intronic
900237290 1:1598876-1598898 AACCTAAGCCCAGTGGGGTGGGG + Exonic
900345775 1:2209637-2209659 ATCCTGAGCCAACAGGGGGAGGG + Intronic
900548572 1:3242119-3242141 ACCCAGAGCCCACAGGGGCCTGG - Intronic
900889840 1:5441793-5441815 ACCCTGAGGCCACAGGGGAGGGG - Intergenic
901678590 1:10900676-10900698 AGCCTGAGGCCACTGTGGAGGGG + Intergenic
903240310 1:21978355-21978377 AGCCTGAGGCTAGAGGGGAGAGG - Exonic
903244058 1:22002989-22003011 AGCCTGAGGCTAGAGGGGAGAGG - Exonic
904829136 1:33295442-33295464 ACCCTGAGATCACAGGGAAGGGG + Intronic
905167239 1:36089860-36089882 GATCTGAGCCCACAAGGGAAGGG - Intronic
905280766 1:36847554-36847576 AAGCTGAGCTCACTGGGGACTGG + Intronic
905816485 1:40954870-40954892 ACCCTGATCCCACGGGGGTGGGG + Intergenic
907296137 1:53456099-53456121 AACCTGAGCCCAGAAGGCAGAGG + Intergenic
908144065 1:61219146-61219168 CACTTGAACCCACAGGGCAGAGG + Intronic
909155482 1:72069358-72069380 CACCTGAGCCCAGAAGGCAGAGG + Intronic
910116523 1:83737642-83737664 CAACTGAGCCCACATGGTAGAGG + Intergenic
912329336 1:108803413-108803435 AAACTGAGCCCACACGAAAGGGG - Intronic
912991343 1:114489659-114489681 TACCTGAGCCCACAAGGTTGAGG + Intronic
914755471 1:150559500-150559522 AGCCTGGGCCCCTAGGGGAGGGG + Intronic
915131512 1:153698325-153698347 AACCTCCGCCCACATGGGAGGGG + Intergenic
915362007 1:155291645-155291667 AACCTGGGACCACAGGAGAGAGG + Intronic
915568347 1:156729213-156729235 ATCGTGAGGCCACAGGGGCGTGG + Exonic
915900300 1:159841935-159841957 AAGCTGAGGCCAGTGGGGAGAGG + Intronic
915973568 1:160370700-160370722 ATCCTGATCTCACAGGGCAGGGG + Exonic
916946000 1:169728083-169728105 AATGTGGCCCCACAGGGGAGTGG - Exonic
917594845 1:176518682-176518704 AACATGAGCCCACATGTGTGTGG + Intronic
917931277 1:179824428-179824450 ACCCTGAACTCTCAGGGGAGAGG + Intergenic
918632900 1:186740056-186740078 AACTTGAGCTAACGGGGGAGTGG - Intergenic
919031781 1:192251790-192251812 AGCCTGAGCCCACAGGGGGAGGG - Intergenic
920851408 1:209630575-209630597 ACCCAGACCCTACAGGGGAGGGG + Intronic
922241289 1:223756924-223756946 AAACTGAGGCCAGAGAGGAGAGG + Intronic
923582724 1:235233347-235233369 AACCTGAGCCCAAAGGGTCATGG + Intronic
1065706158 10:28473175-28473197 AATTTCAGCCAACAGGGGAGGGG + Intergenic
1065949193 10:30636462-30636484 CAGCTGAGCCCACAGGAAAGTGG - Intergenic
1066485402 10:35838207-35838229 AACCTGGGCACTCAGGGAAGGGG - Intergenic
1067306103 10:45065380-45065402 AACCTGGGCACTCAGGGAAGGGG - Intergenic
1067509198 10:46881462-46881484 ATCCTGAGGCCAAAGGGGAAGGG + Intergenic
1067653055 10:48170393-48170415 ATCCTGAGGCCAAAGGGGAAGGG - Intronic
1069609190 10:69761302-69761324 GGTCTGAGCCCACAGGGGATGGG + Intergenic
1070599731 10:77857284-77857306 AACCTGTGCCCTGAGGAGAGTGG + Intronic
1070827947 10:79402005-79402027 AAACAGAGGCCACAGGGGTGGGG + Intronic
1072454667 10:95565201-95565223 AACCTGGGTCCACAGGGAAACGG + Intergenic
1072634471 10:97169152-97169174 AAGCAGGGCCCCCAGGGGAGAGG - Intronic
1072787913 10:98296624-98296646 AACCAGAGCCCACAGGGGTTAGG + Intergenic
1074003382 10:109393967-109393989 AGCCTGAGCCCGTAGGGGAAGGG + Intergenic
1076266157 10:129111237-129111259 AAGCTGGGCCCACAGAGGACAGG + Intergenic
1077156403 11:1093916-1093938 AACCTGAGCCCAAAGAGACGGGG - Intergenic
1077168170 11:1153022-1153044 AACCTGCACCCTCAGGTGAGAGG - Intergenic
