ID: 953975687

View in Genome Browser
Species Human (GRCh38)
Location 3:47380432-47380454
Sequence TGGGCACTGCCCGGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 309}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953975678_953975687 -1 Left 953975678 3:47380410-47380432 CCTCCCTATCGTCCGTCTCCCTT 0: 1
1: 0
2: 1
3: 11
4: 158
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975676_953975687 9 Left 953975676 3:47380400-47380422 CCAGGCGCTCCCTCCCTATCGTC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975680_953975687 -4 Left 953975680 3:47380413-47380435 CCCTATCGTCCGTCTCCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975671_953975687 27 Left 953975671 3:47380382-47380404 CCGCTTGAGACCCTCCATCCAGG 0: 1
1: 0
2: 0
3: 14
4: 159
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975674_953975687 16 Left 953975674 3:47380393-47380415 CCTCCATCCAGGCGCTCCCTCCC 0: 1
1: 0
2: 4
3: 50
4: 531
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975682_953975687 -5 Left 953975682 3:47380414-47380436 CCTATCGTCCGTCTCCCTTGGGC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975673_953975687 17 Left 953975673 3:47380392-47380414 CCCTCCATCCAGGCGCTCCCTCC 0: 1
1: 0
2: 1
3: 28
4: 426
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975675_953975687 13 Left 953975675 3:47380396-47380418 CCATCCAGGCGCTCCCTCCCTAT 0: 1
1: 0
2: 3
3: 13
4: 223
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309
953975677_953975687 0 Left 953975677 3:47380409-47380431 CCCTCCCTATCGTCCGTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 342
Right 953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953975687 Original CRISPR TGGGCACTGCCCGGCCTCCC AGG Intergenic
900176473 1:1293539-1293561 TGGCAGCTGCCCGGCCTGCCCGG + Exonic
900411222 1:2513569-2513591 TGGTCACTGTCCAGCCTCCTAGG + Intronic
900414587 1:2529172-2529194 TGGGAAGTCCCCGGCCGCCCGGG - Exonic
900518519 1:3094767-3094789 CGGGTGCTTCCCGGCCTCCCTGG + Intronic
900998491 1:6135503-6135525 AGGGCAATGCCAGGGCTCCCTGG - Intronic
901201617 1:7470492-7470514 TGGGCACTGCCCTGACACCTTGG - Intronic
901653575 1:10756502-10756524 TGGGCACTGCCCTGTAGCCCTGG - Intronic
902776239 1:18676597-18676619 TGGGGCCTGCCCTGCCTCCCAGG - Intronic
904256586 1:29258629-29258651 CGGGCACAGCCCGGGCACCCTGG + Exonic
904338202 1:29811481-29811503 TGGGGACGGCCCCGCCTTCCTGG + Intergenic
904533174 1:31182209-31182231 ATAGGACTGCCCGGCCTCCCAGG - Intronic
907306142 1:53514149-53514171 GGGGCATTGCCCGGCCTGCGGGG - Intronic
909599047 1:77441982-77442004 AGGGCTGTGCCCTGCCTCCCAGG - Intronic
911100187 1:94089537-94089559 TGCTCACTGCTCCGCCTCCCGGG + Intronic
915327343 1:155087097-155087119 TGTCCACTGCCCGCCCCCCCAGG - Exonic
915937515 1:160098147-160098169 CAGGCACTGCTCGGCCTCCCGGG - Intronic
917329067 1:173863018-173863040 GCCGCAGTGCCCGGCCTCCCAGG - Intergenic
918048241 1:180954031-180954053 TGGGGACAGCCCGCCCTGCCAGG - Intergenic
918378510 1:183932672-183932694 TGGGCCCGGCGCAGCCTCCCTGG + Intronic
919759632 1:201089353-201089375 TGGGCCCTGGCCAGCCGCCCCGG + Exonic
920571606 1:207022164-207022186 TCGGCCCCGCCCGGCCTCCCTGG - Exonic
