ID: 953968331

View in Genome Browser
Species Human (GRCh38)
Location 3:47327297-47327319
Sequence ATCAAAGACACCCAAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 663}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953968331 Original CRISPR ATCAAAGACACCCAAAAATA AGG Intronic
901097806 1:6696428-6696450 GTCAAAGTCACCCACAAAGAAGG - Intronic
901866867 1:12112092-12112114 ATCAAAAACCCACAAACATAAGG - Intronic
903308599 1:22433452-22433474 AAAAAAGACAGCTAAAAATATGG + Intergenic
903710607 1:25321060-25321082 ATCAAAGACACTTAAAAAGATGG + Intronic
903716488 1:25371350-25371372 ATCAAAGACACTTAAAAAGATGG - Intronic
904072248 1:27810180-27810202 ATCACAGACACACAAAACAAGGG - Intronic
905896950 1:41554168-41554190 AACAAAGCCTCCAAAAAATATGG - Intronic
905962984 1:42060702-42060724 AACAAAGCCTCCAAAAAATATGG + Intergenic
906753093 1:48284100-48284122 AACAAAGCCACCAAGAAATATGG - Intergenic
908723939 1:67155461-67155483 AACAAAGCCTCCAAAAAATATGG - Intronic
908869744 1:68595569-68595591 ATCAAAGACATTGAAAAATACGG - Intergenic
909114335 1:71515044-71515066 AGCAAAGCCTCCAAAAAATATGG + Intronic
909216740 1:72900100-72900122 AGCAAAGCCTCCAAAAAATATGG + Intergenic
909240482 1:73206420-73206442 AACAAAAACTCCCAGAAATATGG + Intergenic
909298768 1:73984236-73984258 TATAAAGATACCCAAAAATATGG - Intergenic
909301272 1:74015834-74015856 AACAAAGACTCCAAGAAATATGG + Intergenic
909390175 1:75111534-75111556 AGCAAAGCCACCAAGAAATATGG - Intergenic
909405158 1:75280975-75280997 TATAAAGACACCCAAAAATGTGG + Intronic
909682796 1:78311490-78311512 AACAAAGCCTCCAAAAAATATGG + Intronic
909757157 1:79240625-79240647 TATAAAGACACCCAAAAATGTGG - Intergenic
909918055 1:81345202-81345224 ATGAAACAAACCCAAATATAGGG + Intronic
910091292 1:83467380-83467402 ATCAATGAAACCTAAAAATCAGG + Intergenic
910426769 1:87126538-87126560 AGGAAAGCCACCTAAAAATACGG - Intronic
910954203 1:92683872-92683894 AACAAAGACTCCAAGAAATATGG + Intronic
911156398 1:94641786-94641808 AACAATGACACCCACAAATAAGG - Intergenic
911790822 1:102013684-102013706 TGTAAAGATACCCAAAAATATGG + Intergenic
912464169 1:109858451-109858473 AACAAAGACTCCAAGAAATATGG + Intergenic
912861356 1:113216646-113216668 AGCAAAGACAACCAATAATTTGG + Intergenic
912997011 1:114540950-114540972 ATCTAAAACAAACAAAAATAAGG - Intergenic
913607533 1:120479635-120479657 AACAAAGACTCCAATAAATATGG + Intergenic
914208894 1:145560503-145560525 AACAAAGACTCCAATAAATATGG - Intergenic
914369280 1:147007990-147008012 AACAAAGACTCCAATAAATATGG + Intergenic
914375043 1:147065378-147065400 AACAAAGCCTCCCAGAAATATGG + Intergenic
914463287 1:147904409-147904431 ATCAAGGATACCCAAACATAAGG + Intergenic
914583658 1:149042199-149042221 AACAAAGACTCCAATAAATATGG - Intronic
915377464 1:155409811-155409833 ATCAAAGAAATCCAAAATGAAGG + Intronic
915846379 1:159270032-159270054 AACAAAGCCTCCAAAAAATATGG + Intergenic
916035707 1:160920923-160920945 TGTAAAGATACCCAAAAATATGG + Intergenic
916460665 1:165021090-165021112 AACAAAGCCACCAAGAAATATGG - Intergenic
916650433 1:166829989-166830011 AAAAAAGATACCCAAAAATTTGG + Intergenic
917478459 1:175389125-175389147 ATCACAGACACTCCAAAATTTGG + Intronic
918069187 1:181122531-181122553 AGGAAAGACACCCAAGAACAAGG - Intergenic
919332746 1:196192245-196192267 AACAAAGTCTCCAAAAAATATGG - Intergenic
919362399 1:196611470-196611492 TGAAAAGATACCCAAAAATATGG + Intergenic
919412088 1:197258285-197258307 ATGAAATACACGCAAAAAAAAGG - Intergenic
919412770 1:197266780-197266802 ATTAAAGACACCCTAACAGAAGG + Intergenic
919523946 1:198623964-198623986 ATAAACGACTCCCAAAATTAGGG + Intergenic
919693054 1:200544638-200544660 CTCAAAGAAACGGAAAAATAAGG + Intergenic
919933679 1:202237378-202237400 AGCAGGGACAGCCAAAAATAAGG + Intronic
920647675 1:207815393-207815415 TTCAAAGAAACCCCAAAATTAGG + Intergenic
921241722 1:213191289-213191311 ATTGAAGACACACAAAAAAAGGG - Intronic
921655215 1:217726703-217726725 AAAAAAAACACACAAAAATATGG - Intronic
922610891 1:226926704-226926726 AACAAAGCCTCCAAAAAATATGG - Intronic
923061094 1:230475300-230475322 AACAAAGCCACCAAGAAATATGG - Intergenic
923669065 1:236024683-236024705 ATCAAAGACAACCGAAAAAAGGG + Intronic
923945102 1:238876839-238876861 TTTAAAAGCACCCAAAAATAAGG - Intergenic
1065347851 10:24765801-24765823 TGAAAAGAAACCCAAAAATATGG - Intergenic
1065908367 10:30279594-30279616 TGTAAAGACACCCAAAAATATGG + Intergenic
1066158492 10:32703686-32703708 AACAAAGACTCCAAGAAATATGG - Intronic
1066173118 10:32873209-32873231 AACAAAGACTCCAAGAAATATGG - Intronic
1066225959 10:33383837-33383859 AACAATGACACACAAAAATCAGG + Intergenic
1066272767 10:33839665-33839687 TTCAAAGACAGACAAAAATCTGG + Intergenic
1066298285 10:34075264-34075286 ATCACAGAGACCCAAATACATGG - Intergenic
1066451756 10:35536416-35536438 TGAAAAGATACCCAAAAATATGG + Intronic
1067225002 10:44369935-44369957 ATCAAAGACACTCAGAGAAAAGG + Intergenic
1067326030 10:45267269-45267291 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1068222171 10:54058199-54058221 TGGAAAGAGACCCAAAAATATGG - Intronic
1068283924 10:54910392-54910414 AACATAGACACTCAAATATAAGG - Intronic
1068363046 10:56005443-56005465 ATCAAAGAAATCCCAATATAGGG + Intergenic
1068908591 10:62354246-62354268 ATCACAAAAACCTAAAAATATGG - Intergenic
1068942677 10:62695002-62695024 ATCATAGAAACCCACAATTAAGG + Intergenic
1069093332 10:64228655-64228677 AACAAAGCCTCCAAAAAATATGG - Intergenic
1069139789 10:64809114-64809136 AACAAAGCCTCCAAAAAATATGG - Intergenic
1069339768 10:67397087-67397109 TGTAAAGACACCCAAAAATATGG + Intronic
1070343521 10:75520348-75520370 AACAAAGCCTCCAAAAAATATGG - Intronic
1070974216 10:80592397-80592419 ATCATAAACAACCAAAAAAATGG - Intronic
1070984719 10:80678786-80678808 ATCAAAGCCTCACAAAAATGTGG - Intergenic
1071247778 10:83783917-83783939 ATCAAATAGACACAAAAAAAAGG - Intergenic
1072178676 10:92957035-92957057 ATAAAAGACACTTAACAATATGG + Intronic
1072379884 10:94857187-94857209 AACAAAGCCTCCAAAAAATATGG - Intergenic
1072399304 10:95080547-95080569 AGCAAAGCCACCAAGAAATATGG + Intergenic
1073975396 10:109095149-109095171 AACAAAGACACCAAGAAATATGG - Intergenic
1074900118 10:117809098-117809120 ATCAAACAAACCCAAAATGAGGG + Intergenic
1075209906 10:120482153-120482175 TGAAAAGACACCCAAAAATGTGG + Intronic
1075805232 10:125183625-125183647 AACAAAGCCTCCCAGAAATATGG - Intergenic