1077531563 11:3098886-3098908 AACCTGAGCCCAGGGGGCAGAGG - Intronic
1078131021 11:8614253-8614275 CACCTGAGCCCAGAAGGCAGAGG + Exonic
1078505974 11:11945849-11945871 CACTTGAGCCCAGAGGAGAGAGG + Intronic
1078530066 11:12130381-12130403 AATCAGAGGCCACAGGGCAGAGG + Intronic
1078726853 11:13939672-13939694 AACCCGAGTCCACAGGGAAGGGG + Intergenic
1079392716 11:20036255-20036277 GACCTGTGTCCACAAGGGAGGGG + Intronic
1081741065 11:45441001-45441023 AGGCTGTGCCCACAGGGGTGGGG - Intergenic
1082857722 11:57824025-57824047 AAGCTGAGCCTGCAGGGCAGTGG + Intergenic
1082927205 11:58562577-58562599 AACCTGATTACACAGGTGAGGGG + Intronic
1083048374 11:59755793-59755815 CACATGACCCCGCAGGGGAGGGG - Intronic
1083371926 11:62189304-62189326 AACTTGAGCCCAGAGGTTAGAGG + Intergenic
1083595700 11:63917453-63917475 AACCCGAGCCCACTGGTGTGTGG - Intergenic
1083729385 11:64644628-64644650 AACCTGCTCGGACAGGGGAGAGG + Intronic
1084023239 11:66430984-66431006 CACCTGAGCCCAGAAGGGCGAGG + Intergenic
1085392591 11:76190039-76190061 AGCCTGAGGGCACGGGGGAGGGG + Intronic
1085703698 11:78767567-78767589 AACTGGAGCCCAGAGAGGAGAGG - Intronic
1085920530 11:80949953-80949975 CACTTGAGCCCACAGGGTTGAGG + Intergenic
1087239771 11:95761769-95761791 AACCTGAGCTTTTAGGGGAGCGG - Intergenic
1088530679 11:110805964-110805986 AACCTGTGCTCTCAGGGCAGTGG + Intergenic
1089613703 11:119683688-119683710 AACCTGTGCCCTCAGCAGAGGGG + Intronic
1090672621 11:128959725-128959747 AACCTGAGTCGAGAGTGGAGTGG + Intergenic
1091237870 11:134033741-134033763 TACATGAGCCCACAGGGAGGGGG + Intergenic
1092745006 12:11665089-11665111 CACCTGAGCCCAGAAGGCAGTGG - Intronic
1092995044 12:13941641-13941663 AAACTGGACCCACAGGGAAGTGG + Intronic
1093138496 12:15479344-15479366 CACCTCAGCCAGCAGGGGAGGGG + Intronic
1093346290 12:18040491-18040513 CACAGGAGCCCACAGGGGCGGGG - Intergenic
1093369244 12:18346822-18346844 AACCTGGGTGCACAGGTGAGTGG + Exonic
1098022200 12:66168135-66168157 CACCTGAGCCCAGAAGGTAGAGG + Intronic
1099316437 12:81088248-81088270 TACCTGAACCCACAATGGAGTGG + Intronic
1099502652 12:83432644-83432666 AGCCTGAGTCCCTAGGGGAGAGG - Intergenic
1100685857 12:96985590-96985612 AACCTAAGCCCACAGCAGCGCGG + Intergenic
1103031095 12:117613521-117613543 AACATGAGACCACAGGGCATGGG + Intronic
1103228175 12:119305703-119305725 AACCTGAGATCCGAGGGGAGAGG - Intergenic
1103233392 12:119351138-119351160 ATCCTGACCCCAAAGGGAAGAGG - Intronic
1104356180 12:128089142-128089164 AACCTGAGCCCAGAAGGATGGGG + Intergenic
1104457411 12:128926658-128926680 AACCTGAGGGCACAGGACAGTGG - Intronic
1105593928 13:21818235-21818257 ATCAGGAGCCCACAGGGCAGGGG - Intergenic
1105826453 13:24127435-24127457 AACCAGAGGCCAGAGGGTAGGGG + Intronic
1106094367 13:26629628-26629650 AACCTAGGCACACAGGGGAGGGG + Intronic
1106176224 13:27334466-27334488 CACCCGAGCCCACAAGGCAGAGG + Intergenic
1106558642 13:30830822-30830844 AACCAGAGACCAGAGGGGAAGGG + Intergenic
1106716063 13:32389599-32389621 AACCAGAGGCCAGAGGGAAGTGG - Intronic
1106897881 13:34324673-34324695 AACCCCAGCTCACTGGGGAGAGG - Intergenic
1107227086 13:38064045-38064067 AACTTGAGCCCAGAAGGGGGAGG + Intergenic
1110497234 13:76183155-76183177 TACCTGAGCCCAAAGAAGAGAGG + Intergenic
1111795035 13:92908687-92908709 AAACTGAGGCCACAAGGAAGAGG + Intergenic