921050679 1:211509102-211509124 TAGGCTCTGCCCAGCCTCACTGG + Intergenic
922421910 1:225465984-225466006 TGGGCACAGTCTGGCCACCCAGG + Intergenic
922714426 1:227859543-227859565 TGGGCACTGCCTGCCCTACTGGG - Intergenic
922722457 1:227905860-227905882 TGGGCACTGCCTGCCTGCCCTGG + Intergenic
1062908848 10:1199364-1199386 TGGGGCCTGCCCGGGCTGCCTGG - Intronic
1062925782 10:1314523-1314545 TCCCCACTGCCCGGCCTCCAGGG + Intronic
1063448344 10:6134368-6134390 TGGGCACTGTCCTGCTCCCCTGG + Intergenic
1064999090 10:21320891-21320913 TCGGCCCTCCTCGGCCTCCCAGG - Intergenic
1066303440 10:34117095-34117117 TGGCAACTGCCCTGCCTTCCCGG + Intronic
1067102662 10:43344128-43344150 TGGCCACTGCGCTGTCTCCCGGG - Intergenic
1067179470 10:43973889-43973911 TGGGCACTGCAGGCCCTCCAAGG + Intergenic
1067552229 10:47244127-47244149 AGGGCAATGCCTGGCCACCCAGG + Intergenic
1067569068 10:47358630-47358652 TGGCCGCTGCCCAGGCTCCCTGG - Intergenic
1072624100 10:97099773-97099795 GGGGCACTGCCCGGGGTCTCTGG - Intronic
1073326703 10:102647509-102647531 GGGGCCCTGCCTGCCCTCCCAGG + Intronic
1073650260 10:105351343-105351365 TGGAGACTGCCCTGCCTCACGGG + Intergenic
1074395591 10:113095502-113095524 TGGGCACTGCAGTGCCTCCCTGG + Intronic
1074436739 10:113440641-113440663 TGGGTACTGCTCTGCCCCCCGGG - Intergenic
1074559764 10:114524932-114524954 TGGACCCCGCCAGGCCTCCCTGG + Intronic
1074761425 10:116669959-116669981 TGGCCTCTGCCCGGCCGCCCAGG + Exonic
1076264791 10:129101189-129101211 TGGGGATTGTCCTGCCTCCCAGG - Intergenic
1076492717 10:130873949-130873971 TGGACACTGCCCAAACTCCCTGG - Intergenic
1076675868 10:132147495-132147517 TGGGCACAGCCTGGGCTCCAAGG + Intronic
1076745327 10:132510034-132510056 TGGGCCCATCCTGGCCTCCCAGG - Intergenic
1076908480 10:133375261-133375283 CGGGAGCTGCCCGGCCTCCTGGG - Intergenic
1077103453 11:832232-832254 GGGAACCTGCCCGGCCTCCCTGG - Intergenic
1077115106 11:880562-880584 TGTTCCCTGCCCGGCCTCCAGGG - Intronic
1077194588 11:1272762-1272784 TGGGCCCGGCCTGGCCTTCCCGG - Intergenic
1077298863 11:1838166-1838188 AGGGCAATGCCAGGCCTGCCCGG + Intergenic
1077383225 11:2257208-2257230 CCGGCACTGCCCGGCTGCCCTGG + Intergenic
1080557659 11:33431833-33431855 TGAGCCTTCCCCGGCCTCCCTGG - Intergenic
1081635657 11:44719979-44720001 TGGACACTGCCCGAGATCCCTGG + Intergenic
1081753662 11:45529751-45529773 TGGGCAGTGCCCTTCCACCCTGG + Intergenic
1083724177 11:64619760-64619782 TGGACACTGCCAGGACTGCCAGG - Intronic
1083757074 11:64797380-64797402 TGGGCCCTGCCCCTCCTACCAGG - Exonic
1084089545 11:66870892-66870914 TGGCCCCTGCCCGCCCTCGCAGG - Exonic
1084120452 11:67066070-67066092 TGGAGACTGGCTGGCCTCCCTGG - Intronic
1084320670 11:68371849-68371871 TGGGCACTGGCAGCCCTCCATGG - Intronic
1084438223 11:69156321-69156343 TGAGAACTGGCCGGACTCCCAGG + Intergenic
1084636929 11:70398839-70398861 TGCCCCCTGCCCGGCCTCCTTGG - Intronic
1085276327 11:75302509-75302531 TGAGCGCTGCCCAGCCTTCCTGG + Intronic
1088089517 11:106021979-106022001 TGGGCCCTCCCCAGCCTCCCCGG + Exonic
1089092321 11:115888264-115888286 TGAGCACTGCTGGACCTCCCTGG + Intergenic
1089735041 11:120544921-120544943 TGAGCACAGCCCGGACTCCCAGG + Intronic
1090331458 11:125935650-125935672 TGGACCCTGCTCGGCTTCCCAGG + Intergenic