1078201557 11:9188420-9188442 TTAAAAGATACCCAAAAATGTGG + Intronic
1078255789 11:9657781-9657803 AACAAACACACACAAAAAAACGG - Intergenic
1078321738 11:10341082-10341104 AACAAAGCCACCAAGAAATATGG + Intronic
1078690126 11:13571295-13571317 AACAAAGCCTCCAAAAAATATGG + Intergenic
1078951827 11:16142821-16142843 AACAAAGCCACCAAGAAATATGG + Intronic
1078959666 11:16249588-16249610 TACAAAGATACCCAAAAATGTGG - Intronic
1079232430 11:18660223-18660245 AACAAAGCCACCAAGAAATATGG + Intergenic
1079595266 11:22236990-22237012 ATCAAAAACACCCAGAAATTAGG - Intronic
1079873885 11:25832741-25832763 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1079880685 11:25922760-25922782 AGAAAAGATACCCAAAAATGTGG - Intergenic
1080958425 11:37129596-37129618 TGAAAAGATACCCAAAAATATGG + Intergenic
1081180988 11:39985509-39985531 AACAAAGCCTCCAAAAAATATGG + Intergenic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1081224410 11:40502305-40502327 TGAAAAGATACCCAAAAATATGG - Intronic
1081302776 11:41473379-41473401 TTCAAAAACAACCACAAATATGG + Intergenic
1081315672 11:41626282-41626304 CACAAAGATACCCAAAAATGTGG - Intergenic
1081404158 11:42676988-42677010 TTTAAAGACACCAAAACATAGGG - Intergenic
1082903477 11:58281978-58282000 AACAAAGCCACCAAGAAATATGG - Intergenic
1086513979 11:87590433-87590455 AACAAAGCCTCCCAGAAATATGG + Intergenic
1086657706 11:89380558-89380580 AAAACAGGCACCCAAAAATAAGG + Intronic
1087255654 11:95949528-95949550 TGCAAAGATACCCAAAAATGTGG - Intergenic
1087447178 11:98269596-98269618 TTCAAAGATAACCAAAAATATGG - Intergenic
1087540152 11:99506268-99506290 AACAAAGATACTCAAAATTATGG - Intronic
1087911843 11:103762694-103762716 ATTAAAAATACCCAAAAATCTGG - Intergenic
1088040613 11:105376555-105376577 TGTAAAGATACCCAAAAATATGG - Intergenic
1088552241 11:111024985-111025007 ATAAAAGCCACCAAGAAATAGGG + Intergenic
1088718568 11:112572098-112572120 AACAAAGACCCCAAGAAATAAGG + Intergenic
1091101594 11:132879308-132879330 CTGAAAGACACCAAGAAATAGGG + Intronic
1092532803 12:9359664-9359686 AACAAAGCCTCCAAAAAATATGG - Intergenic
1092788403 12:12050470-12050492 AACAAAGAGCCTCAAAAATATGG + Intronic
1093694917 12:22147974-22147996 AACAAAGACTCCAAGAAATATGG + Intronic
1093836717 12:23840329-23840351 ATTAAAGATACTCATAAATAGGG + Intronic
1093864504 12:24208805-24208827 TTCAAAAACAACCAAAAAAATGG + Intergenic
1094001572 12:25700779-25700801 AACAAAAGCACACAAAAATATGG - Intergenic
1094781472 12:33796498-33796520 TGTAAAGACACCCAAAAATGTGG + Intergenic
1095563132 12:43589182-43589204 ATCAAAGATCCCCAAATAGATGG + Intergenic
1096636236 12:52961464-52961486 ACCAAAGAAACAAAAAAATAGGG - Intergenic
1097131742 12:56816208-56816230 ACCAAAGACACTCAAAATGATGG - Intergenic
1097149977 12:56969763-56969785 AACAAAGACTCCAAGAAATATGG + Intergenic
1097476057 12:60057726-60057748 TTTAAAGATACCCAAAAATGTGG + Intergenic
1097763209 12:63492799-63492821 AACAAAGCCTCCAAAAAATATGG - Intergenic
1097820292 12:64121601-64121623 AACAAAGAAACCCAAAAGAAAGG - Intronic
1097948670 12:65402282-65402304 ATCAAAGCCTCCAAGAAATATGG - Intronic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1098183034 12:67868534-67868556 ATCAAAGCCTCCAAGAAATATGG - Intergenic
1098642495 12:72856102-72856124 AACAAAGCCACCAAGAAATATGG - Intergenic
1098680727 12:73350047-73350069 AACAAAGACTCCAAGAAATATGG - Intergenic
1098865716 12:75761125-75761147 ACCAAAGACACCTGAAAATGGGG - Intergenic
1099099206 12:78416323-78416345 AGCACACACACCCAAAAAAAGGG - Intergenic
1099206131 12:79728953-79728975 AACAAAGATAAGCAAAAATATGG + Intergenic
1099657729 12:85516591-85516613 ATCAAAGGGACACAAAAATGGGG - Intergenic
1099677992 12:85786868-85786890 ATCAAAGGCTCCAAGAAATATGG + Intergenic
1100073776 12:90754152-90754174 AACAAAGCCTCCAAAAAATATGG - Intergenic
1100928493 12:99578380-99578402 ATAAAAGACATCCAAATAAAAGG + Intronic
1101062515 12:100986982-100987004 ATCAATGAAAGCCAAAAATCCGG + Intronic
1101196823 12:102392205-102392227 ATCTAAAATACTCAAAAATAAGG - Intergenic
1101993314 12:109505555-109505577 ATCAAACACACCCAAGAATGTGG - Intronic
1102125495 12:110477045-110477067 ATCAAACAAACCCAAATTTAGGG - Intronic
1102651850 12:114447886-114447908 ACAATAGACAACCAAAAATAAGG + Intergenic
1104079956 12:125421192-125421214 TATAAAGATACCCAAAAATATGG - Intronic
1104559339 12:129829799-129829821 AGCCAAGACAGCAAAAAATAAGG + Intronic
1105244083 13:18632323-18632345 AACAAAGGCTCCAAAAAATATGG + Intergenic
1105650641 13:22373075-22373097 TGTAAAGACACCCAAAAATGTGG - Intergenic
1106190304 13:27446706-27446728 ATCTAAGTGACCCATAAATAAGG + Intronic
1106377289 13:29202175-29202197 AACAAAGCCACCAAGAAATATGG - Intronic
1106779280 13:33040848-33040870 CTCAAAGAAAACAAAAAATAAGG - Intronic
1107554855 13:41508598-41508620 TGAAAAGACACCCAAAAATGTGG - Intergenic
1108207466 13:48105344-48105366 ATCAAAGCCACCCTAAGACATGG + Intergenic
1108719750 13:53118710-53118732 TGAAAAGACACCCAAAAATGTGG - Intergenic
1109480516 13:62946019-62946041 AGAAAAGATACCCAAAAATGTGG - Intergenic
1109584019 13:64374382-64374404 TGTAAAGATACCCAAAAATATGG - Intergenic
1109829336 13:67766201-67766223 ATGAAAGAGACTCAAAAAGAGGG - Intergenic
1111457630 13:88505778-88505800 TACAAAGATACCCAAAAATGTGG + Intergenic
1111917243 13:94373534-94373556 ATCAAAGCCTCCAAGAAATATGG + Intronic
1112492962 13:99883680-99883702 ATAACAGACACACAAAACTAAGG - Intronic
1112925362 13:104667464-104667486 CTGAAAGACACCAAAAAATAAGG + Intergenic
1113300837 13:109017633-109017655 AACAAAGCCTCCAAAAAATATGG - Intronic
1114240401 14:20861577-20861599 AACAAAGCCTCCAAAAAATATGG + Intergenic
1114989911 14:28273487-28273509 TAAAAAGACACCCAAAAATGTGG - Intergenic
1114997448 14:28374002-28374024 ATCACAGAAATTCAAAAATATGG + Intergenic
1115008038 14:28510437-28510459 AACAAAGACTCCAAGAAATATGG - Intergenic
1115135985 14:30108404-30108426 AACAAAGACTCCAAGAAATATGG + Intronic
1115139393 14:30152162-30152184 ATTAAAGAGACCTAAATATATGG + Intronic
1115155910 14:30338764-30338786 TTCAAAGACCCCCAAATATGTGG + Intergenic
1115276916 14:31619953-31619975 AACAAAGCCTCCCAGAAATATGG - Intronic
1115650408 14:35398967-35398989 ATCACACACACACAAAAAAAAGG + Intergenic
1116472655 14:45304278-45304300 AACAAAGCCTCCAAAAAATATGG - Intergenic
1116511747 14:45755286-45755308 AACAAAGACCCCAAGAAATATGG - Intergenic
1116651317 14:47596429-47596451 ATCAAAGAAAAACATAAATATGG - Intronic