1112557728 13:100484195-100484217 CACCTGAGACCACAGAGGACCGG - Intronic
1113440484 13:110324452-110324474 GATCTGAGTCCACAGGGGAGGGG + Intronic
1113803252 13:113097057-113097079 CTCCAGAGCCCACAGAGGAGGGG + Exonic
1114280192 14:21187117-21187139 CACCTGAGCCCAGAAGGTAGAGG + Intergenic
1114705869 14:24726427-24726449 CACCTGAAGCCACAGGGGAAGGG + Intergenic
1117672916 14:58126010-58126032 CACCTGAGACCACAGGGGGAGGG + Intronic
1118012506 14:61624363-61624385 CACCTGAGCCCACGAGGCAGAGG - Intronic
1118952445 14:70446827-70446849 TACCTGAGGCCACTGGGGTGGGG + Intergenic
1119485732 14:74985240-74985262 CACCTGAGGGCACCGGGGAGTGG - Intergenic
1121621850 14:95355763-95355785 AAACTGAGTCCACAGAGGTGAGG - Intergenic
1123014177 14:105365684-105365706 AAAATGAGCTCAGAGGGGAGGGG - Intronic
1123086445 14:105719252-105719274 AACCTGAGCCCAGAGGGGGCCGG - Intergenic
1123410385 15:20054102-20054124 ATCCTGTGCACACTGGGGAGGGG + Intergenic
1123519717 15:21060809-21060831 ATCCTGTGCACACTGGGGAGGGG + Intergenic
1123750947 15:23357964-23357986 AACATGAGCCCAAAAAGGAGAGG - Intronic
1124166094 15:27327363-27327385 AATCTGAGACCACAAGGAAGAGG + Intronic
1124283319 15:28381880-28381902 AACATGAGCCCAAAAAGGAGAGG - Intronic
1124299379 15:28529733-28529755 AACATGAGCCCAAAAAGGAGAGG + Intronic
1124637056 15:31371995-31372017 CCCCTGTGCCCACAGGTGAGAGG + Exonic
1125750533 15:42024580-42024602 TTGCTGGGCCCACAGGGGAGTGG - Intronic
1126848778 15:52785347-52785369 GACCTGAGCCAAGGGGGGAGGGG - Intronic
1129069212 15:72937084-72937106 AACCCAAGCCCAGAAGGGAGGGG + Intergenic
1129192364 15:73944938-73944960 ATCCTAAGGCCAGAGGGGAGCGG - Intronic
1129745387 15:78015923-78015945 CACCTGGGCCTACAGGGGTGGGG + Intronic
1130614445 15:85391566-85391588 CACTTGAGCCCAGAAGGGAGAGG - Intronic
1130992018 15:88881302-88881324 GACCTGAGAGCAGAGGGGAGAGG - Intronic
1132759762 16:1502911-1502933 CACCTGAGGACACAGGGGAGAGG - Exonic
1132810192 16:1793564-1793586 ACCCTGAGCCCGCTGGGGAGAGG - Intronic
1133208581 16:4249405-4249427 AACCTGTGCTGACAGAGGAGGGG - Intergenic
1133379221 16:5315963-5315985 AACTTGAGACCACAGGGGTCAGG - Intergenic
1133539477 16:6735286-6735308 AACATGAACCCACTGGTGAGTGG - Intronic
1133864698 16:9631819-9631841 AAACTTAGCTCACAGGGGAAAGG - Intergenic
1134861127 16:17561421-17561443 AATCTGTGCCCCCAGGAGAGTGG - Intergenic
1135007801 16:18842744-18842766 CACCTGAGCCCAGGGGGCAGAGG + Intronic
1135264109 16:21007290-21007312 CACCTGAGCCCAGAAGGCAGGGG - Intronic
1137288751 16:47037654-47037676 AATCTGAGTCCAGTGGGGAGAGG + Intergenic
1138340664 16:56287074-56287096 CACCTGGGACCTCAGGGGAGAGG - Intronic
1138590879 16:57999135-57999157 AACCAGAGCCCATAGGTGATGGG + Intronic
1138630045 16:58286323-58286345 AACTTGAGTCCAAAGGGGTGAGG - Intronic
1139158852 16:64478546-64478568 AAGCTGAGTCCAAAGGGCAGAGG + Intergenic
1139802511 16:69534905-69534927 AAACTGAGCCCAAAGAGGAGAGG - Intergenic
1140135144 16:72199141-72199163 CACCTGAACCGACAGGGGAGAGG - Intergenic
1140589504 16:76335079-76335101 AAACTGAGGTCACAGGGGAATGG + Intronic
1140699594 16:77569000-77569022 AACCAGAGCAGACAGGGAAGGGG - Intergenic
1141381823 16:83583831-83583853 CACTTGAGCCCACGAGGGAGAGG + Intronic
1141448160 16:84077139-84077161 CACCTGAGCCCAGATGGCAGAGG + Intronic
1141717175 16:85733738-85733760 AGGCTGACCCCACAGAGGAGTGG - Intronic