1090644295 11:128755209-128755231 TGTGCCCAGCCCTGCCTCCCGGG + Intronic
1090961643 11:131562534-131562556 TGGTCTCTGCCGGGCCTCCTTGG - Intronic
1091665430 12:2415381-2415403 GGGGCGCTGCGCGGCCTCCACGG - Intronic
1092915092 12:13182445-13182467 TGGGGACTGCCGGACATCCCTGG - Intergenic
1097671068 12:62539337-62539359 GGGTCACTGCTCTGCCTCCCAGG + Intronic
1101440899 12:104703686-104703708 TGGGCAGTGCCAGGCCTCACAGG - Intronic
1101606142 12:106248383-106248405 TGGACCCTGCTCGGCCGCCCCGG - Intronic
1102180635 12:110909921-110909943 AGGGCACTGCCTGGGCTCCTAGG + Intergenic
1102516533 12:113452353-113452375 TAGGCACTCCCTGGACTCCCTGG - Intergenic
1102571522 12:113829845-113829867 TGGGCACTGCCTGTCCTCTGGGG - Intronic
1103902065 12:124308564-124308586 TGGGCCATGCCCCACCTCCCAGG + Intronic
1103904703 12:124321389-124321411 GGGGCTCTGCCCAGCCTCACTGG - Intergenic
1103968726 12:124656158-124656180 TGCCCACCGCCCCGCCTCCCAGG - Intergenic
1104069409 12:125331187-125331209 TGGGCTCAGTCCGGGCTCCCGGG + Intronic
1104460471 12:128951940-128951962 CGGGCACGGCCCTGCCTCCAAGG - Intronic
1105997231 13:25684453-25684475 TGTGCTCTGCTCGGCCTCCATGG + Intronic
1106140171 13:27005411-27005433 TGGCCTCTGCCCACCCTCCCAGG + Intergenic
1107133582 13:36920543-36920565 CGGCCCCTGCCCGGCCTGCCGGG + Intronic
1113457950 13:110462283-110462305 CGGGGACAGCCCGGCGTCCCAGG + Exonic
1113680766 13:112243139-112243161 TGGGCACTGACCGGCCTCTTGGG - Intergenic
1113932485 13:113975663-113975685 CTGGCACTGCCTGGCCTCCTGGG + Intergenic
1117365978 14:55027488-55027510 TGGCCGCTGCCTGGCCTCGCAGG + Intronic
1119029750 14:71182786-71182808 TGGGCACCTACCTGCCTCCCAGG - Intergenic
1119740215 14:77009126-77009148 TGAGCCCTGCCCTGCCTCCAGGG - Intergenic
1122075201 14:99231241-99231263 TGGGAGCTGCCCTTCCTCCCTGG + Intronic
1122804004 14:104247634-104247656 TGGGCCCTGCTCACCCTCCCTGG + Intergenic
1122951899 14:105049878-105049900 ACGGCCCTGCGCGGCCTCCCTGG + Exonic
1123014677 14:105368008-105368030 TGGTCACTGCCTGGTTTCCCGGG + Intronic
1123178853 14:106447908-106447930 TGGACAATACCCGGCTTCCCTGG + Intergenic
1123216419 14:106813101-106813123 TGGGCCCTGGCCGGCGTCCAGGG - Intergenic
1124109299 15:26772381-26772403 TGGTGAGTGCCCGCCCTCCCAGG - Exonic
1124233895 15:27970330-27970352 TGGGCCCTGCTCTGCCTCTCTGG - Intronic
1125534779 15:40436694-40436716 TGGGCACCCCCCAGGCTCCCGGG - Intergenic
1127764698 15:62173583-62173605 TAGGCGCTGCCCGGCCTCAGCGG - Intergenic
1129773390 15:78217129-78217151 TGGGTGCTGCCAGGCCCCCCAGG + Intronic
1132337809 15:101059940-101059962 AGGGCCCGGCCCAGCCTCCCAGG - Intronic
1132608076 16:801754-801776 AGGGAACCGCCCGGCCTGCCTGG + Intergenic
1133017586 16:2951417-2951439 TGGGCACTGACCGCCCTCCCAGG + Intergenic
1133103580 16:3493564-3493586 TGCACTCAGCCCGGCCTCCCAGG + Exonic
1135295812 16:21278353-21278375 TGGTCACAGCCCAGCCTCCGGGG + Intronic
1138541732 16:57691787-57691809 TGCCCACTGCCTGGCCTGCCTGG + Intergenic
1139373311 16:66481421-66481443 TGGGGCCTGTCCCGCCTCCCAGG - Exonic
1141555536 16:84834437-84834459 GGGGCAGTGCCCGGCAGCCCTGG - Intronic
1141663240 16:85452933-85452955 TGGGCACTGAGGGTCCTCCCTGG + Intergenic
1142004450 16:87682823-87682845 TGGCCACTGGCAGGCCCCCCCGG + Intronic
