ID: 953980353

View in Genome Browser
Species Human (GRCh38)
Location 3:47410336-47410358
Sequence TCCCTATGTGGGGGTAGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953980343_953980353 5 Left 953980343 3:47410308-47410330 CCTCCCCACAGCATGGCGTGGTG 0: 1
1: 0
2: 1
3: 55
4: 1252
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980345_953980353 1 Left 953980345 3:47410312-47410334 CCCACAGCATGGCGTGGTGAGCA 0: 1
1: 0
2: 1
3: 2
4: 92
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980341_953980353 10 Left 953980341 3:47410303-47410325 CCGATCCTCCCCACAGCATGGCG 0: 1
1: 0
2: 0
3: 28
4: 181
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980346_953980353 0 Left 953980346 3:47410313-47410335 CCACAGCATGGCGTGGTGAGCAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980338_953980353 12 Left 953980338 3:47410301-47410323 CCCCGATCCTCCCCACAGCATGG 0: 1
1: 0
2: 1
3: 17
4: 205
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980336_953980353 30 Left 953980336 3:47410283-47410305 CCGGAGCTGGGCCTTGTGCCCCG 0: 1
1: 0
2: 2
3: 24
4: 234
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980337_953980353 19 Left 953980337 3:47410294-47410316 CCTTGTGCCCCGATCCTCCCCAC 0: 1
1: 0
2: 6
3: 20
4: 298
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980344_953980353 2 Left 953980344 3:47410311-47410333 CCCCACAGCATGGCGTGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220
953980340_953980353 11 Left 953980340 3:47410302-47410324 CCCGATCCTCCCCACAGCATGGC 0: 1
1: 0
2: 3
3: 18
4: 292
Right 953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953980353 Original CRISPR TCCCTATGTGGGGGTAGGGC CGG Exonic
901830678 1:11890271-11890293 ACCCTATGTGGGTGTCAGGCTGG - Intergenic
902117093 1:14130235-14130257 TCCAAATGTGTGGGGAGGGCAGG + Intergenic
902290630 1:15432520-15432542 TGCCAAGGTGGGGGTGGGGCGGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903951174 1:26996739-26996761 TCCCGATTTGGGGGTGGGGTGGG + Intronic
906568597 1:46817899-46817921 ACCTTATGTGGAGGTAGGCCTGG + Intronic
907267945 1:53274223-53274245 TACCTGTGTGGGAGTAAGGCAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912521088 1:110245118-110245140 TCCCCATGAGGGGCTGGGGCTGG + Intronic
914748154 1:150514400-150514422 TCCCGAGGTGGGAGTGGGGCTGG + Intergenic
915089887 1:153416908-153416930 TCCCTCTGTGGGGGCAGAGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915976978 1:160397897-160397919 TCACTAGGTGGAGGTGGGGCTGG - Intergenic
915980035 1:160414802-160414824 CTCCTATGAGGGGGTGGGGCCGG + Intronic
916039388 1:160949365-160949387 ACCCTTTGTGGGTGTCGGGCTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
917282144 1:173387352-173387374 TCCTCATGTGGGGGAAAGGCTGG - Intergenic
917504681 1:175616846-175616868 TCCCTGTGTGGCTGTAGGACAGG + Intronic
918427954 1:184429315-184429337 TACCCATGTGGGGGTAAGGAGGG - Intronic
920693498 1:208164425-208164447 TCCCTATGAGAGGGAAGGGAAGG - Intronic