1142193164 16:88727122-88727144 CAGCTGAGCGCACAGAGGAGTGG - Exonic
1142382106 16:89738750-89738772 GGCCTCAGACCACAGGGGAGGGG + Intronic
1142759866 17:2035950-2035972 AACCTGCGGGCACAGGGGCGGGG - Exonic
1142916345 17:3142398-3142420 AGGCTGAGCTCCCAGGGGAGGGG - Intergenic
1143733370 17:8893958-8893980 GACCTGAGCCACAAGGGGAGTGG - Intronic
1146216710 17:30982249-30982271 CACTTCAGCCCACAGTGGAGAGG + Intronic
1147254562 17:39174301-39174323 ACCCTGAGGCCCCAGGGGAGAGG - Exonic
1147257862 17:39192777-39192799 GACCTGAGGCCCCTGGGGAGAGG - Intronic
1147257988 17:39193531-39193553 AACCCGAGCCCCCAAGGGAACGG - Intronic
1147983153 17:44287751-44287773 AGCCTGAGCCCCCAGTGGATGGG - Intergenic
1148766010 17:50038546-50038568 AATCTAAGGCCACAGGAGAGGGG - Intergenic
1148874276 17:50677477-50677499 TATCTGAGGCCACAGAGGAGAGG + Intronic
1150448176 17:65243844-65243866 AGCCTGACTCCATAGGGGAGTGG - Intergenic
1150584518 17:66505316-66505338 AACCTCTGGCCACAGGGAAGAGG + Intronic
1151683540 17:75634188-75634210 CACCTGAGCTCCCAGGTGAGTGG + Intronic
1152288255 17:79424650-79424672 TGCCTGAGGCCAGAGGGGAGAGG - Intronic
1152420919 17:80192710-80192732 ACCCTGTCCCCACAGGGAAGAGG + Intronic
1152771217 17:82170593-82170615 CACATGAGCACGCAGGGGAGAGG + Intronic
1152792342 17:82288138-82288160 CACGTGAGCACACAGAGGAGAGG + Intergenic
1152908557 17:82984033-82984055 CACGTGAGCACACAGGAGAGAGG + Intronic
1152908613 17:82984279-82984301 CACGTGAGCACACGGGGGAGAGG + Intronic
1153050504 18:898969-898991 AGCCTGAGCCCAAAGGGCAGAGG + Intergenic
1154082126 18:11267874-11267896 AAGATGAACCCCCAGGGGAGAGG + Intergenic
1155085779 18:22456617-22456639 AACTTGAGCCCTGAGTGGAGAGG + Intergenic
1156307123 18:35887714-35887736 CCCCTAAGCCCACAGGGGAAAGG + Intergenic
1157367193 18:47075825-47075847 AACCTGATGCCACAGAGAAGTGG - Intronic
1157712532 18:49859786-49859808 AAGCTGGGCCCTCTGGGGAGGGG + Intronic
1158690059 18:59652389-59652411 AGCCTGAGCCCAAAGGTGAATGG + Intronic
1160201780 18:76802045-76802067 AACCTGGGCCCACGTGGGAGTGG + Intronic
1160751716 19:737545-737567 AACCAGAGGGCTCAGGGGAGGGG + Intronic
1160875067 19:1293106-1293128 AAACTGAGGCCAGAGGGCAGTGG + Intronic
1161204210 19:3032319-3032341 CACCTGAGCCCAGAAGGCAGAGG - Intronic
1161250443 19:3276914-3276936 AATCTGAGACCACAGGGCACAGG - Intronic
1161614754 19:5263886-5263908 CACCTGTGCCCACAGGCGGGAGG + Intronic
1162066033 19:8126074-8126096 AACTTGAGACCCCAGGGGAATGG - Intronic
1162312692 19:9916497-9916519 AAACTGAGCTCAGAGAGGAGAGG + Intronic
1163958399 19:20664967-20664989 GACCTGAGCCCCTAGGGGAAGGG - Intronic
1164759843 19:30720417-30720439 GACCTGAACCAAGAGGGGAGTGG + Intergenic
1165266961 19:34668432-34668454 CACAGGAGCCCACAGAGGAGGGG - Intronic
1166366869 19:42282243-42282265 AACCTGAGCCCAAAAGGGAAGGG - Intronic
1167049239 19:47068520-47068542 AGCCTGGGCCATCAGGGGAGCGG + Intronic
1167051500 19:47081724-47081746 AATCTGAGCCCAGAGAGGTGAGG + Intronic
1167993831 19:53386297-53386319 GATCTGAATCCACAGGGGAGTGG - Intronic
1168147042 19:54425431-54425453 CACCTGAGAGCACAGGGGAAGGG - Intronic
925827172 2:7860758-7860780 AACTTGACTCCACAGGGAAGGGG + Intergenic
926693939 2:15757545-15757567 AACGTGAGCTCAGAGGGGTGTGG - Intergenic
927651307 2:24915244-24915266 AGCCAGAGCCGACAGGGGATGGG + Intronic