1142150693 16:88511346-88511368 TGGGCACTCCTCAGCCTCGCCGG + Intronic
1142260636 16:89041059-89041081 TGGGCACTGACCGGAGTCCAGGG - Intergenic
1142698979 17:1648445-1648467 GCGGCACTGCCCTGCCTCCGAGG + Exonic
1142882622 17:2893716-2893738 CTGGCACTGCCTGGCCTCCATGG - Intronic
1145264955 17:21375467-21375489 TGGGCACAGACTGGCCTCCTCGG + Intergenic
1146649812 17:34599732-34599754 TGGGCACAGCCAGGGATCCCAGG + Intronic
1147587051 17:41658788-41658810 TGGGCAATGGCCTGCCTCTCTGG - Intergenic
1147644387 17:42025123-42025145 TGGGCACTGAGCGGCCACTCTGG - Exonic
1147998408 17:44374289-44374311 TTGGCTCTGCCCTGCCTCACAGG - Intronic
1148456618 17:47814656-47814678 TGGGCACTGCCCAGCTGCCCGGG - Intronic
1148654215 17:49271154-49271176 TGCTCACTGCTCTGCCTCCCGGG - Intergenic
1150221120 17:63496492-63496514 CAGGCGCTGCCCGGCCTCCTTGG - Exonic
1151831418 17:76554375-76554397 TGGCCACTGCCCAGCTGCCCTGG + Intergenic
1151877832 17:76877424-76877446 TGGGCCCTGCCAGACCTCCCAGG + Intronic
1152229752 17:79108555-79108577 TTGGCACGGCTCTGCCTCCCTGG - Intronic
1152462951 17:80450838-80450860 TGGCCCCAGCCCGACCTCCCCGG + Intergenic
1152600721 17:81260821-81260843 TGAGCACTGCCCAACCTGCCTGG + Intronic
1154200521 18:12296613-12296635 TGGTCACTTCCCAGCCTTCCAGG - Intergenic
1154386246 18:13895012-13895034 AGGGCACTGCCCGGCTGCTCAGG - Intronic
1157324396 18:46658241-46658263 TCGGCACTCACAGGCCTCCCCGG + Intergenic
1158649307 18:59272565-59272587 TGGGCTCGGCCGTGCCTCCCCGG + Exonic
1158653404 18:59307659-59307681 TGGGCACTGTCTGGCCTTCCAGG + Intronic
1158894092 18:61897131-61897153 TGGGCAGTGCCCAGTCTCCAGGG - Intergenic
1160678112 19:401132-401154 TGAGCAGTTCCCGGCTTCCCCGG - Intergenic
1160779426 19:871293-871315 GGGGCACCGCCCGGCCACCCGGG + Intronic
1161004729 19:1929513-1929535 CGGGCTCTGCCCTGGCTCCCGGG + Intergenic
1161333778 19:3700276-3700298 AGGTAACGGCCCGGCCTCCCGGG - Exonic
1161698236 19:5782175-5782197 TGGCCACTGCCTGGACCCCCAGG + Intergenic
1161772746 19:6240193-6240215 TGGGGTCTCCCTGGCCTCCCAGG - Intronic
1163323579 19:16588725-16588747 TGGGCACTGCCCTGCCTGAATGG - Intronic
1163548393 19:17952180-17952202 TGGGCCCCGCCCCGCCGCCCGGG - Intronic
1164617497 19:29675745-29675767 GTGGCTCTGCCGGGCCTCCCAGG + Intergenic
1164927962 19:32145387-32145409 TGGGCACTGCCCTGTCTCTATGG - Intergenic
1165719256 19:38067398-38067420 TGGGGACTGCCCTGGGTCCCTGG + Intronic
1166205095 19:41264457-41264479 CGAGCCCGGCCCGGCCTCCCAGG - Exonic
1166475270 19:43118994-43119016 TGTGCCCAGCCCGGCCTTCCTGG + Intronic
1166714135 19:44955618-44955640 CCGGCACCGTCCGGCCTCCCGGG - Intronic
1167169999 19:47824611-47824633 TGGGCACCTCCCTCCCTCCCAGG + Intronic
1167982256 19:53284726-53284748 GTGACACTGCCGGGCCTCCCTGG - Intergenic
1167983889 19:53299247-53299269 GTGACACTGCCGGGCCTCCCTGG + Intergenic
925801497 2:7606588-7606610 TGGTCACTGCACGGGCTCCATGG + Intergenic
926239964 2:11077885-11077907 TGGGCACTGCTGGCCTTCCCTGG - Intergenic
927022858 2:19035493-19035515 TGGGCCCTTCCCGGCCTTTCAGG + Intergenic
927869837 2:26616417-26616439 AGGGCCCAGCCTGGCCTCCCAGG - Intronic
931516661 2:63054200-63054222 TGCGCACTCCCCGGGCTCCAGGG + Intronic
931695055 2:64865211-64865233 CGGGCACTGCCGGCACTCCCGGG - Intergenic