1117751787 14:58930979-58931001 TGAAAAGATACCCAAAAATATGG - Intergenic
1117990037 14:61424255-61424277 TATAAAGATACCCAAAAATATGG + Intronic
1120112669 14:80576408-80576430 GTCACACACACACAAAAATAAGG + Intronic
1121483943 14:94299173-94299195 CTAAAAGATACCCAAAAATGTGG - Intergenic
1121667304 14:95682815-95682837 GTTAAAGACAACCCAAAATATGG + Intergenic
1122410647 14:101524329-101524351 ATTAAACACACTCAGAAATAAGG - Intergenic
1124009697 15:25828603-25828625 ATCCAACACACCAAAACATACGG + Intronic
1124204645 15:27706736-27706758 AACAAAGACACACACCAATATGG - Intergenic
1125246383 15:37646161-37646183 TATAAAGATACCCAAAAATATGG + Intergenic
1125461995 15:39916216-39916238 ATCAAAGACTCCAAAAGATCTGG - Intronic
1125789840 15:42356379-42356401 ATCAGAGAAACCCAAATTTAGGG + Exonic
1125838288 15:42773476-42773498 TTCAAAGATATCTAAAAATAAGG + Intronic
1126476459 15:49070019-49070041 ATCAAAACCACCAAGAAATATGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127341784 15:58053434-58053456 ATTACAGACACTCACAAATAAGG + Intronic
1127590810 15:60420995-60421017 ATCAAAGAAACAAATAAATATGG + Exonic
1128416643 15:67452896-67452918 AACAAAGCCTCCAAAAAATATGG - Intronic
1129286299 15:74527984-74528006 ACCAAAGAAAGCCAAAATTAAGG + Intergenic
1129548686 15:76425287-76425309 AACAAAGCCTCCCAGAAATATGG - Intronic
1129580324 15:76802207-76802229 GTCAAAGACATCCAAAAGTTGGG + Intronic
1130241057 15:82191996-82192018 ATCAAATATAGCCAAGAATATGG + Intronic
1130459370 15:84149158-84149180 ATCAAATATAGCCAAGAATATGG - Intergenic
1130688948 15:86063816-86063838 ATCATTCACACTCAAAAATAAGG - Intergenic
1130728529 15:86466166-86466188 AACAAAGACTCCAAGAAATATGG - Intronic
1131849259 15:96521361-96521383 ATAAAAGCCTCCCAAAAATTAGG + Intergenic
1135677735 16:24431336-24431358 ATCAAAGACAACCACAGATGTGG + Intergenic
1135830668 16:25769970-25769992 TTCAGTGACCCCCAAAAATATGG - Intronic
1136644830 16:31604267-31604289 ATCAAAGTAACCAAAAAACACGG + Intergenic
1137280373 16:46972249-46972271 ATCAAAGACACTTGACAATAGGG - Intronic
1137291433 16:47054622-47054644 ATGAAAGACACCCAAAGGGAAGG - Intergenic
1137360702 16:47812648-47812670 AACAAAGCCTCCAAAAAATATGG - Intergenic
1137993604 16:53185106-53185128 TGTAAAGATACCCAAAAATATGG + Intronic
1139282456 16:65782637-65782659 ATGACAGACACCTATAAATATGG + Intergenic
1139766277 16:69232869-69232891 TCCAAAGAAACCAAAAAATAAGG - Intronic
1141086182 16:81096855-81096877 CTCAAAGAAACCCATAAAGATGG - Intergenic
1141732361 16:85831127-85831149 TTCAAACACACACAAAAATGTGG + Intergenic
1144297864 17:13896285-13896307 ATTAAAGACACAGAAAAAGAAGG + Intergenic
1145357146 17:22169212-22169234 TAAAAAGATACCCAAAAATATGG - Intergenic
1145358034 17:22181713-22181735 AGAAAAGATACCCAAAAATGTGG + Intergenic
1146446806 17:32938627-32938649 ATGTAAGACACCGAAAAAGAAGG - Intronic
1148243159 17:46013098-46013120 ATCAAGGTCACCAAAAAACAAGG - Intronic
1149106092 17:52967283-52967305 ATCAAAGACACTTATAAATATGG - Intergenic
1149396223 17:56247591-56247613 ATCAATAACACCACAAAATAAGG + Intronic
1150369851 17:64627815-64627837 ATCAAGAACACTCAAAAATTTGG + Intronic
1150687276 17:67330871-67330893 TGAAAAGACACCCAAAAATGTGG + Intergenic
1150987311 17:70213130-70213152 TGTAAAGACACCCAAAAATGTGG + Intergenic
1150998523 17:70347130-70347152 AACAAAAACAAACAAAAATAAGG - Intergenic
1152023433 17:77793823-77793845 CACAAAGACACCTTAAAATAAGG - Intergenic
1154444860 18:14427578-14427600 AACAAAGCCTCCAAAAAATATGG - Intergenic
1156817377 18:41327537-41327559 TGAAAAGATACCCAAAAATATGG + Intergenic
1156833329 18:41522260-41522282 TTCAAAGAAATCCAAACATATGG - Intergenic
1158297529 18:56015224-56015246 AGCAAAGACTCCAAGAAATATGG - Intergenic
1158379326 18:56911855-56911877 ATTAATGTCAACCAAAAATATGG - Intronic
1158539911 18:58343921-58343943 ATCAAAAATAGCCAGAAATACGG - Intronic
1158877766 18:61749393-61749415 TTCAAGGACACCCAGGAATAAGG + Intergenic
1159271273 18:66154455-66154477 AACCATGAAACCCAAAAATACGG + Intergenic
1159989540 18:74887734-74887756 ATTAAAGACAACTAAAAATATGG - Intronic
1160001170 18:75024843-75024865 ATTAAAGAAATCCAAGAATATGG - Intronic
1160081920 18:75736189-75736211 AGAAAAGATACCCAAAAATGTGG + Intergenic
1161735045 19:5986814-5986836 ATCAAACAAACCCAAAGTTAAGG - Intergenic
1163049914 19:14675140-14675162 AACACAGACACCCTAAAATCTGG - Intronic
1163066343 19:14799063-14799085 ATCAAAGACACGATAAGATATGG + Intronic
1163940127 19:20483919-20483941 AACAAAGCCTCCCAGAAATATGG + Intergenic
1164319887 19:24134724-24134746 TTCAAAGCCACGCAAATATATGG - Intergenic
1164416756 19:28052174-28052196 AACAAAGACTCCAAGAAATATGG + Intergenic
1164556176 19:29254283-29254305 AACAAAGCCTCCAAAAAATATGG - Intergenic
926068336 2:9862414-9862436 AACAAAGCCTCCCAGAAATATGG + Intronic
926406769 2:12561554-12561576 ATCAAAGACCTCAAAACATAGGG + Intergenic
926454692 2:13051838-13051860 AACAAAGTCAATCAAAAATAGGG - Intergenic
926788812 2:16548656-16548678 GTCAAAGACATGAAAAAATAAGG - Intergenic
927455356 2:23244118-23244140 ATCAAACAGACCTAAAAAGAAGG + Intergenic
928480902 2:31682693-31682715 AACAAAGCCTCCAAAAAATATGG - Intergenic
928680243 2:33693868-33693890 GTGAAAGAGACCCAAAAATGTGG - Intergenic
929823489 2:45291902-45291924 TGAAAAGATACCCAAAAATATGG + Intergenic
930434001 2:51317384-51317406 AACAAAGACTCCAAGAAATATGG - Intergenic
930438386 2:51376284-51376306 TGTAAAGACACCCAAAAATGTGG + Intergenic
930514916 2:52394142-52394164 TGTAAAGACACCCAAAAATGTGG - Intergenic
930868042 2:56141806-56141828 AACAAAGCCACCAAGAAATATGG - Intergenic
931011759 2:57924369-57924391 ATTGAAGACACACAAAAAAATGG - Intronic
931046746 2:58362558-58362580 GATAAAGACACCCAGAAATATGG + Intergenic
931360578 2:61574522-61574544 ATTAAAGACAAACAAAACTATGG + Intergenic
931485999 2:62692536-62692558 ATCAAAGACAGACAATAACAAGG - Intronic
932096055 2:68849746-68849768 TTCAGAGACACACAAACATACGG + Intergenic
932584003 2:73011462-73011484 AACAAAGACACCAGAGAATAAGG + Intronic
932747303 2:74344571-74344593 ATCAAAGACAGGCAAGACTAGGG + Intronic
932914020 2:75835445-75835467 AACAAAGCCTCCAAAAAATACGG + Intergenic
933037458 2:77418385-77418407 ATCAAAGATACCTACAAATTTGG + Intronic
933257463 2:80097677-80097699 AACAAAGACTCCAAGAAATATGG - Intronic
933519186 2:83348808-83348830 AGCAAAGACTCCAAGAAATATGG + Intergenic
933757384 2:85650496-85650518 CTTTAAAACACCCAAAAATAGGG - Intergenic
934013111 2:87846979-87847001 ATTAAAAACACGGAAAAATAAGG - Intergenic