922485878 1:225972659-225972681 TCCTTCTCTGGGGATAGGGCTGG + Intergenic
922731772 1:227952255-227952277 ACCCTAGTTGCGGGTAGGGCAGG - Intergenic
922752518 1:228077207-228077229 TCCCTATGAGGTGGCGGGGCTGG - Intergenic
1063675457 10:8137494-8137516 CCCCCATGTGAGGGAAGGGCGGG + Intergenic
1066243603 10:33561312-33561334 TCCCTCTGTGGGGATGGGGGTGG + Intergenic
1067694236 10:48523812-48523834 TCCCCATGTGGGAGTGGGGGTGG - Intronic
1067893124 10:50152906-50152928 TCCCTAGGTGCGGGTCGGGCGGG - Intergenic
1069544415 10:69318569-69318591 TCCCTACGTGGGGGACGTGCAGG + Intronic
1069961223 10:72080593-72080615 TCCCTGTGAGGGGGTGGGGGTGG + Intronic
1070350155 10:75583975-75583997 TCCCTATGGGGGGGCTGGGAAGG - Intronic
1070963702 10:80516639-80516661 TGCCTATCTGGAGGTAGGTCAGG + Intronic
1071545137 10:86522993-86523015 TCCATTTGTGGGAGAAGGGCGGG - Intergenic
1071601553 10:86961028-86961050 TTCCTACCTGGGGGTGGGGCGGG + Intronic
1073289619 10:102407119-102407141 GCCCTGGGTGGGGGTAGGGGAGG - Intronic
1075372472 10:121949668-121949690 CCCCTTTGTGGGGGCAGGGGTGG - Intergenic
1075636554 10:124034664-124034686 TCCCTGTTAGGGGGTAGAGCCGG - Intronic
1077150536 11:1071154-1071176 TCCCTGTGTGGGGCTGGGGTTGG + Intergenic
1079101006 11:17542458-17542480 TCCCTGTGTGCAGGCAGGGCAGG - Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080304644 11:30823158-30823180 TCCCTAAGTGGTGGTAGGCAAGG + Intergenic
1080392849 11:31864470-31864492 GAACTATGTGGGGGTGGGGCAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081774403 11:45667432-45667454 TCCCTGGGTGGGGGTGGGGAGGG - Intergenic
1083052790 11:59792027-59792049 TGGCTATGTGGGGGTGGGGAGGG + Intronic
1083228468 11:61299982-61300004 CCCCTATGTGGAAGTGGGGCGGG - Exonic
1083433781 11:62629184-62629206 TCCTTCTGTGGGGGTAAGACAGG - Exonic
1083725685 11:64626895-64626917 TCCCAAAGTGGGGGGCGGGCAGG + Intronic
1084028762 11:66468351-66468373 GCCCTATGTGGGGGGAGGAGGGG - Intronic
1084176641 11:67425772-67425794 TCTTGATGTGGGTGTAGGGCAGG - Intergenic
1085322612 11:75583945-75583967 TCCCCATCTTGGGGTGGGGCAGG - Intergenic
1087930485 11:103972281-103972303 TCACAATGTGGGGGTAAGGATGG - Intronic
1089561760 11:119346697-119346719 TCTCTGTGTGGGGGAAGGGATGG + Intergenic
1091337627 11:134784299-134784321 TCACCATGTGGGGGTGGGGTAGG + Intergenic
1092044303 12:5418182-5418204 TGCCTCTGTGGGGATGGGGCAGG - Intergenic
1092075020 12:5665714-5665736 TCCCTGGGTGGGGGTGGGGGTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097249798 12:57626281-57626303 TCTCTCTGTGGGGGTGGGGCTGG + Exonic
1097250952 12:57632131-57632153 ATCCTAGGTGGGGGTAGGGTGGG + Exonic
1099035342 12:77580196-77580218 TCTTTATTTGGGGGTAGGGTGGG + Intergenic
1099654323 12:85469480-85469502 ACCCTTTATGGGGGTCGGGCTGG + Intergenic
1102481951 12:113229864-113229886 TCCCTCTATGGGGGTTGGGGAGG + Intronic
1102680551 12:114687712-114687734 TTCCTTTGTGGGGGTGGGGTCGG + Intergenic
1103526068 12:121569385-121569407 TCCCCATGGGAGGGTAGGGAGGG - Intronic
1105825614 13:24119994-24120016 TCACTCTGTGGGGGTGGGGCTGG - Intronic