934503761 2:94876974-94876996 TGGGCACTTCCTGTCCTCTCAGG - Intergenic
934527227 2:95059428-95059450 TGGCCTCGGCCCCGCCTCCCAGG + Intergenic
934678245 2:96265309-96265331 TGGGCAGAGCGCTGCCTCCCGGG + Exonic
934899005 2:98142259-98142281 TAGACCCTGCCCCGCCTCCCTGG + Intronic
934988281 2:98902728-98902750 TTGCCACGGCCCAGCCTCCCTGG + Intronic
935132352 2:100270134-100270156 TGGGCAATACCCGGCTTTCCAGG - Intergenic
938463563 2:131512768-131512790 TGGACACTGTCCTCCCTCCCTGG - Intergenic
942459091 2:176157383-176157405 GGGGCACCGCGCGGCCCCCCTGG - Intronic
945270459 2:207933596-207933618 AGGGCACTGGCCAGTCTCCCAGG + Intronic
946147829 2:217744206-217744228 TGGGGACTGCCAGGTCTCCAGGG + Intronic
946310772 2:218881302-218881324 TGGGCACTGCCTTGTCTCCCTGG - Intronic
946351786 2:219160281-219160303 TGGGCCCCGCCCGGTCCCCCTGG + Intronic
947586529 2:231360250-231360272 AGGGCACTTCCTGGCCACCCTGG + Intronic
947590062 2:231380321-231380343 TGGGAACTGCCCGACTGCCCTGG + Intergenic
947722018 2:232375885-232375907 TGCTCACTGCTCCGCCTCCCAGG - Intergenic
947753137 2:232543129-232543151 AGGGCCCACCCCGGCCTCCCAGG - Intronic
948294932 2:236853650-236853672 TGGAGACTGCCAGACCTCCCTGG - Intergenic
949007449 2:241657872-241657894 GGGGCTCTACCCGACCTCCCTGG + Intronic
949010129 2:241673523-241673545 TCGGCACTGACCGGCCCACCTGG + Exonic
1172205331 20:33159209-33159231 TGGGCACCGGCAGGGCTCCCAGG + Intergenic
1172876134 20:38165348-38165370 TGGGCAATGGGTGGCCTCCCAGG - Exonic
1173502633 20:43565297-43565319 TGGCCAGGACCCGGCCTCCCTGG - Intronic
1173504510 20:43576289-43576311 CGGCCACTGTCCGGCCTCCGGGG - Exonic
1173655726 20:44699043-44699065 TGGCCCCAGCCCTGCCTCCCAGG + Intergenic
1175237457 20:57524834-57524856 GGGGCCCTGCCAGGCCTCCGAGG - Intronic
1175619512 20:60431505-60431527 TATGCCCTGCCCTGCCTCCCTGG - Intergenic
1175882605 20:62269575-62269597 GCCGCACTTCCCGGCCTCCCTGG + Intronic
1175998605 20:62822117-62822139 TCTGGACTCCCCGGCCTCCCTGG + Exonic
1176012118 20:62903496-62903518 AGGCCCCTGCCCTGCCTCCCTGG - Intronic
1176058473 20:63161262-63161284 TGTGCCCGGCCAGGCCTCCCTGG - Intergenic
1176074252 20:63241320-63241342 GTGGCACTGCCCTGCCGCCCTGG + Exonic
1176130572 20:63495122-63495144 TGAGCCCTGCCCCGCCTGCCTGG + Intronic
1176163434 20:63660341-63660363 TGGGCAATACCCGGCTTTCCAGG + Intronic
1176215674 20:63946583-63946605 TGGGCACTGGGCGCTCTCCCCGG - Exonic
1176256110 20:64154110-64154132 TGGGCAGTCCCAGGCCTTCCAGG + Intronic
1178280940 21:31282434-31282456 TGAGCACTGCCTGCCCTCCACGG + Intronic
1179519629 21:41933665-41933687 TGGGATCTGCCCGGGCTCCTGGG - Intronic
1179563905 21:42234620-42234642 TGGGCAGAGCCCGGCCTTCCGGG - Intronic
1179588501 21:42389377-42389399 TGAGAACTGCTCGGCCTTCCTGG + Intronic
1179906954 21:44427457-44427479 TGGGCACTGGCAGGCTTACCTGG + Intronic
1180003075 21:45003880-45003902 TGGGCACAGCCAGGACCCCCAGG - Intergenic
1180086593 21:45510457-45510479 TGGGCACTGCCACGTCCCCCAGG + Intronic
1180581968 22:16846159-16846181 TGGTCAGTGCCCGGGCTCCTGGG - Intergenic
1180699206 22:17772676-17772698 TGGGCACTGCTGGGGCTCCTGGG + Intronic
1181804760 22:25367950-25367972 TGGGCACTGGCAGCCCTCCACGG + Intronic