934112905 2:88758920-88758942 TGAAAAGATACCCAAAAATATGG + Intergenic
934702875 2:96456177-96456199 AACAAAGCCTCCAAAAAATATGG + Intergenic
934831199 2:97526874-97526896 AACAAAGTCTCCAAAAAATATGG + Intronic
935203682 2:100879949-100879971 GTCAAAGACACCCTGAAATGTGG - Intronic
935431174 2:102977628-102977650 ATAAAAGACAAGCTAAAATAAGG - Intergenic
935436865 2:103044915-103044937 TGTAAAGACACCCAAAAATGTGG + Intergenic
936092042 2:109507689-109507711 ATCCCAGACACCCAAGAAAATGG + Intergenic
936683631 2:114803369-114803391 TTAAAAGATACCCAAAAATGTGG + Intronic
936777572 2:115992990-115993012 TACAAAGACACCTGAAAATATGG + Intergenic
937420371 2:121749315-121749337 TTCAAAGACTCCCAAAATTTAGG + Intronic
937518847 2:122686285-122686307 AGAAAAGATACCCTAAAATATGG - Intergenic
938221300 2:129570309-129570331 AACAAAGCCTCCAAAAAATATGG + Intergenic
938638318 2:133252748-133252770 CTCAATGCCAGCCAAAAATAGGG + Intronic
939263405 2:139839280-139839302 ATGAGATACAACCAAAAATATGG + Intergenic
939534224 2:143405698-143405720 CACAAAGGCACCCAAAAAGATGG - Intronic
939740604 2:145901519-145901541 AGTAAAGATACCCAAAAATGTGG + Intergenic
940135816 2:150435085-150435107 TGCAAAGATACCCAAAAATGTGG + Intergenic
940288817 2:152058288-152058310 TATAAAGACACCCAAAAATGTGG + Intronic
940370701 2:152897348-152897370 AACAAAGCCTCCAAAAAATATGG + Intergenic
940528115 2:154843608-154843630 ATCAAAGCCTCCAAGAAATATGG - Intronic
940821550 2:158361145-158361167 AACAAAGCCACCAAGAAATATGG + Intronic
940905843 2:159168681-159168703 ATAAAAAACACCAAAAAATGCGG + Intronic
940999168 2:160182463-160182485 ATCAAAGCCTCCAAGAAATATGG + Intronic
941314782 2:163978865-163978887 TTCAAAAACAATCAAAAATAAGG - Intergenic
942853168 2:180514747-180514769 ATAAAATACACCCATAAATTGGG - Intergenic
943074501 2:183178219-183178241 AACAAAGACTCCAAGAAATAGGG - Intergenic
943223608 2:185140877-185140899 TATAAAGACACCCAAAAATGTGG - Intergenic
943929302 2:193829753-193829775 ATCAATAACTCCCAACAATAAGG - Intergenic
944264989 2:197713774-197713796 AACAAGGACAAACAAAAATAGGG - Intronic
944303833 2:198156880-198156902 TATAAAGAAACCCAAAAATATGG + Intronic
944322087 2:198358058-198358080 ATCAAAAACACACAAAAAAAAGG - Intronic
944393464 2:199244264-199244286 AACAAAGCCACCAAGAAATATGG - Intergenic
945507420 2:210658499-210658521 ATTAAAGACATCCAAATTTAAGG + Intronic
946183417 2:217962690-217962712 ATCAAACACACCCAAATTGAGGG + Intronic
946205756 2:218107226-218107248 AACAAAGCCTCCAAAAAATATGG - Intergenic
946815776 2:223577244-223577266 ATCAAGGACACTCAGACATAAGG - Intergenic
947242101 2:228006211-228006233 AACAAAGCCTCCAAAAAATATGG - Intronic
947557220 2:231104756-231104778 ATCACAGCCACTCAAAAAGATGG - Intronic
948834839 2:240620875-240620897 ATCAAATACACACAAAAGCAGGG + Intronic
1168898563 20:1340881-1340903 ATCACAGCCACCCAAACAAATGG + Intronic
1170062505 20:12273739-12273761 TGAAAAGATACCCAAAAATATGG - Intergenic
1170229243 20:14027128-14027150 AACAAAGCCTCCAAAAAATATGG - Intronic
1171194172 20:23184559-23184581 AACAAAGCCTCCAAAAAATATGG - Intergenic
1171441548 20:25167402-25167424 AACAAAGACTCCAAGAAATATGG + Intergenic
1171452487 20:25246217-25246239 ATAAATGAAACACAAAAATAAGG - Intergenic
1171571376 20:26254772-26254794 AGAAAAGATACCCAAAAATGTGG + Intergenic
1171753429 20:29078464-29078486 AAGAAAGAAACCCAGAAATATGG + Intergenic
1171788831 20:29499097-29499119 AAGAAAGAAACCCAGAAATATGG - Intergenic
1171814211 20:29769156-29769178 AACAAAGACTCCAAGAAATATGG + Intergenic
1173751008 20:45476842-45476864 AACAAAGCCTCCAAAAAATATGG - Intronic
1174856381 20:54049425-54049447 ATCAAAGAAGGCCAAAAATCAGG + Intronic
1174869814 20:54172634-54172656 ATCAAAGAAACGCCAAAACAGGG - Intronic
1175047410 20:56120163-56120185 ATCAAAGAAACCCAAATAGGGGG + Intergenic
1176451127 21:6862294-6862316 AACAAAGCCTCCAAAAAATATGG + Intergenic
1176829296 21:13727345-13727367 AACAAAGCCTCCAAAAAATATGG + Intergenic
1177184035 21:17774417-17774439 AACAAAGACTCCAAGAAATATGG - Intergenic
1177533332 21:22392642-22392664 AACAAACACACCAAAATATATGG + Intergenic
1177566715 21:22832339-22832361 ATCAAAGACTGCCAGAAAAAAGG + Intergenic
1177570379 21:22878392-22878414 TATAAAGATACCCAAAAATATGG - Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1178505824 21:33162225-33162247 CTGCAAGACACTCAAAAATAGGG + Intergenic
1180251281 21:46591652-46591674 TTAAAAGATACCCAAAAATGTGG + Intergenic
1180398971 22:12390306-12390328 AACAAAGACTCCAAGAAATATGG + Intergenic
1181326832 22:22056256-22056278 AACAAAGCCTCCAAAAAATATGG - Intergenic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1182337684 22:29595651-29595673 ATAAAATAAAGCCAAAAATAAGG + Intergenic
1184207978 22:43017177-43017199 AACAAAAACCCCCAAAAATTTGG - Intergenic
1185183483 22:49378156-49378178 AGCAATGATATCCAAAAATAAGG + Intergenic
949209323 3:1478934-1478956 ATCAAAGCCTCCAAGAAATATGG + Intergenic
949210025 3:1487287-1487309 ATAAAAGAAAGCAAAAAATAAGG - Intergenic
949425391 3:3910253-3910275 AACAAAGACTCCAAGAAATATGG + Intronic
950208807 3:11102038-11102060 ATAAAAGGCACCCAGAAAGATGG - Intergenic
951139054 3:19139979-19140001 GTCAAAGACAACAAAAAATTAGG + Intergenic
951435478 3:22657589-22657611 ACAAAAGACACACAGAAATAAGG + Intergenic
951487630 3:23231740-23231762 ATCAAACAAACCCAAAGATGGGG - Intronic
951512345 3:23517414-23517436 ATCTCAGACTCCCAAAAAGAAGG + Intronic
952548459 3:34449043-34449065 AACAAAGCCTCCAAAAAATATGG - Intergenic
952554501 3:34516958-34516980 ATCAAAGACATAAGAAAATATGG + Intergenic
952955522 3:38554994-38555016 ATTAAAGACACATACAAATATGG - Intronic
953480705 3:43249296-43249318 ATCAAAGCAACTTAAAAATAAGG + Intergenic
953504613 3:43472460-43472482 TTAAAAGACACCAAAAAAGAGGG + Intronic
953505283 3:43480192-43480214 AACAAGGAGACACAAAAATAGGG + Intronic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
955048968 3:55390178-55390200 AACAAAGCCACCAAGAAATATGG + Intergenic
955064759 3:55524894-55524916 GTGGAAGGCACCCAAAAATATGG - Intronic
955987007 3:64584033-64584055 TTCAAAGACAACCAAAAAGAAGG + Intronic
956279509 3:67541486-67541508 AACAAAGCCTCCAAAAAATATGG + Intronic
956396482 3:68831853-68831875 AACAAAGACTCCAAGAAATATGG - Intronic
956558910 3:70551893-70551915 TAAAAAGACACCCAAAAATGTGG - Intergenic
956932523 3:74061129-74061151 ATCGCAGACACCCAAAACTGGGG + Intergenic
