ID: 953979648

View in Genome Browser
Species Human (GRCh38)
Location 3:47407233-47407255
Sequence GGACACCCCCTCAGTCCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953979648_953979650 -8 Left 953979648 3:47407233-47407255 CCGGTAGGACTGAGGGGGTGTCC 0: 1
1: 0
2: 2
3: 8
4: 80
Right 953979650 3:47407248-47407270 GGGTGTCCTGGTGCCAGCCTTGG 0: 1
1: 0
2: 2
3: 49
4: 379
953979648_953979652 4 Left 953979648 3:47407233-47407255 CCGGTAGGACTGAGGGGGTGTCC 0: 1
1: 0
2: 2
3: 8
4: 80
Right 953979652 3:47407260-47407282 GCCAGCCTTGGTTAGTGCTAAGG 0: 1
1: 0
2: 1
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953979648 Original CRISPR GGACACCCCCTCAGTCCTAC CGG (reversed) Intronic
900167138 1:1248324-1248346 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
900167583 1:1249644-1249666 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
905825027 1:41020750-41020772 GGACACTCCCTGAGTCCTCTGGG - Exonic
906210938 1:44011791-44011813 GGCCACCAGCTCAGTCCTGCAGG - Intronic
912959319 1:114181190-114181212 GGACACCACCTCTTTCCTATTGG - Intergenic
916254419 1:162772054-162772076 GGGCACCCCCTCAGGGCCACTGG - Exonic
924201444 1:241663435-241663457 GGCCACCCCCTCAGAACTAGAGG + Intronic
1063143730 10:3277387-3277409 GGCCACCCCCTCTGTGTTACAGG + Intergenic
1064959591 10:20948826-20948848 GGACATCCCCTCAGTGCTGTGGG - Intronic
1078727745 11:13946735-13946757 GCAGACCTCCTAAGTCCTACTGG - Intergenic
1090356868 11:126146425-126146447 GGACACCCCCTGCTTCCTGCTGG - Intergenic
1090589679 11:128251872-128251894 GTACACTGCCTCAGTCCTATAGG + Intergenic
1099769379 12:87031937-87031959 GTACACCCCCACATTGCTACAGG + Intergenic
1101864331 12:108508960-108508982 GGACACTCAAGCAGTCCTACGGG + Intergenic
1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG + Intergenic
1105420598 13:20248519-20248541 GGACTCCACCTCTGTCCTACTGG - Intergenic
1106132916 13:26954339-26954361 GGACAGCCCCTCAGTCCCAGAGG - Intergenic
1113306880 13:109088885-109088907 GGGCAGCCCCTCACTCCTCCAGG + Intronic
1113846227 13:113393350-113393372 GGACACGCAGTCAGTCCGACTGG + Intergenic
1121637951 14:95466411-95466433 AGACCCTCCCTCAGTCCTACTGG + Intronic
1122425063 14:101601070-101601092 GCACACCCTCTGAGTCCTCCCGG - Intergenic
1124162202 15:27282879-27282901 GGACACCCCCCCAGCCTCACTGG + Intronic
1124371528 15:29107181-29107203 GGAAACCCCCTCAGTGCTGGTGG + Intronic
1128258078 15:66212790-66212812 GGACTCCCCCCCAGCCATACAGG + Intronic
1129467192 15:75730828-75730850 GGACACAGCCTCAGACCTCCTGG - Intergenic
1129651406 15:77493312-77493334 TGACTCTCCCTAAGTCCTACTGG - Intergenic
1132991938 16:2799835-2799857 GAACTCCCCCTCACTCCTTCAGG - Intergenic
1135176735 16:20236537-20236559 AGGAACCCCCTCACTCCTACAGG + Intergenic
1135400845 16:22165460-22165482 GGAGTTCCCCTCAGTCCTAGAGG + Intergenic
1136141052 16:28288911-28288933 CGACTCCCTCTCAGTTCTACAGG - Intergenic
1138514659 16:57529309-57529331 GGACGCCTCCTCGGACCTACGGG + Exonic
1141236066 16:82217659-82217681 AGACACCCACACAGTCCTACTGG - Intergenic
1149434328 17:56620157-56620179 GGACACCAGCCCAGTCCTGCTGG - Intergenic
1152151816 17:78606040-78606062 GGACTGCCCATCAGTCCTCCTGG + Intergenic
1152549268 17:81021249-81021271 GGAAAGCCCCTCAGTGCTCCGGG + Intergenic
1161435259 19:4259036-4259058 GGACACAGCCTCAGGCCTCCTGG + Intronic
1161683710 19:5693055-5693077 AGCCACCCCCCCAATCCTACTGG + Intronic
1164057261 19:21632223-21632245 GGACACCCCTTCAACCCTAATGG + Intergenic
1166976821 19:46609687-46609709 CAACGCCCCCTCAGTCCTTCTGG - Exonic