928335607 2:30395453-30395475 ATCCTAAGGCCACAAGGGAGTGG - Intergenic
930189269 2:48441040-48441062 AACCTGAGGCCGCAGGGCGGGGG - Intronic
930526960 2:52542497-52542519 CACCTTAGCCCACAGTGGCGAGG - Intergenic
931462728 2:62462482-62462504 CACCTTAGCCCAGTGGGGAGGGG - Intergenic
931552586 2:63462958-63462980 AACCTTGGAGCACAGGGGAGAGG + Intronic
931774676 2:65530384-65530406 CACCTGTGCCAACAGTGGAGAGG + Intergenic
934036842 2:88095462-88095484 CACCTCAGACCACAGGGAAGGGG + Intronic
935650103 2:105374566-105374588 AAACTGAGCACACATGAGAGAGG + Intronic
937238927 2:120447775-120447797 AAAATGAGTCCAGAGGGGAGAGG + Intergenic
937277885 2:120697293-120697315 CACCTGAGCCCAGAAGGCAGAGG + Intergenic
937887139 2:126907729-126907751 AACATCTGCCCACACGGGAGGGG - Intergenic
938033745 2:128018399-128018421 CACCTGAGCCCAAAAGGCAGAGG + Intronic
938555404 2:132418887-132418909 TTCCTGATGCCACAGGGGAGAGG - Intronic
938947578 2:136227007-136227029 AAACACAGCCCACAGGAGAGTGG - Intergenic
938984522 2:136561164-136561186 ATCCTTACCCCACAGGTGAGGGG + Intergenic
940410767 2:153360724-153360746 AACCTGAGCCCCTAGGGGGAGGG + Intergenic
940792105 2:158039880-158039902 AGACTGAGGCCCCAGGGGAGGGG + Intronic
941874648 2:170420331-170420353 AAGCTGAGTCCACATGGGTGAGG + Intronic
942418481 2:175783150-175783172 ACCCTGAGCACAAAGGGCAGGGG - Intergenic
942604871 2:177679956-177679978 AACTAGAGCCCTCTGGGGAGAGG + Intronic
943018559 2:182545262-182545284 AAGCTGGGACCACAGGGGATGGG - Intergenic
944517982 2:200531502-200531524 AATCTGTGTCCTCAGGGGAGAGG + Intronic
946361155 2:219220068-219220090 AACCTGTGCCAACTGTGGAGTGG - Exonic
946848117 2:223879101-223879123 CACCTGAGCCCAGAAGGCAGAGG + Intronic
947542759 2:230990287-230990309 AGCCCGAGCCCAGAGGGGCGAGG + Intergenic
948460795 2:238129017-238129039 CAGCTGAGGCCACAGAGGAGAGG - Intronic
948561379 2:238855893-238855915 AACATGAGCCCACGAAGGAGAGG - Intronic
948601513 2:239110190-239110212 AACCTGCCACCACTGGGGAGTGG + Intronic
948824441 2:240567589-240567611 AGCCTGAGCCCCGAGGGAAGGGG - Intronic
1172886327 20:38233549-38233571 TACCTGAGCCCATGGGGGACTGG - Intronic
1173464176 20:43268148-43268170 AACCTGTCCCCACAGAGGACAGG - Intergenic
1173581937 20:44153329-44153351 AAAGTGAGCCCAGAGGGGTGAGG + Intronic
1174067943 20:47879051-47879073 AACCTGCACCCTCAAGGGAGAGG - Intergenic
1174500826 20:50982692-50982714 AAACTGAGGCCAGAGAGGAGGGG - Intergenic
1175551409 20:59820311-59820333 AACCTCAGCCCTAAAGGGAGGGG + Intronic
1176047569 20:63100758-63100780 AAATTGAGCACACAGGGGTGGGG + Intergenic
1176059667 20:63167029-63167051 GACCTGGGCCTCCAGGGGAGTGG - Intergenic
1178161972 21:29928445-29928467 AACCTGTGCCCACAGGCAGGTGG + Intronic
1179449874 21:41461134-41461156 ATCCAGAGCCGAGAGGGGAGTGG + Intergenic
1179972800 21:44845721-44845743 ACCCTGAGCCCAGAGAGGCGTGG - Intergenic
1180963366 22:19772948-19772970 AGCCTGAGGCGACAGGGAAGGGG - Intronic
1181303773 22:21902361-21902383 AACCATAACCCACAGAGGAGTGG - Intergenic
1183101337 22:35585891-35585913 TTCCTGACCCCGCAGGGGAGGGG - Intergenic
1183187245 22:36299276-36299298 CACCCAAGCCCACAGGGGAAGGG - Intronic
1183208161 22:36433436-36433458 CAGCTGAGCAAACAGGGGAGTGG - Intergenic
1183452555 22:37905163-37905185 CCCCTGAGCACTCAGGGGAGTGG - Intergenic
1183509943 22:38228802-38228824 CATCTGAGCCCACAGGGCTGGGG + Intronic