957130329 3:76215630-76215652 AACAAAGACTCCAAGAAATATGG + Intronic
957148832 3:76458565-76458587 TGAAAAGATACCCAAAAATATGG - Intronic
957676867 3:83378198-83378220 TGTAAAGACACCCAAAAACATGG - Intergenic
957780681 3:84814441-84814463 ATCAAAGCCTCCAAGAAATATGG - Intergenic
958482455 3:94660516-94660538 ATTAAAGACACCTAAAATAAAGG + Intergenic
958512271 3:95064474-95064496 AACAAAGACTCCAAGAAATACGG - Intergenic
958826428 3:99036248-99036270 AACAAAGCCTCCAAAAAATATGG + Intergenic
959070953 3:101701667-101701689 ATTAAAGATACCAAAATATAAGG + Intergenic
959172146 3:102855972-102855994 TGAAAAGACACCCAAAAATGTGG - Intergenic
959673460 3:109006538-109006560 ATCAGTCACACACAAAAATATGG - Intronic
960077887 3:113508995-113509017 ATCAATGATACCAAACAATAGGG - Intronic
960482101 3:118204394-118204416 ATGAAAGTAAGCCAAAAATAGGG - Intergenic
960491479 3:118321278-118321300 AACAAAGCCTCCAAAAAATATGG - Intergenic
961112992 3:124301093-124301115 AACAAAGACAACCATAATTAGGG + Intronic
962057194 3:131884993-131885015 TGAAAAGATACCCAAAAATATGG + Intronic
962073219 3:132053506-132053528 AACAAAGACTCCAAGAAATATGG - Intronic
962077574 3:132100138-132100160 AACAAAGACTCCAAGAAATATGG + Intronic
962104368 3:132375907-132375929 AGCAAAGACTCCAAGAAATATGG - Intergenic
962124988 3:132607595-132607617 AACAAAGCCTCCAAAAAATATGG + Intronic
963488549 3:145968523-145968545 ACCAAGAACTCCCAAAAATATGG + Intergenic
963765396 3:149329763-149329785 ATCACATACACCCAACAATATGG + Intronic
963906977 3:150780639-150780661 AACAAAGACAACCAAATGTAAGG - Intergenic
963980391 3:151530181-151530203 AACAAAGCCTCCAAAAAATATGG + Intergenic
964032219 3:152151909-152151931 ATTAAAGGAACCCAAATATATGG - Intergenic
964296172 3:155236013-155236035 ATAAAAGACATCCAAATAGAAGG - Intergenic
964557546 3:157956299-157956321 ATTAAAGACACGGAAAAAGAAGG + Intergenic
964584347 3:158280211-158280233 AACAAATACACCCAAGAAGAAGG + Intronic
964676682 3:159290124-159290146 ATCGAAGACAACTAAAAAAAAGG + Intronic
964999171 3:162930404-162930426 ATCAAAGGCAGCCAAATATCAGG + Intergenic
965013529 3:163126908-163126930 GTGAAAGATACCCAAAAATGTGG - Intergenic
965013540 3:163127048-163127070 CTGAAAGACACCCAAAAATGTGG - Intergenic
965027814 3:163325323-163325345 ATTAAAGTCACCCAAAAAGAAGG - Intergenic
965794609 3:172427086-172427108 ATAAAAGACACCCGAATTTAAGG + Intergenic
965989490 3:174799674-174799696 AGAAAAGATACCCAAAAATGTGG + Intronic
966477696 3:180368830-180368852 AACAAAGCCACCAAGAAATATGG + Intergenic
967501491 3:190203231-190203253 TGTAAAGATACCCAAAAATATGG + Intergenic
967737678 3:192970537-192970559 AACAAAGACGCCAAGAAATATGG - Intergenic
967821196 3:193840900-193840922 ATAAAAGACAGCCAAAAGAATGG - Intergenic
967844305 3:194032057-194032079 CTCAAAGGCAACCAAAAAAATGG + Intergenic
969644415 4:8418891-8418913 AACAAAAACACAGAAAAATATGG + Intronic
970750526 4:19353829-19353851 CATAAAGACACCCAAAAATGTGG - Intergenic
972201007 4:36714924-36714946 TTCAAATACAGACAAAAATAAGG + Intergenic
972261187 4:37409479-37409501 AACAAAGACTCCAAGAAATATGG + Intronic
972634297 4:40869600-40869622 ATAAAAGAGGCCTAAAAATAAGG + Intronic
973107672 4:46360637-46360659 TTAAAAGATACCCAAAAATGTGG + Intronic
973237511 4:47921703-47921725 AACAAAGCCTCCCAGAAATATGG - Intronic
973886949 4:55332025-55332047 ATCAAAGACAAATATAAATAGGG + Intergenic
974132069 4:57769089-57769111 AACAAAGACTCCAAGAAATATGG + Intergenic
974200235 4:58627858-58627880 ATAAAATCCACACAAAAATAGGG + Intergenic
974271633 4:59657406-59657428 AACAAAGCCACCAAGAAATATGG + Intergenic
974326166 4:60418042-60418064 AACAAAGCCTCCAAAAAATATGG - Intergenic
974493470 4:62596244-62596266 ATAAAAGACAGTTAAAAATAAGG - Intergenic
975361402 4:73475885-73475907 TATAAAGATACCCAAAAATATGG - Intergenic
975988644 4:80233012-80233034 ATTAAAGATATCCAAATATAAGG + Intergenic
976156708 4:82153419-82153441 ATCAAAGCCTCCAATAAATATGG + Intergenic
976395063 4:84546421-84546443 AACAAAGACTCCAAGAAATATGG + Intergenic
976441632 4:85082593-85082615 TTCATATACAACCAAAAATATGG + Intergenic
976982535 4:91248600-91248622 ATCAAAGTCATTCAAAAACAAGG + Intronic
977023827 4:91790701-91790723 AGCAAAGACTCCAAGAAATATGG - Intergenic
977063896 4:92289134-92289156 TGCAAAGATACCCAAAAATATGG - Intergenic
977300714 4:95264188-95264210 ATGAAAGACCAACAAAAATAGGG + Intronic
978075676 4:104526557-104526579 AACAATGACATCCCAAAATATGG - Intergenic
978835372 4:113143068-113143090 ATAAAAGACAACCACAGATAGGG - Intronic
978969515 4:114786056-114786078 ATCAGAGACACACAAACAAATGG + Intergenic
979172987 4:117625403-117625425 TGAAAAGATACCCAAAAATATGG + Intergenic
979748900 4:124251575-124251597 ATCAAAGTCACTCAATATTATGG - Intergenic
980148890 4:129022616-129022638 AACAAAGACTCCAAGAAATATGG + Intronic
980513346 4:133822404-133822426 AACAAAGCCTCCAAAAAATAAGG - Intergenic
981242284 4:142492311-142492333 TCTAAAGACACCCAAAAATGTGG + Intronic
982279040 4:153665286-153665308 TGAAAAGACACCCAAAAATGTGG + Intergenic
982870687 4:160575366-160575388 AGCAAAGACTCCAAGAAATATGG + Intergenic
983446511 4:167859219-167859241 AGCAAAGACTCCAAGAAATATGG + Intergenic
983668428 4:170208554-170208576 AACAAAGCCTCCAAAAAATATGG + Intergenic
983814970 4:172112901-172112923 ATCAAAGACATCAGAAAATTTGG - Intronic
983899673 4:173120472-173120494 CTCAAAAACACTGAAAAATAGGG + Intergenic
984020275 4:174476715-174476737 ATCAAAGTCTCCAAAAAATATGG + Intergenic
985794906 5:1954908-1954930 AACAAAGACTCCAAGAAATATGG + Intergenic
986455399 5:7913133-7913155 TGCAAAGAAACCCAAAAATGTGG - Intergenic
986484491 5:8221485-8221507 AACAAAGACTCCAAGAAATATGG + Intergenic
986648092 5:9938233-9938255 AACAAAGCCTCCAAAAAATATGG + Intergenic
986920380 5:12672938-12672960 AACAAAGACTCCAAGAAATATGG - Intergenic
987434652 5:17879921-17879943 AACAAAGACACTAAAATATAAGG - Intergenic
987481233 5:18460850-18460872 AACGATGACACCCAAAAATATGG - Intergenic
987710570 5:21497456-21497478 CTCAAAAACACACAAAAATTTGG - Intergenic
987794222 5:22606751-22606773 TATAAAGATACCCAAAAATATGG + Intronic
988047784 5:25980548-25980570 TGAAAAGATACCCAAAAATATGG - Intergenic
988162708 5:27542455-27542477 AAAAAAAACACACAAAAATATGG - Intergenic
988266083 5:28952720-28952742 AACAAAGACTCCAAGAAATATGG - Intergenic
988378215 5:30466964-30466986 ATAAAATACACCAAAATATACGG + Intergenic
988426962 5:31075125-31075147 TGAAAAGACACCCAAAAATGTGG - Intergenic
989733000 5:44669835-44669857 AGCAAAGACTCCAAGAAATATGG + Intergenic
989949592 5:50281548-50281570 AACAAAGACTCCAAGAAATATGG + Intergenic
990291155 5:54353530-54353552 AGTAAAGATACCCAAAAATGTGG + Intergenic
990600715 5:57356171-57356193 AGCAAAGCCTCCAAAAAATATGG - Intergenic
990743946 5:58939131-58939153 AACAAAGAGACCCTAAAATTAGG - Intergenic
990755549 5:59065506-59065528 AACAAAAAAACCCAAAAAGATGG + Intronic
990941567 5:61207404-61207426 CTGAAAGATACCCAAAAATGTGG - Intergenic
991042710 5:62192466-62192488 TACAAAGACACCTAAAAATGTGG + Intergenic
991116208 5:62958843-62958865 ATCAAAGTAACTCACAAATATGG - Intergenic
991137151 5:63195264-63195286 AACAAAGACTCCAAGAAATATGG + Intergenic
991283844 5:64947031-64947053 ATCAAAGAAAGCCAAATAAATGG - Intronic
991364164 5:65851579-65851601 AACAAAGCCTCCAAAAAATATGG - Intronic
991649341 5:68836240-68836262 TTTAAAGAAAGCCAAAAATAAGG + Intergenic
992511627 5:77441962-77441984 ATCAAAGAAATCTAAAAACAAGG + Intronic
992590311 5:78288948-78288970 AAAAAAAACACCCAAAAATATGG + Intronic
992961664 5:81961624-81961646 ATCAATGACACCCAAATACAGGG + Intergenic
993355518 5:86902366-86902388 ATAGAAGAAAGCCAAAAATAGGG - Intergenic
993366608 5:87041701-87041723 AACAAAGACTCCAAGAAATAAGG - Intergenic
993442529 5:87974148-87974170 TGAAAAGACACCCAAAAATGTGG - Intergenic
993451173 5:88073603-88073625 TTTAAAGACACCCAAAAATGTGG + Intergenic
993711670 5:91231154-91231176 TACAAAGATACCCAAAAATGTGG - Intergenic
994132701 5:96248419-96248441 TTTAAACACACCCAAATATATGG - Intergenic
994177095 5:96722831-96722853 TTCAAAGACCCCCATAAATTAGG - Intronic
994590875 5:101769963-101769985 AGTAAAGATACCCAAAAATATGG - Intergenic
994978318 5:106840201-106840223 AACAAAGCCCCCCAAAAATATGG + Intergenic
995079933 5:108038081-108038103 ATAAATGACATGCAAAAATAGGG + Intronic
995110868 5:108427520-108427542 AACAAAGCCTCCAAAAAATATGG - Intergenic
995179021 5:109213136-109213158 AACAAAGACTCCAAGAAATATGG - Intergenic
995467415 5:112465405-112465427 AACAAAGCCTCCAAAAAATATGG - Intergenic
995627407 5:114094114-114094136 AACAAGGTCACCCATAAATAAGG - Intergenic
995983249 5:118133935-118133957 AACAAAGCCTCCCAGAAATATGG - Intergenic
996069310 5:119117001-119117023 ATAAAAAACAAACAAAAATAGGG - Intronic
997069800 5:130608258-130608280 AACAAAGCCTCCCAGAAATATGG + Intergenic
997097118 5:130925269-130925291 AACAAAGACTCCAAGAAATATGG + Intergenic
998304883 5:141064791-141064813 ATCAAAGACAAGTAAAATTAAGG + Intergenic
999071530 5:148748668-148748690 ATCAAAGACACCCAGAAAGCAGG + Intergenic
999111382 5:149124364-149124386 AACAAAGCCTCCAAAAAATATGG + Intergenic
999587041 5:153101089-153101111 ATCAAAGAGACCTATAAACAGGG - Intergenic
999814459 5:155162269-155162291 AACAAAGACTCCAAGAAATATGG - Intergenic
1000001898 5:157146852-157146874 ATGAAAGATACCCAATACTAAGG - Intronic
1002800518 6:517716-517738 AGCAGAGACAACCAAACATAAGG + Intronic
1004809141 6:19240158-19240180 AACAAAGCCTCCAAAAAATATGG + Intergenic
1004831670 6:19483194-19483216 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1004976596 6:20974030-20974052 AACAAAGAGGCCCCAAAATATGG + Intronic
1005184489 6:23149771-23149793 TGTAAAGATACCCAAAAATATGG - Intergenic
1005376141 6:25184705-25184727 AACAAAGCCTCCAAAAAATAAGG - Intergenic
1005466504 6:26121193-26121215 AACAAAAACACCCCAAAAAAAGG + Intronic
1005500708 6:26426699-26426721 ATCAAAGAGTCCCAAAACTCGGG + Intergenic
1005547118 6:26883061-26883083 CTCAAAAACACACAAAAATTTGG + Intergenic
1005715730 6:28545702-28545724 ATTAAAAAAACACAAAAATATGG + Intergenic
1006280250 6:33046773-33046795 AGAAAAGATACCCAAAAATGTGG + Intergenic
1007137303 6:39534532-39534554 ATCAAAGCCTCCAAGAAATATGG + Intronic
1007934736 6:45722903-45722925 CTCAAAGACACCAAAAGAAATGG - Intergenic
1008798464 6:55336887-55336909 AACGAAGAAAACCAAAAATAAGG - Intronic
1008855214 6:56076686-56076708 ATGTAAGACAACCAAAAATATGG + Intronic
1009017880 6:57924135-57924157 CTCAAAAACACACAAAAATTTGG + Intergenic
1009264259 6:61533259-61533281 AACAAAGCCTCCAAAAAATATGG + Intergenic
1009283731 6:61785194-61785216 ATCAAAGAAAACAAAAAAGAGGG + Intronic
1009346000 6:62613523-62613545 CGAAAAGATACCCAAAAATATGG + Intergenic
1009518982 6:64658026-64658048 AACAAAGCCTCCCAGAAATATGG - Intronic
1009559407 6:65220668-65220690 TGTAAAGATACCCAAAAATATGG + Intronic
1009864918 6:69385461-69385483 TTCAGAGCCACCCAAAAATATGG - Intronic
1009959827 6:70505403-70505425 ATCAAGGTCACGCAAAGATAAGG - Intronic
1010441868 6:75904399-75904421 AACAAAGACTCCAAGAAATATGG - Intronic
1010673985 6:78720224-78720246 ATATAAGATACCCAAAAATGTGG + Intergenic
1010868936 6:81014527-81014549 GGCAAAGACACACAAAAAAAGGG - Intergenic
1010945774 6:81971368-81971390 AACAAAGACTCCAAGAAATATGG + Intergenic
1011088510 6:83570011-83570033 AGAAAAGCCACCCAAAAATGAGG + Intronic
1011105966 6:83781894-83781916 ATCAAACACACCCAACAAAGAGG - Intergenic
1011110529 6:83832985-83833007 TGAAAAGATACCCAAAAATATGG + Intergenic
1011152675 6:84291197-84291219 AGGAAAGATACCCAAAAATATGG - Intergenic
1011209306 6:84937478-84937500 AACAAAGCCACCAAGAAATATGG + Intergenic
1011238448 6:85243925-85243947 AAAAAAGTCCCCCAAAAATATGG + Intergenic
1011301310 6:85877567-85877589 AACAAAGCCTCCAAAAAATATGG - Intergenic
1011348169 6:86394046-86394068 AACAAAGACTCCAAGAAATATGG + Intergenic
1011353768 6:86452833-86452855 TTAAAAGATACCCAAAAATGTGG + Intergenic
1011519658 6:88191778-88191800 ATTCAAGACACACATAAATAGGG + Intergenic
1011533658 6:88352279-88352301 AGCAAAGCCTCCAAAAAATATGG + Intergenic
1011545347 6:88476992-88477014 ATAAATGAAACCCAAATATAAGG + Intergenic
1011598407 6:89038063-89038085 TGTAAAGATACCCAAAAATATGG - Intergenic
1011760842 6:90563540-90563562 AACAAAGACTCCAAGAAATATGG + Intronic
1011883252 6:92058609-92058631 AGAAAAGATACCCAAAAATGTGG + Intergenic
1011892947 6:92190032-92190054 ATAAATGACACACAAAAAAATGG - Intergenic
1011926857 6:92655818-92655840 AACAAAGACTCCAAGAAATATGG - Intergenic
1012102751 6:95111778-95111800 ATCAAAGAATCCCAAGAACAGGG + Intergenic
1012238445 6:96844875-96844897 ATCAAAACCTCCAAAAAATATGG + Intergenic
1012435013 6:99205745-99205767 AACAAAGTCTCCAAAAAATATGG + Intergenic
1012776120 6:103495839-103495861 AACAAAGCCTCCCAGAAATATGG - Intergenic
1013147096 6:107404384-107404406 TGTAAAGATACCCAAAAATATGG - Intronic
1013397481 6:109756607-109756629 AACAAAGACTCCAAGAAATATGG - Intronic
1013909019 6:115251542-115251564 AACAAAGCCTCCAAAAAATACGG + Intergenic