1182318969 22:29466088-29466110 AGGGCTCTGCCTGGCCTCACTGG - Intergenic
1183668098 22:39256594-39256616 TCGGAGCTGCCCGGGCTCCCTGG + Intergenic
1183806853 22:40219155-40219177 GGGGCTCAGCCCGGTCTCCCAGG - Intronic
1183948598 22:41340395-41340417 TGCTCCCTGCCCAGCCTCCCGGG + Intronic
1184213825 22:43053127-43053149 TGGGCCCTCCCCAGCCTGCCTGG + Intronic
1184640714 22:45868550-45868572 TGGCCAGAACCCGGCCTCCCGGG + Intergenic
1184864021 22:47192618-47192640 TGGACACAGCCTGACCTCCCGGG - Intergenic
1185069482 22:48648238-48648260 AGGCCCCTGCCAGGCCTCCCAGG + Intronic
1185205561 22:49535905-49535927 TGGCCCCTGCCCAGCCTCCCGGG - Intronic
950229408 3:11263290-11263312 TGGGCACTGCATGGACTTCCAGG + Exonic
951524759 3:23643313-23643335 TGGAAGCTGCCCGGCCTCCTAGG + Intergenic
953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG + Intergenic
954224324 3:49172586-49172608 AGGGCACTGACCGGCCCCTCAGG - Intronic
954628534 3:52035929-52035951 TGGGCACTGGCTGGAGTCCCGGG + Intergenic
954973176 3:54668792-54668814 TGGACACTGTACGGCCTTCCAGG - Intronic
956975178 3:74570567-74570589 AGGGCACTGCCAGTCATCCCAGG - Intergenic
959567619 3:107848748-107848770 TGGGCAGTGACCGGCCTCAGAGG + Intergenic
960951488 3:123001259-123001281 TGGCCACAGCTCAGCCTCCCTGG + Intronic
961323922 3:126098652-126098674 TGGGCAGGGCCAGGCCTGCCTGG - Intronic
961367079 3:126406791-126406813 TGGCCAGTGCCTTGCCTCCCAGG - Intronic
961539188 3:127589059-127589081 TGGGCAACCCCAGGCCTCCCAGG + Intronic
961817844 3:129560434-129560456 TGACCACTGCCCGGCCTCCCAGG - Exonic
963042894 3:141082250-141082272 TGGGCTTTGCCAGGTCTCCCAGG + Intronic
966512965 3:180784786-180784808 TGGGCACTAACCTGCCTCTCAGG - Intronic
967760926 3:193225652-193225674 TGGGCACTGCCAGGCCTCTGGGG + Intergenic
968574053 4:1356794-1356816 AGGTCACTGCCCGGTCTCCACGG + Intronic
968691297 4:1991797-1991819 TGGGCAGTGGCCGGGCTCTCTGG + Intronic
968976410 4:3824442-3824464 TGGGAACTGCCCGGCTTCGTGGG - Intergenic
969669877 4:8583730-8583752 TGGGCACTCTGGGGCCTCCCGGG - Intronic
979576087 4:122293884-122293906 TCTGGACTGCCCGGACTCCCTGG - Intronic
981082062 4:140645420-140645442 TTGGCACTCTCCGGCCTCTCTGG + Intronic
981518460 4:145635258-145635280 TGGGAACAGCCAGGCCTCTCTGG + Intronic
983237825 4:165199843-165199865 TGGGCATTGGCTGGCGTCCCAGG - Intronic
984767231 4:183408940-183408962 AGGGCAGGGCCAGGCCTCCCAGG + Intergenic
984868982 4:184310516-184310538 TGGGCACACCTCTGCCTCCCTGG + Intergenic
984908155 4:184649038-184649060 CTCGCGCTGCCCGGCCTCCCCGG + Intronic
985642188 5:1068899-1068921 CTGGCACTGCCTGGCCTCCCTGG - Intronic
986153322 5:5147930-5147952 AGGGCACAGCTCAGCCTCCCTGG - Intronic
986480971 5:8187636-8187658 TAGGCACTCCCAGGCTTCCCAGG - Intergenic
986520567 5:8613283-8613305 TGTGCACATCCCTGCCTCCCTGG - Intergenic
988741858 5:34083678-34083700 TGGGAACTGCTCGGTCTCCAAGG + Intronic
990410218 5:55534629-55534651 TGGTCTCTGCCCGGGCTGCCCGG + Exonic
1000296380 5:159916571-159916593 TGGGCACCGCCGGGCGCCCCCGG + Intergenic
1000956857 5:167553890-167553912 TGGGCTCTGTCCAGCCTGCCTGG - Intronic
1001506504 5:172284091-172284113 TGGGCTCGGCCCGGCCCGCCCGG + Intergenic
1002268920 5:178056678-178056700 TGGACAATACCCGGCTTCCCAGG + Intergenic
