ID: 953980364

View in Genome Browser
Species Human (GRCh38)
Location 3:47410379-47410401
Sequence AATTGAGGAGGTGGGGCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953980364_953980374 3 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980374 3:47410405-47410427 AGGCCCCGAGTTGGCCATGGCGG 0: 1
1: 0
2: 2
3: 8
4: 126
953980364_953980372 -6 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980372 3:47410396-47410418 TCAATTCTCAGGCCCCGAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 89
953980364_953980373 0 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980373 3:47410402-47410424 CTCAGGCCCCGAGTTGGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 131
953980364_953980378 8 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980378 3:47410410-47410432 CCGAGTTGGCCATGGCGGTTCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953980364 Original CRISPR AATTGAGGAGGTGGGGCCGA GGG (reversed) Exonic