1106542739 13:30704546-30704568 CCCCTGTTTGGGGGCAGGGCTGG + Intergenic
1107636330 13:42395874-42395896 TCCCCATTTGGGAGCAGGGCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108126649 13:47252050-47252072 TCCCTCTCTGGGGGTTGGGAGGG + Intergenic
1111172780 13:84550489-84550511 CCCCTGTGTGTGGGTAGGGGTGG + Intergenic
1112661752 13:101517808-101517830 ACATTATTTGGGGGTAGGGCTGG + Intronic
1113064503 13:106359807-106359829 TACGTATGTGGGGGCAGGGAGGG + Intergenic
1114207228 14:20583639-20583661 TCTCTGTGTGGGGGGAGGGTGGG - Exonic
1115338571 14:32268121-32268143 TCCAAATGTTGGGGTAGGGAAGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121733265 14:96201275-96201297 TCGCCATGCGGGGCTAGGGCTGG + Intergenic
1122549501 14:102542330-102542352 TCCCTGAGTGTGGGTAGGACTGG - Intergenic
1122930571 14:104931438-104931460 TCCCTAGATGGGGGTGGGGGTGG + Intronic
1126455081 15:48852255-48852277 TGCTAATGTGGTGGTAGGGCAGG + Intronic
1127013729 15:54659457-54659479 TCTCTGTGTGAGGGTAGGGTGGG - Intergenic
1128109282 15:65066752-65066774 CCCCTCTCTGGGGGTGGGGCTGG + Intronic
1128747160 15:70122854-70122876 TCCATATTTGGGGGTGGGGCTGG + Intergenic
1129151520 15:73691534-73691556 TCACTGAGTGGGGGCAGGGCAGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131153959 15:90063490-90063512 TGCCTAAGTGGGGGCAGGGCAGG - Intronic
1131353089 15:91719246-91719268 TCCCTAGTTTGGGGTAGGGTAGG - Intergenic
1131554745 15:93387231-93387253 TTCCTTGGTGGGGCTAGGGCTGG + Intergenic
1132730138 16:1357027-1357049 TCCCTATGTGCCTGTTGGGCAGG + Intronic
1132959028 16:2612106-2612128 TCTCTGTATGGGGGTGGGGCAGG + Intergenic
1132972087 16:2694081-2694103 TCTCTGTATGGGGGTGGGGCAGG + Intronic
1133033668 16:3023230-3023252 TACCTGAGTGGGGGCAGGGCTGG + Exonic
1135354595 16:21758580-21758602 TCCCTATGTGAAGGCAGGACAGG - Intronic
1135453085 16:22574720-22574742 TCCCTATGTGAAGGCAGGACAGG - Intergenic
1135861210 16:26057802-26057824 TGCCTTTGTGGGGGTCGTGCAGG + Intronic
1137465731 16:48707244-48707266 TCCCCATTTGGAGGTAGGCCTGG - Intergenic
1137481234 16:48853363-48853385 TCCCTCTGTGTGGGGAGGGCCGG - Intergenic
1138515274 16:57532763-57532785 TCTCTATGTGGAGCTAGGCCAGG - Intronic
1138515613 16:57534154-57534176 TCCCCAGGTGGGGGTGGGGTTGG - Intronic
1139529602 16:67536628-67536650 TCCCTCTGTGGGAGTAGGGATGG + Intronic
1141687776 16:85580108-85580130 TCTCTTTCTGGGGGAAGGGCAGG + Intergenic
1141821471 16:86449127-86449149 TCCCTAAGTGGGGGTGCAGCGGG + Intergenic
1141888386 16:86909241-86909263 TACCTGGGTGGGGGTGGGGCAGG - Intergenic
1142904470 17:3033017-3033039 GCCCCATGTGGGGAGAGGGCTGG - Intronic
1143477420 17:7210924-7210946 TCCCTCCATGGGGGTGGGGCAGG - Intronic
1143615424 17:8046594-8046616 TGCCTGTGTGGGGGAAGGTCTGG + Intronic
1144340810 17:14309292-14309314 TCCCAGTGCGGGGGCAGGGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145921580 17:28613969-28613991 ACCCAATGTGGGGGTGGGGCAGG - Intronic
1146805091 17:35858523-35858545 TGCCTATGAGGGGGCAGGGTAGG + Exonic