1002467305 5:179413997-179414019 TGGACACAGCCCTGCCTCCCTGG - Intergenic
1002569856 5:180134159-180134181 TGGGCACTGCCTCTCCTCACTGG - Intronic
1002579447 5:180198877-180198899 TGGGCCCAGCTCTGCCTCCCTGG - Intronic
1002801916 6:531254-531276 TGGGCACAGCACAGCTTCCCCGG + Intronic
1003221589 6:4165282-4165304 TGGGCCCTGCCAGGCTTGCCTGG + Intergenic
1006375906 6:33671478-33671500 GGGTCCCTGCCCGGACTCCCTGG + Intronic
1006451768 6:34109480-34109502 CAGGCACGGCCAGGCCTCCCGGG + Intronic
1006880246 6:37332645-37332667 GGGACACTGCTCGGCTTCCCAGG - Exonic
1006984757 6:38169092-38169114 GGAGCACAGCCCGGCCGCCCAGG - Exonic
1009558259 6:65203054-65203076 TGGGCAGTGCCTGGACTCTCAGG - Intronic
1018423881 6:163663082-163663104 TGGGCTCTGCACCACCTCCCGGG - Intergenic
1019353347 7:565484-565506 TGGACACTGCCCATCTTCCCAGG + Intronic
1019361055 7:604361-604383 CGGGTACTGCCCGGCCTCAGAGG - Intronic
1019410551 7:904823-904845 GGGGCCCCGCCCGGCCGCCCAGG + Intronic
1019428268 7:987377-987399 TGGGCCCTGGGCGGACTCCCCGG + Exonic
1019545881 7:1575919-1575941 TGGGCTGTGTCCTGCCTCCCGGG - Intergenic
1019637260 7:2082519-2082541 TGGGCTCTGGCCGGCGTCGCCGG + Intronic
1019696010 7:2446537-2446559 TGGGCACAGCCAGGGGTCCCTGG - Intergenic
1019708956 7:2509725-2509747 TGGGCACAGCCCAGCCTCTGGGG + Intergenic
1021968327 7:25943996-25944018 TAGGCCCTGCCTGGCCTCCCTGG + Intergenic
1022422052 7:30232565-30232587 TGGGAAATGCCCAGCCTCACTGG + Intergenic
1024063254 7:45714216-45714238 TGCACACTTCCAGGCCTCCCTGG + Exonic
1025145448 7:56496974-56496996 TGGGCACTTCTCAGCCTTCCTGG - Intergenic
1025217351 7:57070023-57070045 TGAGGGCTGCCCGCCCTCCCAGG - Intergenic
1025628268 7:63243676-63243698 TGAGGGCTGCCCGCCCTCCCAGG - Intergenic
1025653997 7:63500442-63500464 TGAGGGCTGCCCGCCCTCCCAGG + Intergenic
1025738365 7:64174683-64174705 TGGGCACTTCTCAGCCTTCCTGG - Intronic
1026807704 7:73438185-73438207 AGGGCCCTGCCCTCCCTCCCAGG - Intergenic
1026935038 7:74249647-74249669 TGTGCACAGCGCTGCCTCCCTGG - Intronic
1027001435 7:74657398-74657420 TGGGGCCTGCGCGGCCGCCCGGG - Intergenic
1027050778 7:75019953-75019975 TGGGCAGGGCCCAGCTTCCCTGG + Intronic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1029547288 7:101217135-101217157 TCGGCCGTGCCGGGCCTCCCCGG + Intronic
1032947569 7:136870375-136870397 TGCGCGCTGCCCGGCGCCCCTGG + Intronic
1033552544 7:142460614-142460636 GGGGGACTGCCGGGTCTCCCAGG + Intergenic
1034944521 7:155253358-155253380 CAGGCAATGCCCAGCCTCCCTGG + Intergenic
1035093045 7:156330499-156330521 TGCACACTGCCTGGCCTCCAGGG + Intergenic
1035243665 7:157548569-157548591 TGAGCGCTGCCCGGCCTCTCCGG - Intronic
1035246541 7:157566197-157566219 TTGGCACTGCCCGACTGCCCGGG + Intronic
1035405865 7:158596821-158596843 TGGGCAGTGGCCAGCCTCCTGGG - Intergenic
1035441280 7:158903082-158903104 TGGACACTGCCACGCCTCCAGGG - Intronic
1036618117 8:10404371-10404393 TCGTCACTTCCCTGCCTCCCTGG - Intronic
1038838715 8:31158854-31158876 TGGCCACTCCCCCGCATCCCTGG - Intronic
1039965378 8:42280223-42280245 TGTTCACTGCCCTCCCTCCCTGG - Intronic
1040323286 8:46329075-46329097 TGGGAACCGACAGGCCTCCCTGG + Intergenic
1040850952 8:51899618-51899640 TGGGCCCCGCCCTGCCTGCCAGG + Intergenic