1014441791 6:121481927-121481949 ATCAATGACACAAAAATATAAGG - Intergenic
1014851495 6:126344522-126344544 AGCAAAAACACCCCATAATATGG - Intronic
1015013285 6:128377101-128377123 TGAAAAGATACCCAAAAATATGG - Intronic
1015674082 6:135725429-135725451 TGAAAAGATACCCAAAAATATGG + Intergenic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1016301504 6:142636672-142636694 ACAAAAAACCCCCAAAAATATGG - Intergenic
1016524836 6:144990051-144990073 ATCTAAGACACCTGAAAAGAAGG - Intergenic
1017262572 6:152403744-152403766 ATCAAAAACACCAAAAAAAGAGG + Intronic
1018075909 6:160213398-160213420 AACAAAGCCACCAACAAATATGG - Intronic
1018526880 6:164722175-164722197 ATCAAAGAAACAAAAAAATATGG - Intergenic
1019870498 7:3756768-3756790 AACAGATACACCCAAATATAGGG - Intronic
1020607918 7:10360992-10361014 TGCAAAGATACCCAAAAATGTGG + Intergenic
1020874119 7:13672688-13672710 ATCAAAGCCTCCAAGAAATATGG - Intergenic
1021024007 7:15642280-15642302 AACAAAGACTTCCAGAAATATGG - Intronic
1021192551 7:17638481-17638503 ATCAAAAACACTCAAACACATGG - Intergenic
1022173891 7:27855032-27855054 AACAAAGCCTCCCAGAAATATGG - Intronic
1022546592 7:31194778-31194800 GTTAAAGACAACCAAAAAAAAGG - Intergenic
1022600695 7:31756421-31756443 GTCAAAGTCACCAAAAATTAGGG + Intronic
1023189333 7:37562625-37562647 ATCAAAGAAAACTGAAAATAGGG + Intergenic
1023322356 7:39012195-39012217 AGCAAAGACTCCAAGAAATATGG - Intronic
1023511471 7:40958332-40958354 AACAAAGCCTCCAAAAAATACGG - Intergenic
1023610930 7:41969627-41969649 GTCAAAGACATCCAAAACTCTGG - Intronic
1024129951 7:46340973-46340995 AACAAAGCCACCAAGAAATATGG - Intergenic
1024413871 7:49079803-49079825 TGTAAAGATACCCAAAAATATGG - Intergenic
1024666933 7:51556806-51556828 AACAAAGACTCCAAGAAATATGG - Intergenic
1024817368 7:53286995-53287017 AACAAAGCCTCCAAAAAATATGG - Intergenic
1025533903 7:61924315-61924337 CTCACAGACTCTCAAAAATAGGG - Intergenic
1026643044 7:72143445-72143467 AACAAAGCCTCCAAAAAATATGG + Intronic
1027308135 7:76923829-76923851 ATCAATGAAACCTAAAAATCAGG + Intergenic
1027484257 7:78740221-78740243 ATAAAAGAGACCCCAGAATAAGG - Intronic
1027510702 7:79076068-79076090 ACAAAAGACAAGCAAAAATATGG + Intronic
1027624641 7:80531258-80531280 AAAAAAGACACCCAAAAATGTGG + Intronic
1027637235 7:80690474-80690496 AACAAAGCCTCCCAGAAATATGG + Intergenic
1028114622 7:86983157-86983179 AACAAAGACTCCAACAAATATGG + Intronic
1028144452 7:87305825-87305847 AACAAAGGCTCCAAAAAATATGG + Intergenic
1028258266 7:88628259-88628281 ATCACAGGCATCCAAAAATGTGG + Intergenic
1028291517 7:89071185-89071207 ATCAAAAACACTCAGAAAAAGGG - Intronic
1028535288 7:91884869-91884891 ATTAAAGACATCCAAAAACTAGG + Intergenic
1028998222 7:97125503-97125525 AACAAAGACTCCAAGAAATATGG - Intronic
1029917069 7:104221482-104221504 ATCAAGGATACCAAAAAATGTGG - Intergenic
1030260128 7:107555310-107555332 ATAAAAGGCACACAATAATAAGG - Intronic
1030844710 7:114394711-114394733 AACACAGACAACCAAAATTAAGG + Intronic
1031548845 7:123084001-123084023 AACAAAGCCTCCAAAAAATATGG - Intergenic
1031559059 7:123215550-123215572 TGAAAAGATACCCAAAAATATGG + Intergenic
1031709009 7:125021748-125021770 TGTAAAGATACCCAAAAATATGG + Intergenic
1032686626 7:134240523-134240545 AACAAAGCCTCCAAAAAATATGG + Intronic
1032816340 7:135478800-135478822 GTCAAAAACACCAAAAAATAAGG + Intronic
1032994076 7:137425869-137425891 AACAAAGACTCCAAGAAATATGG + Intronic
1033106956 7:138535887-138535909 AACAAAGCCACCAAGAAATATGG - Intronic
1033830001 7:145240597-145240619 AACAAAGACTCCAAGAAATATGG - Intergenic
1034132278 7:148730810-148730832 CTCAAAAACACAAAAAAATAGGG - Intronic
1035779055 8:2213067-2213089 CTCACAGACCCCCAGAAATAAGG - Intergenic
1035836934 8:2764754-2764776 CACAGACACACCCAAAAATAAGG - Intergenic
1036270185 8:7296982-7297004 ATCAAACACATCCAAAGACAAGG - Intergenic
1036457880 8:8925445-8925467 TGAAAAGATACCCAAAAATATGG - Intergenic
1038221606 8:25614021-25614043 AACAAAGACTCCAAGAAATATGG - Intergenic
1038280536 8:26160131-26160153 CTGAAAGATACCCAAAAATGTGG - Intergenic
1039695840 8:39910408-39910430 GAAAAGGACACCCAAAAATATGG + Intronic
1040691365 8:49942688-49942710 ATCAAAGAAACCCCAATATAGGG - Intronic
1040769407 8:50955209-50955231 AACAAAGCCTCCAAAAAATATGG + Intergenic
1041222843 8:55669361-55669383 TGCAAAGATACCCAAAAATGTGG + Intergenic
1041295739 8:56355864-56355886 AACAAAGCCTCCAAAAAATATGG - Intergenic
1041339284 8:56824887-56824909 TTCAAAGACACATAAAAAGATGG + Intergenic
1041634625 8:60129333-60129355 AACAAAGCCTCCAAAAAATATGG - Intergenic
1042251592 8:66761295-66761317 AACAAAAAAACCCAAAAATCAGG - Intronic
1042383952 8:68151419-68151441 AACAAACAAAACCAAAAATAAGG + Intronic
1042622167 8:70718246-70718268 AACAAAGATACCCAAAAATGTGG - Intronic
1042660815 8:71152538-71152560 CTCAAAGACACACTTAAATAAGG - Intergenic
1043308122 8:78822747-78822769 TGTAAAGATACCCAAAAATATGG + Intergenic
1044055840 8:87568991-87569013 TTTAAAGATACACAAAAATATGG + Intronic
1044203080 8:89458986-89459008 AACAAAGACTCCAAGAAATATGG + Intergenic
1044221348 8:89673593-89673615 AACAAAGACACCAAGAAATATGG + Intergenic
1044349230 8:91144174-91144196 TTCAGAGACACCCCAAAATTTGG - Intronic
1044808942 8:96037778-96037800 ATCAAAGCCTCCAAGAAATATGG - Intergenic
1045150441 8:99401294-99401316 GTAAAACACACTCAAAAATATGG - Intronic
1047545549 8:125813039-125813061 TGAAAAGATACCCAAAAATATGG + Intergenic
1048324379 8:133427918-133427940 ATCAAAAACAACCATAAAAATGG + Intergenic
1048457764 8:134593290-134593312 TTCAAAGGCATCAAAAAATAAGG - Intronic
1050819006 9:9854642-9854664 ATCAAAAACAAGTAAAAATATGG - Intronic
1050904986 9:10993050-10993072 TGAAAAGATACCCAAAAATATGG + Intergenic
1051069933 9:13153431-13153453 AACAAAAACAAACAAAAATAGGG - Intronic
1051238499 9:15026656-15026678 AACAAAGACTCCAAGAAATATGG + Intergenic
1051479204 9:17540893-17540915 AACAAAGCCACCAAGAAATATGG + Intergenic
1051670314 9:19503761-19503783 AACAAAGACTCCAAGAAATATGG - Intergenic
1051957352 9:22712434-22712456 TGAAAAGACACCCAAAAATGTGG + Intergenic
1052022568 9:23541787-23541809 AACATAGACACCCACAAATGAGG - Intergenic
1053604546 9:39643819-39643841 ATTAAAGAAACCCATAAATAAGG + Intergenic
1053862360 9:42399842-42399864 ATTAAAGAAACCCATAAATAAGG + Intergenic
1054248997 9:62698595-62698617 ATTAAAGAAACCCATAAATAAGG - Intergenic
1054563107 9:66733128-66733150 ATTAAAGAAACCCATAAATAAGG - Intergenic
