ID: 953974388

View in Genome Browser
Species Human (GRCh38)
Location 3:47371384-47371406
Sequence CGGCGGCGGGGTGGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953974388_953974416 11 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974416 3:47371418-47371440 CCTAGGCTGGGAGCTGGGGAAGG No data
953974388_953974412 7 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974412 3:47371414-47371436 AACCCCTAGGCTGGGAGCTGGGG No data
953974388_953974403 -2 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974403 3:47371405-47371427 CGGCCCCCCAACCCCTAGGCTGG No data
953974388_953974410 5 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974410 3:47371412-47371434 CCAACCCCTAGGCTGGGAGCTGG No data
953974388_953974417 12 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974417 3:47371419-47371441 CTAGGCTGGGAGCTGGGGAAGGG No data
953974388_953974411 6 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974411 3:47371413-47371435 CAACCCCTAGGCTGGGAGCTGGG No data
953974388_953974404 -1 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974404 3:47371406-47371428 GGCCCCCCAACCCCTAGGCTGGG No data
953974388_953974418 26 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974418 3:47371433-47371455 GGGGAAGGGTTGTGATTTTGTGG No data
953974388_953974419 30 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974419 3:47371437-47371459 AAGGGTTGTGATTTTGTGGATGG No data
953974388_953974401 -6 Left 953974388 3:47371384-47371406 CCCCCACCCCCACCCCGCCGCCG No data
Right 953974401 3:47371401-47371423 CCGCCGGCCCCCCAACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953974388 Original CRISPR CGGCGGCGGGGTGGGGGTGG GGG (reversed) Intergenic
No off target data available for this crispr