ID: 953975110

View in Genome Browser
Species Human (GRCh38)
Location 3:47376526-47376548
Sequence AAGGGCCCATCCAACTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953975102_953975110 23 Left 953975102 3:47376480-47376502 CCTGGGTTTCTACATTGGTAAAA No data
Right 953975110 3:47376526-47376548 AAGGGCCCATCCAACTCTGCTGG No data
953975100_953975110 28 Left 953975100 3:47376475-47376497 CCAGGCCTGGGTTTCTACATTGG No data
Right 953975110 3:47376526-47376548 AAGGGCCCATCCAACTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953975110 Original CRISPR AAGGGCCCATCCAACTCTGC TGG Intergenic
No off target data available for this crispr