1183958392 22:41396264-41396286 ACCCTGAGCGCCCAGGAGAGAGG - Exonic
1184092964 22:42301976-42301998 AACCTAAGCCCCCAGAGGAAAGG + Intronic
1184960060 22:47922150-47922172 CACCTGAGACCACTGGGGTGAGG - Intergenic
949239508 3:1853091-1853113 AGTATGATCCCACAGGGGAGAGG - Intergenic
950415213 3:12865338-12865360 GACCTCAGCCCATGGGGGAGTGG + Intronic
950544620 3:13630984-13631006 AACCTGAGGTCAGAGTGGAGAGG - Intronic
952443875 3:33361425-33361447 CACCTGAGCCCAGGGGGCAGAGG + Intronic
953600982 3:44364656-44364678 CACCTGAGCCCAGGGGGCAGAGG + Intronic
953958221 3:47247516-47247538 AACCTGAGCCCACAGGGGAGTGG + Intronic
954431114 3:50471324-50471346 AACATGTGCCCACAGGAGACAGG - Intronic
955059888 3:55485349-55485371 CACCGGAGCGCACGGGGGAGGGG + Intronic
956580545 3:70807567-70807589 CACCTGAGCCCAGAAGGCAGAGG - Intergenic
958644515 3:96852343-96852365 AACTTGAGCCCAGAAGGCAGGGG + Intronic
961168427 3:124779429-124779451 TGCCTGAGACCACAGGGTAGGGG - Intronic
961753503 3:129112169-129112191 CACCTGAGCCCAAGGGGCAGAGG + Intronic
962235092 3:133700621-133700643 AGCCTCAGCCCACAGTGGAAAGG + Intergenic
963038049 3:141049502-141049524 AACTGGAGCCCCCAAGGGAGGGG + Intergenic
964487249 3:157198798-157198820 CACCTGAGCCCAGAAGGCAGAGG - Intergenic
965580693 3:170264685-170264707 AACCAGAGTCCACAGTGGAACGG + Intronic
967247566 3:187503354-187503376 CACTTGAGCCCACAGGCCAGAGG - Intergenic
968074377 3:195808573-195808595 AAACTGAGCCCAGGGGGAAGGGG - Intronic
968081038 3:195847253-195847275 AAACGGAGCCCAAAGGGGTGTGG - Intergenic
968540637 4:1166573-1166595 AAGCTGCTCCCACAGAGGAGGGG + Intergenic
968935080 4:3605563-3605585 TGCCTCAGCCCACGGGGGAGGGG - Intergenic
968960959 4:3743453-3743475 GACTTGAGCCCCCAGGGGTGGGG + Intergenic
969268523 4:6082132-6082154 AACCTGAGCCCAAAGAGAGGAGG + Intronic
970152712 4:13106890-13106912 AACCTGAGCAACCTGGGGAGTGG + Intergenic
970666468 4:18342844-18342866 GGCCTGAGCCCCTAGGGGAGGGG - Intergenic
972420004 4:38878212-38878234 CAGCTGACCCCAGAGGGGAGGGG + Exonic
973685225 4:53363217-53363239 AACTTGAGCCCAGAAGGCAGAGG - Intronic
975132492 4:70842961-70842983 AACCGGAGCCCACAAGGTTGAGG + Intergenic
977694484 4:99950599-99950621 GAGCTGAGACCTCAGGGGAGGGG + Intergenic
977934475 4:102785559-102785581 AACTTGAGGCCCAAGGGGAGAGG - Intergenic
978848227 4:113300659-113300681 AACCTGAGCCAAGAGAAGAGGGG + Intronic
982222706 4:153138421-153138443 AACCAGAACCCACAGGCCAGGGG - Intergenic
982224981 4:153156865-153156887 AGCCCTAACCCACAGGGGAGAGG - Intronic
982989666 4:162255952-162255974 AACCTAATCCCACAGGGGACGGG + Intergenic
983591272 4:169413931-169413953 CACCTGAACCCAGAGGGCAGAGG + Intronic
985531956 5:438957-438979 TGCCTGAGGCCACAGAGGAGAGG - Intergenic
986223549 5:5792205-5792227 GCCCTGTGGCCACAGGGGAGAGG - Intergenic
987187586 5:15440959-15440981 AACATGAGCCCCCCGGGAAGTGG - Intergenic
989741712 5:44781224-44781246 AAAAAGAGCCCACAGGGGAAAGG - Intergenic
990218494 5:53561054-53561076 AACCTTAGCCCTCAGAGAAGGGG + Intronic
990218860 5:53564620-53564642 CACCTGAGCCCAGAGGGTGGAGG - Intronic
990256997 5:53981046-53981068 AACCCGACTGCACAGGGGAGTGG + Intronic
991070784 5:62478247-62478269 CACTTGAGCCCACAAGGCAGAGG - Intronic
994376952 5:99025860-99025882 CACCTGAGCCCATGGGGTAGAGG - Intergenic
995934007 5:117486398-117486420 AACCTGAAGCCACAGTGGAAAGG - Intergenic