1146820689 17:35981827-35981849 TCTGTATGTTGGGGAAGGGCAGG + Intergenic
1148127937 17:45246485-45246507 TCACTGAGTGGGGGTGGGGCAGG - Exonic
1148589599 17:48805912-48805934 TTTCTCTGTGTGGGTAGGGCTGG - Intronic
1149670761 17:58407324-58407346 GCACTTTGTGGGGCTAGGGCAGG - Intronic
1151453994 17:74215309-74215331 CCCCTAGGTGGGGGTAGGGATGG + Intronic
1151484455 17:74389681-74389703 TCCCTAAGAGGGGGTATGGGGGG + Intergenic
1151852781 17:76700937-76700959 TCCTGATGTGGGCGCAGGGCTGG + Intronic
1152236002 17:79139237-79139259 TCCCTGTGTCGGGGTGGGGGGGG - Intronic
1154076128 18:11203582-11203604 TCCCTGCCTGGGTGTAGGGCTGG - Intergenic
1155958087 18:31970823-31970845 TGCATACGTGGGGGTGGGGCAGG - Intergenic
1156190225 18:34710532-34710554 TGCCCATGTGGGGGTGGGGGTGG - Intronic
1158420032 18:57285189-57285211 TGCATATGTGGGGGTGGGGTGGG - Intergenic
1158642371 18:59214506-59214528 TCCCTTTCTGGGGGTAGGAGTGG - Intergenic
1162728135 19:12701947-12701969 TGCATCTGTGGGGGTGGGGCAGG + Intronic
1162909171 19:13840268-13840290 TACCTATGTGGGGAGAAGGCAGG - Intergenic
1163134941 19:15303392-15303414 TGCCTATGCGGGGATGGGGCGGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163893729 19:20039299-20039321 TCCCGAGGTGGGGGCAGGGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165004107 19:32790150-32790172 TACCCATGTTGGGGTTGGGCTGG + Intronic
1165390630 19:35536793-35536815 TCACTATGCGGGGGAAGGGAGGG - Exonic
1166210967 19:41306365-41306387 GCCCTAGGTGAGGGTGGGGCTGG + Intronic
1168267430 19:55230457-55230479 TCCCGGGGTGGGGGCAGGGCGGG - Exonic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
933420646 2:82041840-82041862 TTCCCATGTGGTGCTAGGGCAGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
935499197 2:103817943-103817965 TCCCTAGGTTGGGGCGGGGCAGG - Intergenic
937070497 2:119059623-119059645 TCCCTCTACGGGGGCAGGGCTGG - Intergenic
940229029 2:151430669-151430691 ACCCTAAGTGGGGGGAGGGGGGG - Intronic
947169177 2:227293937-227293959 TCTGTATTTGGGGATAGGGCTGG - Intronic
948525262 2:238567341-238567363 TCCTGATATGGGGGAAGGGCAGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168786663 20:545186-545208 TCCCCATGTGGGGTTAGGGCTGG + Intergenic
1169039293 20:2479918-2479940 TCCCTCTGCTGGGCTAGGGCAGG + Intronic
1170273262 20:14552311-14552333 TCTCTATGTGGGGGTGGGGGTGG + Intronic
1172749381 20:37239349-37239371 TCCCTTTGTTGGTCTAGGGCAGG - Intronic
1176165666 20:63672202-63672224 TCCCTGAGTGGGGCTGGGGCAGG + Intronic
1177549589 21:22602478-22602500 TCTCTATTCGTGGGTAGGGCAGG - Intergenic
1178834843 21:36088095-36088117 GCCCTGTGTGGGGGAAGGCCAGG - Intergenic
1178961777 21:37072801-37072823 TCCCTGTGGGAGGGGAGGGCAGG + Exonic
1179589359 21:42396087-42396109 TTGCTATGTGGGGGAAGGACCGG - Exonic
1179998055 21:44982968-44982990 TCCCTATGTGGCGATAACGCCGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181762056 22:25065418-25065440 TTCCTATGTGGGGACGGGGCAGG - Intronic
1183660321 22:39216236-39216258 TCGCCGTGTGGGTGTAGGGCCGG - Intergenic