1041774340 8:61507931-61507953 TGGGCACTGCTCTCCATCCCTGG + Intronic
1041929833 8:63274393-63274415 TGGGCCTTGCCCGGTCACCCAGG + Intergenic
1042739712 8:72029691-72029713 CTGCCACTGCCCGGCATCCCAGG - Intronic
1045506021 8:102779352-102779374 TGGGCCCCGCCTGCCCTCCCAGG - Intergenic
1047533041 8:125694574-125694596 TTGCCGCTGCCCGGCCACCCTGG - Intergenic
1049015422 8:139916525-139916547 GCGGCACTCCGCGGCCTCCCGGG + Intronic
1049324614 8:142015556-142015578 TGTGCACAGCCCTCCCTCCCAGG + Intergenic
1049393164 8:142382398-142382420 TGGGCAGAGGCCGGCCTCCCGGG - Intronic
1049440351 8:142606856-142606878 TGGGCTGTTCCCAGCCTCCCAGG - Intergenic
1049592459 8:143468830-143468852 TGGGCCCTGCCAGGCCCCTCTGG + Intronic
1049708237 8:144052448-144052470 TGGGGCCTGCGCCGCCTCCCAGG - Exonic
1049803806 8:144530037-144530059 TGGGCCTTGCCCAGCCGCCCCGG - Exonic
1052947381 9:34179177-34179199 CTGGCACCGGCCGGCCTCCCAGG - Exonic
1052955662 9:34251572-34251594 TGGGCTCTGCAGGGCCTCCCAGG - Exonic
1056660094 9:88536792-88536814 AGGGCACCGCCCAGCCTTCCAGG + Intronic
1056756852 9:89387086-89387108 TGGGCACTGCCCCAACTCCTCGG + Intronic
1056951596 9:91044562-91044584 GGGGCTCTGCCCAGCATCCCTGG - Intergenic
1057146021 9:92760098-92760120 TGGGCCCTGCCTGGTCTCCCAGG - Intronic
1057172389 9:92970824-92970846 TGGCCACTGCCTGGCCTTCAAGG - Intronic
1057295164 9:93830427-93830449 CTGGCACTGCACAGCCTCCCTGG + Intergenic
1057573209 9:96219410-96219432 GGGTCACTGCCCGGCCTGCGGGG + Intergenic
1057906714 9:98989128-98989150 TGGGCCCTGCCCGCTCTGCCCGG + Intronic
1058469255 9:105260256-105260278 GGGTCATTGCCCTGCCTCCCAGG + Intronic
1059328320 9:113518244-113518266 TGGGCTCTGCCCTGGCTACCTGG + Intronic
1059341494 9:113599943-113599965 TGGGCCCTGCCTGGGCTCCCTGG + Intergenic
1060010245 9:120037509-120037531 TGGGCACTGAGTGGCCTCCCTGG - Intergenic
1061083518 9:128386119-128386141 TGGGCAGTGCCTGGCCTGCATGG - Intronic
1061189191 9:129071732-129071754 TGGGCACTAACCCGCCTCCCAGG + Exonic
1061189210 9:129071794-129071816 TGGGCACTAACCCACCTCCCAGG + Exonic
1061275913 9:129569245-129569267 CGGGCCCTGCCCTCCCTCCCTGG - Intergenic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1062005938 9:134238512-134238534 TCAGGACTGCCCAGCCTCCCAGG + Intergenic
1062021528 9:134321732-134321754 GGGGCCCAGCCCAGCCTCCCTGG - Intronic
1062283102 9:135760575-135760597 GGAGCACTGCCCTGTCTCCCCGG - Intronic
1062343892 9:136105993-136106015 GGGGCTCTGCCGTGCCTCCCGGG - Intergenic
1062431879 9:136529993-136530015 GGGGCCCTGCCCTGGCTCCCAGG + Intronic
1062449265 9:136608693-136608715 GGGGCCCAGCCTGGCCTCCCTGG + Intergenic
1062634071 9:137480758-137480780 TGGGCACTGTCAGGCCTCCCAGG - Intronic
1185596578 X:1310693-1310715 TGTACAGTGCCAGGCCTCCCTGG + Intergenic
1185761346 X:2691545-2691567 TGGGCACAGCGCGTCCTGCCGGG - Intronic
1186184858 X:7010801-7010823 TGTGCCCAGCCCGGCCTTCCTGG + Intergenic
1186496181 X:10014709-10014731 AGGGCACTGCCCGCTCTCTCGGG + Intergenic
1187727098 X:22214641-22214663 TGGGCACTGCCAGGTACCCCTGG - Intronic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic
1201862437 Y:18614025-18614047 AGAGCACTTCCTGGCCTCCCAGG + Intergenic
1201870886 Y:18706355-18706377 AGAGCACTTCCTGGCCTCCCAGG - Intergenic