996775287 5:127126321-127126343 AATATGAGCCCAAAGGTGAGTGG - Intergenic
997159219 5:131589549-131589571 AAGCTGAGCAGCCAGGGGAGTGG + Intronic
997288075 5:132698412-132698434 AACCAGTGCCCAAAGGAGAGGGG + Intronic
997971473 5:138406259-138406281 CACCTGAGCCCAGAAGGGTGAGG + Intronic
1000116964 5:158162425-158162447 GACCTGAGCCCAGAATGGAGGGG - Intergenic
1000565302 5:162839818-162839840 AACCAGAGGCCAGAGGTGAGTGG + Intergenic
1001207438 5:169777461-169777483 AACCAGACGCCACAGTGGAGAGG + Intronic
1001412758 5:171522452-171522474 AACCTGAGACCGCAGGGAAATGG - Intergenic
1001421308 5:171589370-171589392 AACCAGATTCCACAGGGAAGGGG - Intergenic
1001929749 5:175664533-175664555 GACCTGAGACCCCAGGGCAGTGG + Intronic
1002106772 5:176883218-176883240 ACCCTGTGTCCACAGGGGACTGG - Intronic
1004470263 6:15922638-15922660 AGCCTGAGCCAGCAGGGCAGAGG - Intergenic
1004558870 6:16728258-16728280 AAGCTGTGCGCACAGGGCAGTGG + Intronic
1004643099 6:17534624-17534646 CAGCAGAGCCCACAGGAGAGGGG - Intronic
1004763331 6:18695868-18695890 AAACTGAGCCCTCAGGGAAATGG - Intergenic
1006849728 6:37089634-37089656 AACCAGAGCCCAAAGGAAAGGGG + Intergenic
1007483176 6:42163283-42163305 GACCTGAGGTCACAGGGGTGAGG - Exonic
1008617868 6:53243622-53243644 AACCTGAGACTCCAGGGGTGGGG - Intergenic
1008741598 6:54615274-54615296 GGCCTGAGCCCATTGGGGAGGGG + Intergenic
1010197997 6:73258967-73258989 AACGGGAGCCCACTGGTGAGAGG + Intronic
1010413485 6:75587380-75587402 TACATGAGCCCACAAGGCAGAGG - Intergenic
1011567868 6:88697785-88697807 AACTTGAGCCCAGGGGGCAGAGG + Intronic
1012178915 6:96126080-96126102 AACCTGCGCCGACATGAGAGAGG - Intronic
1013002735 6:106040585-106040607 CACCTGAGCCCACAGGATACAGG - Intergenic
1016175423 6:141072968-141072990 CACCTGAGCCCAGAGGGTCGAGG + Intergenic
1017421950 6:154281918-154281940 AACCTGAACCCAGAAGGTAGAGG + Intronic
1017817743 6:158027672-158027694 CACCTGTGCCCCCAGGGGAGGGG - Intronic
1018039817 6:159911848-159911870 CCCCTGAGCACACAGGGGAGAGG - Exonic
1018151482 6:160944140-160944162 ACACTGAGCTCACAGGTGAGTGG + Intergenic
1018492414 6:164307631-164307653 AACCTGGGCCCAGATGGCAGTGG + Intergenic
1018989553 6:168663127-168663149 AACCTGAGCCCACCAGTGAGTGG + Intronic
1019786910 7:2982924-2982946 CACCTGAGGCCACAGAGGAGAGG + Intronic
1019995658 7:4722841-4722863 AACCGGAGCCCAAACGAGAGAGG - Intronic
1022547164 7:31200273-31200295 AGCCTGAGCCCCCTGAGGAGTGG - Intergenic
1022603194 7:31781352-31781374 AACCAGATCCCACAGGGCAGAGG + Intronic
1023706082 7:42943111-42943133 AAACTGAGCCCCGAGGAGAGGGG + Intronic
1024121437 7:46245277-46245299 AACCTGAGCATACAGGAGACAGG - Intergenic
1024414113 7:49082165-49082187 ACCCTGAGCCCAGAGAGCAGAGG - Intergenic
1025942048 7:66082029-66082051 AGCCTGGGGCCACAGGGAAGGGG - Intronic
1027187473 7:75980807-75980829 AGCCTCAACCCACAGGGAAGCGG - Intronic
1027714884 7:81657926-81657948 AACTTGAGACCACAGAGTAGAGG - Intergenic
1029064600 7:97836969-97836991 ATCCTGAGGCAACAGGGCAGCGG - Intergenic
1029068124 7:97872491-97872513 AACCAGCGCGCACAGGGGCGGGG + Exonic
1029955136 7:104630849-104630871 AAACTGAGCCCTAAGGGTAGTGG - Intronic
1031332745 7:120486333-120486355 AACCTGAGCCTTCAGGGGGTGGG + Intronic
1032159135 7:129497328-129497350 TCCCTGAGCCAGCAGGGGAGGGG + Intergenic