1184646277 22:45897111-45897133 TTCCTGTGTGGGGCTAGGGTGGG - Intergenic
1184874894 22:47268109-47268131 TCCCTGTGTGGGTGGAGGGAAGG - Intergenic
1185137332 22:49080295-49080317 TCCCTATCTGGGGCCTGGGCGGG - Intergenic
1185333950 22:50263293-50263315 TCCCTGGGTGGGGGCTGGGCAGG - Intergenic
950654213 3:14426763-14426785 TCCCTACCTGGGAGGAGGGCTGG + Intronic
952286287 3:31972599-31972621 TCCTTATGTGTGGGTAGAACTGG - Intronic
952885189 3:38007703-38007725 TCCACATGTGGGGACAGGGCTGG - Exonic
953645456 3:44749601-44749623 TCCAAATGTTGGGGTAGGGAAGG - Exonic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
954848758 3:53582608-53582630 TCCCTAGGTGGGGGTAGCTAAGG + Intronic
954934852 3:54317297-54317319 TCCCAAGGTAGGGGTAGGGAAGG + Intronic
954992863 3:54855951-54855973 CCCCTCTGTGGGGGAAGGGGAGG - Intronic
955347600 3:58172638-58172660 TCCTTTTGTGGGGGTGGGGTGGG + Intergenic
958086459 3:88814473-88814495 TCCATATGTTGGGGTAGGCTTGG + Intergenic
961655424 3:128439052-128439074 TCCCTAGCTGGGGGTAGAGGGGG - Intergenic
961705663 3:128783255-128783277 CATCTAAGTGGGGGTAGGGCAGG - Intronic
961954301 3:130785439-130785461 TACCTCTGAGGAGGTAGGGCAGG - Intergenic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
966647144 3:182259422-182259444 ACCCTATGAGGTGGTAGGGCAGG - Intergenic
968575143 4:1362549-1362571 ACCCTATGTGGTGCTGGGGCTGG - Intronic
969049394 4:4361999-4362021 CCCATATGTGGGGGCTGGGCAGG + Intronic
969298314 4:6282284-6282306 TCCCCATGTGGGGGATGCGCCGG + Intronic
971928934 4:33052990-33053012 TTACTGTGTGGGGGTAGGGGTGG + Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972788608 4:42349534-42349556 TACCAATGTGGGAGTAGGCCGGG + Intergenic
972847352 4:43005704-43005726 TCCAGATGTGGGTGAAGGGCAGG + Intronic
977721410 4:100244168-100244190 TCCCTCTCTGGGGGTTGGGTGGG - Intergenic
980132667 4:128831166-128831188 TCCCTCTGTGGGGTTAGAGATGG + Intronic
986229035 5:5844583-5844605 TGCCTATGTGGGGGTGGAGAAGG - Intergenic
988579162 5:32454095-32454117 TCCCTATGAGGGCGTAAGGACGG + Intergenic
989151040 5:38300182-38300204 TCCCGAGGTGGGGGTGTGGCTGG + Intronic
990837248 5:60035688-60035710 TCCCTATTTGGGAGGAGGGGTGG - Intronic
997414356 5:133713637-133713659 TCCCTATTTGGGGGTTGGACTGG - Intergenic
997749425 5:136330156-136330178 CCCCCATGTGGGGGCGGGGCAGG - Intronic
1000418078 5:161005336-161005358 GCCCTATGTGTGGGTATGGTGGG + Intergenic
1000565700 5:162844771-162844793 TCCAAATGTGGTTGTAGGGCAGG + Intergenic
1002204561 5:177553973-177553995 TCCCAGTGTGGGTGTACGGCCGG + Intronic
1002565629 5:180111630-180111652 TCCCCATGAGGGGGAGGGGCTGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004519743 6:16350716-16350738 TCCCTATTTGTGGGGAGGGAAGG + Intronic
1005926946 6:30452390-30452412 TGCCTTTATGGGGGAAGGGCTGG - Intergenic
1005928685 6:30465096-30465118 TGCCTTTATGGGGGAAGGGCTGG - Intergenic
1006439874 6:34047347-34047369 TCCATATGTTGGGCTAGGTCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008542573 6:52558089-52558111 GCCTGAGGTGGGGGTAGGGCAGG - Intronic