1168316247 19:55485956-55485978 GCTCACCCCCCCAGCCCTACTGG + Intronic
931535390 2:63270781-63270803 GGAGAGCCCCTCAGTCCTTATGG + Intronic
932112067 2:69010958-69010980 GGACACCCCCTGCTTCCTTCCGG + Intergenic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
937274570 2:120675525-120675547 GGACACCCCGTCAGCCCCACGGG + Intergenic
938766101 2:134461431-134461453 GGGCACAGCTTCAGTCCTACAGG - Intronic
938928035 2:136062155-136062177 GGCCAACCCCTCTTTCCTACAGG + Intergenic
940046790 2:149418258-149418280 GGAAACCCCCACATTCTTACTGG + Intronic
943209029 2:184938844-184938866 GGACAAAGCCTCGGTCCTACTGG - Exonic
946159883 2:217829655-217829677 GGACACCTCCTGAGTCCTGATGG - Intronic
946414855 2:219534914-219534936 GGACCCCCCCCCAGTCCCAGGGG + Intronic
948545988 2:238729257-238729279 GGTGACACCCTCTGTCCTACTGG - Intergenic
1169025144 20:2364471-2364493 CTACACTCCCTCTGTCCTACTGG - Intergenic
1174188207 20:48721926-48721948 AGACAGCCCCTCTGTCCTTCTGG - Intronic
1174436490 20:50510638-50510660 GAACATCCCCTCAGACCTCCAGG + Intronic
1175790201 20:61736023-61736045 GGACACCCCCTCAGTCCCAGAGG + Intronic
1181417482 22:22771143-22771165 GCACAGCCCCTCAGTGCTAGAGG - Intronic
1181760442 22:25054742-25054764 AGACACCCCCTCCCTCCTCCAGG - Intronic
1184521956 22:44999884-44999906 GGACACGTCATCAGTCCCACTGG + Intronic
953979648 3:47407233-47407255 GGACACCCCCTCAGTCCTACCGG - Intronic
955269671 3:57484981-57485003 AGATACCACCTCACTCCTACAGG + Intronic
956502158 3:69898608-69898630 GTTCTCCCCCTCTGTCCTACTGG - Intronic
957140728 3:76352323-76352345 GCACATCCCCTCGTTCCTACTGG + Intronic
962457068 3:135574380-135574402 TGACACCACCACAGTCCCACAGG + Intergenic
962898645 3:139737768-139737790 GGTCAGCCCCTCTGTCCTGCAGG + Intergenic
965484970 3:169267527-169267549 GCCCACCCCCTCAGCCCCACAGG - Intronic
969635971 4:8369728-8369750 GGACCCTCCCTCAGTCCTCAGGG - Intronic
975973532 4:80071413-80071435 GGACAGCCCTTCAGTCCTTGAGG - Intronic
985080627 4:186260792-186260814 AGACACCAGCCCAGTCCTACTGG - Intergenic
994517594 5:100790468-100790490 AGCCACCACCTCAGTGCTACAGG - Intergenic
997720561 5:136075386-136075408 GGAGACCCCCTCAGCCCTACTGG + Intergenic
1004379595 6:15120914-15120936 GGAAACACCCCCAATCCTACTGG + Intergenic
1006119463 6:31795356-31795378 GGTCAGACCCTCAGTCCTATGGG - Intronic
1006919844 6:37620150-37620172 GGACAGCCCCACTCTCCTACAGG + Intergenic
1019332911 7:469704-469726 GGACCCCACCACAGTCCTGCAGG - Intergenic
1027149515 7:75722962-75722984 GGCCACCCTTTCAGACCTACAGG - Intronic
1029915830 7:104208547-104208569 GGAAAGCCTCTCAGTCCTAATGG + Intergenic
1035034090 7:155884117-155884139 GGACAGCCCCTCAGTCCCTGTGG + Intergenic
1037781352 8:21871375-21871397 TGACACCCCCTCAGTACTTCGGG - Intergenic
1039476978 8:37844140-37844162 GGAAGCCCCCTCAGGCCTGCAGG + Exonic
1044717391 8:95113055-95113077 TGAGACCACCACAGTCCTACGGG + Intronic
1049603759 8:143519838-143519860 GGACACCCCCGCAGTCCCAGAGG + Intronic
1050362483 9:4843800-4843822 GGACACCCTCTCACTTCTGCTGG + Intronic
1055986948 9:82062268-82062290 GGCCTCCCCCTCTGCCCTACTGG + Intergenic
1062115589 9:134806431-134806453 GGACACACGCTCTGTCCTAGAGG - Intronic
1192099986 X:68254244-68254266 TGACACCTCCTAGGTCCTACGGG - Intronic
1194123371 X:89987093-89987115 CTACACCCTCTCAGTCCGACAGG + Intergenic
1196054508 X:111340387-111340409 GCAGACCCCCTTACTCCTACAGG - Intronic
1198027369 X:132720276-132720298 GGACACCCCATATATCCTACAGG + Intronic
1200476256 Y:3644710-3644732 CTACACCCTCTCAGTCCGACAGG + Intergenic
1201947358 Y:19526479-19526501 GGAGATCCCCTCAGCCCTTCAGG + Intergenic