1032745933 7:134786015-134786037 AATCTAAGCTCAGAGGGGAGGGG + Intronic
1033628321 7:143132657-143132679 AATCTCAGACCACAGGGCAGTGG - Intronic
1034537048 7:151731919-151731941 CACTTGAGCCCACAAGGCAGAGG - Intronic
1035104462 7:156430290-156430312 AACCTGGCGCCACTGGGGAGAGG - Intergenic
1035129520 7:156639814-156639836 AGCCCGAGCTCACAGGGGCGGGG + Exonic
1035252210 7:157604908-157604930 AAGCAGAGCTCACAGAGGAGTGG + Intronic
1035491728 7:159285026-159285048 GGCCTGAGCCCCTAGGGGAGGGG + Intergenic
1035522581 8:287113-287135 AACCTGCCCCGACAGTGGAGTGG + Intergenic
1036208013 8:6819385-6819407 AGCCTGAGGCCACAGTGCAGTGG - Intronic
1037393240 8:18416435-18416457 ACCATGAGCCCAGAGGGCAGAGG - Intergenic
1037827584 8:22168454-22168476 GGCCTGACCCCACAGGGGTGGGG + Intronic
1039685895 8:39801655-39801677 AGCCTGAGCCCCCAGGGGGAGGG - Intronic
1041898247 8:62951540-62951562 AGTTTGAGCCCACAGGGCAGAGG - Intronic
1042510592 8:69607446-69607468 AACCTGAGCCCAGGAGGGCGAGG - Intronic
1044475134 8:92617148-92617170 AACCTCAGCCTACAGGAGACAGG - Intergenic
1045811914 8:106231692-106231714 AAACTGAGTCCACAGGGGGCTGG - Intergenic
1047383642 8:124387792-124387814 AAACTGAGCAGACTGGGGAGAGG + Intergenic
1047880375 8:129186274-129186296 AACCAGCTCCCACAGGGAAGGGG - Intergenic
1048325115 8:133433061-133433083 AACCTGAGCTGACAGGTGAGAGG + Intergenic
1049511305 8:143028156-143028178 AACCTCAACCTGCAGGGGAGGGG + Intergenic
1053193849 9:36099140-36099162 CACCTGAGCCCACAAGGTCGAGG + Intronic
1054455096 9:65426414-65426436 TGCCTCAGCCCACGGGGGAGGGG + Intergenic
1057275900 9:93675834-93675856 AACCTGAGCCCACCAGGTGGGGG - Intronic
1059419704 9:114183301-114183323 ACCCAGAGCCTTCAGGGGAGTGG + Intronic
1059437508 9:114285496-114285518 CAGCTGAGCCAGCAGGGGAGGGG - Intronic
1060776671 9:126379770-126379792 AGCCTGAGCCCACTGGGCTGGGG + Intronic
1061608776 9:131732048-131732070 TACCTTAGCTCACAGAGGAGGGG + Intronic
1061856394 9:133443992-133444014 AACTGAAGCCCACAGAGGAGGGG - Intronic
1062026427 9:134342739-134342761 AACCTGGCCCCATAGGAGAGTGG + Intronic
1062105594 9:134753219-134753241 AAGTTGAGGCCACAGGGCAGGGG - Intronic
1062324068 9:136004159-136004181 GATCTGAGCACACAGGGGTGGGG - Intergenic
1062459429 9:136656706-136656728 AAACTGAGGCCCCATGGGAGTGG - Intergenic
1062484473 9:136768218-136768240 CAGGTGAGCCCACAGGGCAGGGG + Intergenic
1186180651 X:6969587-6969609 CATCTGGGCCCACAGGGCAGTGG + Intergenic
1186361649 X:8848625-8848647 TAACTGTGGCCACAGGGGAGTGG - Intergenic
1186430970 X:9503795-9503817 GGCCTCAGCCCATAGGGGAGGGG + Intronic
1189146435 X:38659908-38659930 CACTTGAACCCACAGGGCAGAGG - Intronic
1189198001 X:39167776-39167798 AACCTCAGCACACTGGGAAGAGG + Intergenic
1189955564 X:46273922-46273944 AACCTTAGCCAATAGGGGAAGGG + Intergenic
1192947767 X:75984449-75984471 ATCCTTAGCCCACAGGCCAGAGG + Intergenic
1194025564 X:88746451-88746473 CACAGGAGCCCACAGAGGAGGGG + Intergenic
1194177250 X:90665558-90665580 AAACTGAGCCCACTGGGGGAGGG + Intergenic
1195458879 X:105101131-105101153 ATCATGTGCCCACTGGGGAGAGG - Intronic
1195983152 X:110601257-110601279 AACCTGAGCTCATAGGGGGAGGG + Intergenic
1196817571 X:119677381-119677403 AACCAACGGCCACAGGGGAGGGG + Intronic
1198399638 X:136256517-136256539 AGCCTGAGCTCACCAGGGAGGGG + Intergenic
1200831302 Y:7690412-7690434 AACCTGGGTCCACATGGGTGTGG + Intergenic