1054884773 9:70184552-70184574 ATCAAAGCCTCCAAGAAATATGG - Intronic
1055053078 9:71999163-71999185 AACAAAGACTCCAAGAAATATGG - Intergenic
1055840322 9:80495441-80495463 ATAACAGATACCTAAAAATATGG - Intergenic
1056055815 9:82822664-82822686 ATTAAACACACCAGAAAATAGGG - Intergenic
1056217436 9:84418369-84418391 ATCAAAGACACTCTAAGAAAAGG - Intergenic
1056422029 9:86437752-86437774 ATCAATGAAACCCAAAGATATGG - Intergenic
1056697529 9:88872461-88872483 CTCAAGGCCACACAAAAATAAGG + Intergenic
1056862003 9:90193644-90193666 AACAAAGACTCCAAGAAATATGG + Intergenic
1058259687 9:102813480-102813502 ATCAAAGATATTTAAAAATAAGG + Intergenic
1060192238 9:121600252-121600274 AACAAAAACACCCAAAACTTGGG - Intronic
1203518054 Un_GL000213v1:22223-22245 AACAAAGCCTCCAAAAAATATGG - Intergenic
1185963358 X:4571367-4571389 AGCATAGACAGCCAAAAATGGGG - Intergenic
1185970802 X:4660874-4660896 ATCAAAGTGTCACAAAAATACGG + Intergenic
1186157822 X:6743886-6743908 ATAAATGACACCAAAAAATAAGG - Intergenic
1186774702 X:12853453-12853475 ATCAAAGCCTCCAAGAAATATGG - Intergenic
1186999540 X:15161082-15161104 AGCAAAATCACCAAAAAATACGG + Intergenic
1187453352 X:19418508-19418530 AACAAAGCCACCAAGAAATATGG + Intronic
1187923675 X:24230529-24230551 ATCCAAAACAACCAAAAAGATGG - Intergenic
1188000382 X:24974820-24974842 AACAAAGAAACCCTAATATAGGG + Intronic
1188058149 X:25565125-25565147 AACAAAAACACCCTAATATATGG + Intergenic
1188289131 X:28366753-28366775 AACAAAGCCTCCAAAAAATATGG - Intergenic
1188865084 X:35304676-35304698 TGTAAAGATACCCAAAAATATGG + Intergenic
1189210664 X:39279370-39279392 AACAAAGCCTCCAAAAAATATGG - Intergenic
1189613344 X:42761346-42761368 ATCTAACACACCTAAAAATGTGG - Intergenic
1190171065 X:48112112-48112134 TTCAAACACACACAAAAGTATGG - Intergenic
1191005224 X:55703906-55703928 AACAAAGACCCCCCAAAATATGG + Intergenic
1191132488 X:57029689-57029711 AACAAAGCCTCCAAAAAATATGG - Intergenic
1191644423 X:63464982-63465004 AACAAAGACTCCAAGAAATATGG - Intergenic
1191647105 X:63493562-63493584 AACAAAGCCTCCAAAAAATATGG + Intergenic
1191772465 X:64775939-64775961 AACAAAGCCACCAAGAAATATGG + Intergenic
1192132730 X:68568115-68568137 TGTAAAGACACCCAAAAATGTGG - Intergenic
1192685830 X:73304303-73304325 AACAAAGCCACCAAGAAATATGG - Intergenic
1192922175 X:75718570-75718592 AACAAAGCCTCCAAAAAATATGG - Intergenic
1193029407 X:76881473-76881495 AACAAAGACTCCAAGAAATAGGG + Intergenic
1193064598 X:77245602-77245624 AGCAAAGACTCCAAGAAATATGG + Intergenic
1193376538 X:80768050-80768072 AACAAAGACTCCAAGAAATATGG + Intronic
1193525732 X:82586098-82586120 AACAAAGACACCCATTCATATGG + Intergenic
1193733725 X:85132319-85132341 AACAAAGCCTCCAAAAAATATGG - Intergenic
1193747875 X:85304659-85304681 AGCAAAGACACCTTAAAAAAAGG - Intronic
1194368082 X:93034017-93034039 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1194370179 X:93061638-93061660 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1194522375 X:94935102-94935124 TTTAAAGATACCCAAAAATGTGG + Intergenic
1194582733 X:95696807-95696829 AATAAAGATACCCAAAAATGTGG + Intergenic
1194727049 X:97410875-97410897 AACAAAGCCTCCAAAAAATATGG + Intronic
1194910704 X:99640666-99640688 TTCAACTACACACAAAAATATGG + Intergenic
1195116594 X:101705277-101705299 AACAAATAAACCCAAACATATGG + Intergenic
1195200909 X:102549399-102549421 ATCAATGACATGCAAAAAAAAGG + Intergenic
1195210197 X:102646954-102646976 TCAAAAGACACCCCAAAATATGG - Intergenic
1195232750 X:102867665-102867687 ATTAAAGGAACCCAAATATATGG - Intergenic
1195233567 X:102875850-102875872 AACAAAGCCACCAAGAAATATGG - Intergenic
1195715884 X:107818446-107818468 AACAAAGACACCTGAAAATATGG + Intergenic
1195826322 X:109004816-109004838 AACAAAGCCACCAAGAAATAAGG + Intergenic
1195833596 X:109087990-109088012 AACAAAGCCTCCAAAAAATATGG - Intergenic
1195846093 X:109230254-109230276 AACAAAGACTCCAAGAAATATGG + Intergenic
1196587360 X:117444894-117444916 AACAAAGCCACCCAGAAATATGG + Intergenic
1196608716 X:117686173-117686195 ATGAAAGACACTCACAAACAGGG + Intergenic
1196699300 X:118650322-118650344 ATCCAATAAACCCAAAAGTATGG - Intronic
1197098184 X:122620514-122620536 AACAAAGACTCCAAGAAATATGG - Intergenic
1197343951 X:125309164-125309186 AACAAAGATAACCAAAAACATGG - Intergenic
1197349982 X:125371428-125371450 AACAAAGACTCCAAGAAATATGG - Intergenic
1197937596 X:131755477-131755499 AACAAAGACACCAGAAACTATGG + Intergenic
1198555952 X:137793438-137793460 AACAAAGCCTCCAAAAAATATGG + Intergenic
1198835144 X:140796551-140796573 AGTAAAGATACCCAAAAATGTGG - Intergenic
1199112715 X:143954460-143954482 TGAAAAGATACCCAAAAATATGG + Intergenic
1199131360 X:144191502-144191524 ATTAAAAACACGGAAAAATAAGG + Intergenic
1199274907 X:145929328-145929350 TGAAAAGATACCCAAAAATATGG + Intergenic
1199379900 X:147158174-147158196 ATAGAAGACACACAAAAAAATGG + Intergenic
1199462533 X:148100399-148100421 CTTAAAGATACCCAAAAATGTGG + Intergenic
1199615859 X:149655055-149655077 TTCAAATACACCTAATAATAGGG + Intergenic
1199626782 X:149748193-149748215 TTCAAATACACCTAATAATAGGG - Intergenic
1199933224 X:152545853-152545875 AGCAAAGCCTCCAAAAAATATGG + Intergenic
1201346496 Y:12990553-12990575 AACAAAGACTCCAAGAAATATGG - Intergenic
1201466201 Y:14283616-14283638 AACAAAGACTCCAAGAAATATGG + Intergenic
1201536295 Y:15052359-15052381 AACAAAGCCTCCAAAAAATATGG - Intergenic
1201541949 Y:15114575-15114597 AACAAAGCCACCAGAAAATATGG + Intergenic
1201800103 Y:17945635-17945657 AACAAAGCCTCCAAAAAATATGG + Intergenic
1201800618 Y:17951006-17951028 AACAAAGCCTCCCAGAAATACGG - Intergenic
1201800935 Y:17954950-17954972 AACAAAGCCTCCCAGAAATACGG + Intergenic
1201801450 Y:17960321-17960343 AACAAAGCCTCCAAAAAATATGG - Intergenic
1201932053 Y:19361024-19361046 ATCAAAGCCTCCAAAAAATATGG + Intergenic
1201947589 Y:19528063-19528085 ATGAAAGACAACCATAAATTTGG + Intergenic
1202058075 Y:20856729-20856751 AACAAAGCCTCCAAAAAATATGG - Intergenic
1202065108 Y:20930865-20930887 ATCAAAGCCTCCAAGAAATATGG + Intergenic
1202085072 Y:21128173-21128195 AACAAAGACTCCAAGAAATATGG - Intergenic
1202344256 Y:23905047-23905069 ATCAAAGCCTCCAAGAAATATGG - Intergenic
1202379687 Y:24264969-24264991 ATCAAATATAGCCAAGAATATGG + Intergenic
1202491095 Y:25405152-25405174 ATCAAATATAGCCAAGAATATGG - Intergenic
1202526512 Y:25765036-25765058 ATCAAAGCCTCCAAGAAATATGG + Intergenic