1009338335 6:62522783-62522805 TCTGTATGTGGGGGTATGCCAGG - Intergenic
1010564939 6:77399406-77399428 AGCCTAAGTGGGGGTGGGGCGGG + Intergenic
1019540476 7:1548884-1548906 GGCCTATGCAGGGGTAGGGCAGG + Intronic
1019632481 7:2057119-2057141 TCTCTAGGTGGGGCTGGGGCAGG - Intronic
1021788913 7:24180123-24180145 TCCCTCTGTGCGGGCAGGTCAGG + Intergenic
1022637549 7:32151218-32151240 TCTGTTTGTGGGGGTGGGGCTGG - Intronic
1022795434 7:33727902-33727924 TCTCCTTGTGGGGGTGGGGCAGG + Exonic
1024088696 7:45918277-45918299 TCCCTGGGTGGGGGTGGGGTAGG + Intronic
1024415512 7:49100917-49100939 TCCCTTTTTTGGGGTAGGGGTGG + Intergenic
1025994361 7:66518733-66518755 TCCCTCTCTGGGGGCAGGGCAGG - Intergenic
1026033637 7:66815930-66815952 TCCCTCTCTGGGGGCAGGGCAGG + Intergenic
1026848749 7:73712031-73712053 TCCGTCTATGAGGGTAGGGCTGG + Intronic
1026985974 7:74555422-74555444 TCCCTCTCTGGGGGCAGGGCAGG - Exonic
1030383431 7:108839985-108840007 TTTTTATGTGGGGGGAGGGCAGG + Intergenic
1031539114 7:122971698-122971720 TACCTATATGGGGGAAGGGTGGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033658293 7:143387672-143387694 TCTCTGTGTGGGGGTGGGGCTGG + Intronic
1036293337 8:7515087-7515109 CCCCTCTGAGGAGGTAGGGCTGG + Intergenic
1036329221 8:7805910-7805932 CCCCTCTGAGGAGGTAGGGCTGG - Intergenic
1037637498 8:20712793-20712815 TCCCTATCTGGGCTTGGGGCAGG + Intergenic
1037902019 8:22694031-22694053 TCCCTTTGTGGGGGGAAGGAGGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039794172 8:40898020-40898042 GCCCAATGTGGGGGCAGGACCGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042922306 8:73932070-73932092 CTCCTCTGTGGGGGTATGGCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043383625 8:79728136-79728158 TCCCTATGTGAGGGTCAGGGAGG - Intergenic
1047068824 8:121318980-121319002 TGATTATGTGGGGGCAGGGCGGG + Intergenic
1051780644 9:20684694-20684716 TCCCTAGTTGGGGGCAGAGCAGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1057851922 9:98572598-98572620 TCCCTGTGTTGGGGTTGGGGTGG + Intronic
1057937814 9:99255718-99255740 ACCCTATGAGGAGGTTGGGCAGG + Intergenic
1060240423 9:121898244-121898266 TCTCTCTGTGGGGGTGGGGGTGG - Intronic
1061912444 9:133732318-133732340 CCCCTGTGGGGGGGTAGGGTGGG - Intronic
1062138744 9:134943981-134944003 TCCCTGTGTGTGGGCAGGGCTGG + Intergenic
1062337477 9:136078633-136078655 TCCCGATGTCGGGGCTGGGCTGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186784973 X:12948772-12948794 TTCCTATGAGGGGGAAGGGCAGG - Intergenic
1187201809 X:17141202-17141224 TGCCTCTGTGTGGGTAGGGCAGG - Intronic
1191861085 X:65667372-65667394 GCCCTGAGTGGGGGTGGGGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195687001 X:107596656-107596678 TGCATATGTGGGAGGAGGGCAGG - Intronic
1196439737 X:115707654-115707676 TACTCATGTGGGGGTGGGGCTGG + Intergenic
1197775903 X:130118509-130118531 CCCCGATGTGGGGGCAGGGTGGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic