ID: 953980364

View in Genome Browser
Species Human (GRCh38)
Location 3:47410379-47410401
Sequence AATTGAGGAGGTGGGGCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953980364_953980373 0 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980373 3:47410402-47410424 CTCAGGCCCCGAGTTGGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 131
953980364_953980374 3 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980374 3:47410405-47410427 AGGCCCCGAGTTGGCCATGGCGG 0: 1
1: 0
2: 2
3: 8
4: 126
953980364_953980372 -6 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980372 3:47410396-47410418 TCAATTCTCAGGCCCCGAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 89
953980364_953980378 8 Left 953980364 3:47410379-47410401 CCCTCGGCCCCACCTCCTCAATT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 953980378 3:47410410-47410432 CCGAGTTGGCCATGGCGGTTCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953980364 Original CRISPR AATTGAGGAGGTGGGGCCGA GGG (reversed) Exonic
901748135 1:11388242-11388264 GATGGAGGAGGTGGGGGAGAGGG + Intergenic
902770843 1:18644658-18644680 AAATGAGGACATGGGGCGGAGGG + Intronic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
904615013 1:31744872-31744894 AATAGTGGTGGTGGGGCAGAGGG - Intronic
905370923 1:37482359-37482381 AATTGCTGAGAAGGGGCCGATGG - Intronic
905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG + Intergenic
907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG + Intronic
909252215 1:73372948-73372970 AATTGAAGGGGTGTGGCCTAGGG + Intergenic
910122700 1:83808197-83808219 CATTGAGGAGGTGGGGAAAATGG - Intergenic
917594907 1:176519375-176519397 AGGTGAGGAGGTGGGGCTGGTGG + Intronic
919425545 1:197425920-197425942 AATGTTGAAGGTGGGGCCGATGG + Intronic
920707943 1:208268426-208268448 AAATGAGGAGGTGGGAGGGAGGG + Intergenic
921465995 1:215488671-215488693 AATTGATGGGGTGGTGCGGATGG + Intergenic
921564957 1:216705849-216705871 AATGCAGCAGGTGGGGCAGATGG + Intronic
921823023 1:219639458-219639480 ATCTGAGGAGGTGGGGCCCAGGG + Intergenic
923429244 1:233905022-233905044 ACTTGAGGCGGAGGGGCCGCGGG - Exonic
923518812 1:234720453-234720475 ATTTGAGGAGATTGGGGCGAGGG + Intergenic
1063125919 10:3136699-3136721 ACTGGAGCAGGTGGGGCAGATGG - Exonic
1063319110 10:5036035-5036057 AATTCAGCAGGTGGAGCCGACGG - Intronic
1066458291 10:35590839-35590861 ATATGAGGAGGTGGGGCCTTTGG - Intergenic
1069621712 10:69841266-69841288 AATTGGGGAGGTGGGGGCAGGGG - Intronic
1070386408 10:75928770-75928792 CATGGAGGAAGTGGGGCCCAAGG - Intronic
1071335502 10:84597129-84597151 AATTGAGGAGCTGGGGGCTGGGG + Intergenic
1074814120 10:117132032-117132054 AATTAAGGAGGAGGGTCTGAGGG + Intronic
1075169762 10:120102223-120102245 AATTGAGGAGGTGATGGAGAGGG + Intergenic
1075347694 10:121696326-121696348 AACTGAGGAGGTGGGAGCAAGGG - Intergenic
1075475114 10:122727671-122727693 CCTTGAGGAGGAGGGGCCGCGGG + Intergenic
1076553234 10:131301285-131301307 AATTGAGGAGGTGAGAAAGAAGG - Intronic
1078631141 11:13005769-13005791 AATTGGGGAGGAGGGGTTGAGGG - Intergenic
1079243588 11:18737755-18737777 ACTGGAGGAGGTGGGACAGAGGG - Intronic
1079255114 11:18821144-18821166 AATTCAGCAGGTGGAGCTGACGG + Intergenic
1081713491 11:45232909-45232931 ACTTGAGGGGGTGGGGGGGAAGG - Intronic
1081781925 11:45719048-45719070 CTTTGAGGAGGTGGGGGAGAAGG - Intergenic
1081785736 11:45745651-45745673 AATTCAGGAAGTGGGGTCAAGGG + Intergenic
1085218398 11:74851909-74851931 CATTGATGAGGTGGGGATGAGGG + Intronic
1085669986 11:78454298-78454320 AATATTGGAGGTGGGGCCTAGGG + Intronic
1085736333 11:79042384-79042406 TATTAAGGAGGTGGGGCCTTTGG + Intronic
1086003687 11:82011083-82011105 AATTGTTGGGGTGGGGCAGAAGG - Intergenic
1088361694 11:108997301-108997323 AATTGAAGAGGTGAGGGAGAGGG - Intergenic
1089337762 11:117736743-117736765 AAATGAGGAGATGGGGCCAATGG - Intronic
1089822055 11:121237485-121237507 AATTCAGCAGGTGGAGCTGAGGG - Intergenic
1090890610 11:130919417-130919439 AAGAGAGAAGGTGGGGCTGAGGG + Intergenic
1091198088 11:133748895-133748917 ATGTTAGGAGGTGGGGCCGTTGG - Intergenic
1091652507 12:2320514-2320536 AATGGAGGAGCGGGGGCAGAGGG - Intronic
1091714750 12:2768793-2768815 GAGTGAGGAGGGAGGGCCGAGGG - Intergenic
1092992100 12:13912876-13912898 CATTGAGGAGGGGGGACCCAGGG - Intronic
1093081551 12:14817476-14817498 AGTTGAGGAGTGGGGGGCGAGGG - Intronic
1093228121 12:16510249-16510271 AAGGGAGGAGGTGGGGAAGAAGG + Intronic
1094496403 12:30992097-30992119 AATGGAGGAGAGGGGGCCGAGGG - Exonic
1098363258 12:69676079-69676101 ATTTGAGGAGGTGGTGGTGAAGG + Intronic
1098420371 12:70290390-70290412 AATTGAGGAAGTGGAGAAGAGGG - Intronic
1099893692 12:88619249-88619271 GGTTGGAGAGGTGGGGCCGAGGG - Intergenic
1100654132 12:96622426-96622448 AACTGAGGAGGTGGAGGCTACGG - Intronic
1102223838 12:111213881-111213903 AATTTAAGAGGTGGGGCAGGGGG + Intronic
1103517631 12:121517832-121517854 AATGCAGGAGGTGGGACAGAGGG - Intronic
1110423991 13:75344637-75344659 AATTGAGGGGGTGGCATCGAAGG - Intronic
1111805897 13:93040347-93040369 AATTCAGCAGGTGGAGCTGATGG - Intergenic
1113776083 13:112945851-112945873 AATTGATGAGGAGGGGCCCATGG + Intronic
1114383580 14:22233680-22233702 AATGGTGGAGGTGGGGCCTGGGG - Intergenic
1116980425 14:51164261-51164283 ATTTAAGGAGGTGGGGGTGAGGG + Intergenic
1119177266 14:72578294-72578316 ACGTGAGGAGGTGGGACCCAGGG - Intergenic
1119322545 14:73740346-73740368 ATATGAGGTGGTGGGACCGAAGG - Intronic
1120516967 14:85482195-85482217 AAGTGAGTAGGTGGGGCAGGAGG + Intergenic
1121363889 14:93289069-93289091 AATTGAGGGGGCGGGGACAAGGG + Intronic
1122157982 14:99762046-99762068 ATATGTGGAGGTGGGGCTGATGG + Intronic
1122788731 14:104175639-104175661 AACTGAGGAGGTGGGGGAGCCGG - Exonic
1202844063 14_GL000009v2_random:150676-150698 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1202913453 14_GL000194v1_random:140919-140941 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1202879203 14_KI270722v1_random:41772-41794 AATTCAGCAGGTGGAGCCAACGG - Intergenic
1125341135 15:38676713-38676735 AATTGAGAAGGTGGCACAGAAGG - Intergenic
1126690209 15:51283246-51283268 AATTCAGCAGGTGGAGCCAACGG - Intronic
1128147407 15:65339619-65339641 ACATGAGGAAGTGGGGCTGAGGG + Intronic
1128609651 15:69063543-69063565 AAATGAGGAGGCGGGGCTCATGG + Intergenic
1129530919 15:76263883-76263905 AATTCAGCAGGTGGAGCTGATGG - Intronic
1131252536 15:90839827-90839849 AATGCAGGAGGTGGAGCTGAGGG - Intergenic
1132830448 16:1925500-1925522 ACTGGAGGAGGTGGGGCTGGGGG - Intergenic
1134359987 16:13522391-13522413 CACTGAGGGGGAGGGGCCGATGG - Intergenic
1135224311 16:20642335-20642357 AATTCAGCACGTGGGGCTGATGG - Intronic
1136599690 16:31276763-31276785 AATTGCGGGGGTGGGGCAGGGGG + Intronic
1136650027 16:31661132-31661154 AATTCAGCAGGTGGAGCTGATGG - Intergenic
1138241167 16:55428250-55428272 AAATGAGGAGGTGAGGCCTTTGG - Intronic
1139725381 16:68893493-68893515 ACTTTAGGAGGTGGGGCTGGCGG + Intronic
1139833682 16:69821250-69821272 AGTTGAGGGTGTGGGGCTGAGGG - Intronic
1139902868 16:70341966-70341988 AATAGTGGAGGTGGAGCAGAGGG - Intronic
1139914860 16:70421650-70421672 ATGTGAGGAGGTGGGGCCCAGGG + Intronic
1140443958 16:75009241-75009263 AACTGGGGAGGTGGGGGAGAGGG - Intronic
1142585249 17:968148-968170 CATTGAGGAGGTGGGGGTGGGGG + Intronic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143002847 17:3805888-3805910 AATTGAGTATGTGGGGCAGAAGG + Intergenic
1143853592 17:9831829-9831851 CGTTAAGGAGGTGGGGTCGATGG + Intronic
1146779708 17:35658353-35658375 AATGGAGTAGGTGGGGAAGAAGG - Intronic
1148844102 17:50518637-50518659 TGCTGAGGAGGTGGGGCCCAGGG - Exonic
1151365478 17:73613710-73613732 AATAGAAGAGGTGGGGCAGCTGG - Intronic
1151588132 17:75023834-75023856 AATTTAGCAGGGGGCGCCGACGG - Intergenic
1151849630 17:76682782-76682804 AATTGAGAAGGAGGGGCCGGAGG - Intronic
1151993516 17:77593873-77593895 AATGGAGGAGGAGGGCCCAAAGG - Intergenic
1152028110 17:77824765-77824787 CATTGAGGAGGAGGGGCCCAGGG + Intergenic
1154000549 18:10478657-10478679 AAATTAGGAGGTGGGGCCTGTGG - Intronic
1155734269 18:29201554-29201576 AATTTTGGAGGTGGGGCCTCTGG + Intergenic
1157232406 18:45930366-45930388 AGTTGAAGGGGTGGGGGCGAGGG + Intronic
1159759978 18:72413245-72413267 GATTGAAGAGGAGGGGCCCATGG - Intergenic
1159869405 18:73743651-73743673 AATTGGAGAGTTGGGGCCCAGGG - Intergenic
1160033161 18:75279554-75279576 AATTGAGGAGCTGGAGCAGGAGG + Intronic
1161481673 19:4513813-4513835 TTTTGAGGAGGTGGGGCCTCTGG - Intronic
1162019690 19:7862870-7862892 GAATGAGGAGGCGGGGCCGCGGG - Intronic
1162693348 19:12451750-12451772 AATTCAGCAGGTGGAACCGAAGG - Intronic
1164323373 19:24170511-24170533 AATTGATCAGGTGGAGCCAATGG + Intergenic
1165403397 19:35615922-35615944 ACCTGAGGAGGTGAGGTCGAAGG + Intronic
1166193206 19:41189589-41189611 AATTGTGGAGGAGGGGGAGAAGG + Intergenic
1167504794 19:49865532-49865554 AAGTGAAGAGGTGGGGCCTAAGG - Intronic
1167754274 19:51401744-51401766 AATTCAGCAGGTAGAGCCGATGG + Intergenic
1168623332 19:57896425-57896447 AATTCAGCAGGTGGAGCTGATGG - Intronic
925507459 2:4584221-4584243 AAGTGAGGAGGTGGGGGAGCAGG - Intergenic
925955863 2:8963248-8963270 AATTGAGGCGGGGGGGCAGGGGG + Intronic
926717801 2:15938998-15939020 AGGTGAAGAGGTGGGGGCGATGG + Intergenic
927485385 2:23485201-23485223 ATCTGAGGACGTGGGGCTGAGGG - Intronic
928399496 2:30967633-30967655 AATTCAGGAGGTGGGGCAAAAGG - Intronic
928458143 2:31443327-31443349 AATGCAAGAGGTGGGGCTGATGG - Intergenic
929756790 2:44772757-44772779 AATTGGGGAGGAGGAGCAGAGGG - Intergenic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
932880640 2:75498542-75498564 AATTGAAGAGGTAGTGCAGAAGG - Intronic
934051154 2:88212075-88212097 GAGAGAGGAGGTGGGGCCCACGG + Intergenic
935194261 2:100802694-100802716 ACTTGAGGAGGGGGGACAGAGGG + Intergenic
935677017 2:105603545-105603567 AATTGAGGGGCTGGGGCAGGAGG - Intergenic
936785865 2:116094068-116094090 AATGGAGGTGGTGGGCCAGATGG + Intergenic
942816238 2:180057455-180057477 AATTCAGCAGGTGGAGCCGACGG - Intergenic
944817899 2:203397950-203397972 AATGTTGGAGGTGGGGCCTAGGG - Intronic
944980315 2:205110118-205110140 AATTGAGGATGGGGAGCCGGGGG - Intronic
945204680 2:207319423-207319445 AATTGAGTGGGTGGGGAGGAGGG - Intergenic
946249708 2:218404902-218404924 AAGGGAGGAGGTGGGGCAGGGGG - Exonic
1169501249 20:6162927-6162949 AATGAAGAAGGTGGGGGCGATGG - Intergenic
1170022359 20:11850436-11850458 AAATGAGGGGGTGGGGCCTTTGG + Intergenic
1174559671 20:51421649-51421671 CATGCAGGAGGTGGGGCCCAAGG + Intronic
1175892449 20:62321643-62321665 AGTGGAAGAGGTGGGGCCAATGG + Intronic
1176632814 21:9155596-9155618 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1176640505 21:9299233-9299255 AATTCAGCAGGTGGAGCCAACGG - Intergenic
1178599997 21:33986855-33986877 AATAGATGAGGTGTGGCTGAGGG - Intergenic
1180069284 21:45428056-45428078 CATGGAGGAGGTGGTGCCGACGG - Intronic
1180349529 22:11788617-11788639 AATTCAGCAGGTGGAGCCAACGG - Intergenic
1180388674 22:12203618-12203640 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1183345800 22:37307045-37307067 AACTGAGGAGGTGGGGGTGGAGG + Intronic
1183981393 22:41542510-41542532 TGTTGAGGAGGTGGGGTTGAAGG - Intronic
1183988577 22:41583140-41583162 AAATGAGGGGGTGGGGCTGGGGG + Intronic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
1184189914 22:42887646-42887668 AGGAGGGGAGGTGGGGCCGAGGG + Intronic
1184291544 22:43500201-43500223 AATGGAGGTGGTGGGGGTGATGG + Intronic
1184926772 22:47647132-47647154 AATTGAGGGGGAGAGGCTGATGG + Intergenic
1184929159 22:47667922-47667944 AGTTGAGGTGGTGGGGATGATGG + Intergenic
1185332021 22:50256210-50256232 AATTGGGGAGGTGGGTTCTAGGG + Intronic
949315993 3:2756263-2756285 ATATGAGGAGGTGGGGCCTTTGG + Intronic
949635621 3:5978605-5978627 TATTGAGGAGGTGGGGCAGGGGG + Intergenic
951514734 3:23546001-23546023 AAGAGAGGAGGTGGGGCAGTTGG + Intronic
953925996 3:46982655-46982677 GATAGAGGAGGTGGGTCCCATGG + Intronic
953980364 3:47410379-47410401 AATTGAGGAGGTGGGGCCGAGGG - Exonic
954508472 3:51099965-51099987 AATTAATGAGGTGGAGCCAAGGG + Intronic
956423907 3:69113117-69113139 AATGGGGGAGGAGGGGTCGAAGG + Intronic
957099675 3:75811439-75811461 AATTCAGCAGGTGGAGCCAACGG + Intergenic
957957427 3:87206102-87206124 AGTTGAGCAGGTGGGTCTGAGGG + Intergenic
958039316 3:88207071-88207093 AATGCCGGAGGTGGGGCCTAAGG - Intergenic
961635787 3:128331478-128331500 CATTGAGGAAGTGGGGAAGAGGG - Intronic
961655371 3:128438846-128438868 AAGTGAGGAGGCAGGGCCAAGGG - Intergenic
965824879 3:172720306-172720328 AATTCAGTAGGTGGAGCCGTCGG - Intergenic
966680495 3:182637335-182637357 AATTGAGGAGGAGGGGTTGTGGG + Intergenic
967126041 3:186425741-186425763 AGTTGAGGAGCTGGGGCAAATGG - Intergenic
967838512 3:193984636-193984658 GATTCAGGATGTGTGGCCGAAGG + Intergenic
968313080 3:197700119-197700141 AACTGAGTCGGTGGGGCTGACGG - Intronic
1202746388 3_GL000221v1_random:105791-105813 AATTCAGCAGGTGGAGCCAACGG + Intergenic
968703869 4:2069291-2069313 AATCCAGGAGGTGGGGCAGGGGG + Intergenic
968985038 4:3870336-3870358 AAGGGAGGAGATGGGGCCCAAGG + Intergenic
969115530 4:4868555-4868577 ACAGGACGAGGTGGGGCCGAAGG - Intergenic
975987338 4:80213472-80213494 GTCTGAGGAGGTGGGGCCAAAGG + Intergenic
976540367 4:86267477-86267499 AATGGAGGATTTGGGGCAGAGGG - Intronic
978305962 4:107329017-107329039 AATTCAGCAAGTGGAGCCGACGG - Intergenic
982740879 4:159055599-159055621 AATTGAGGAGCTGAGGCTGGAGG + Intergenic
984333197 4:178353964-178353986 TTTTTAGGAAGTGGGGCCGAGGG + Intergenic
984938652 4:184912137-184912159 AATTCAGCAGGTGGAGCCCACGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985656314 5:1133362-1133384 CCTGGAGGAGGTGGGGCTGACGG - Intergenic
988366630 5:30309229-30309251 AATGTTGGAGGTGGGGCTGATGG + Intergenic
988457345 5:31398050-31398072 AATTCAGCAGGTGGAGCCGAAGG + Intergenic
988711938 5:33787717-33787739 CATTGAGGAGGTGGGGGCAGTGG - Intronic
989460448 5:41691973-41691995 AATATTGGAGGTGGGGCCAATGG + Intergenic
991613777 5:68475218-68475240 AATTGAGGAGGTGGAGCAGAGGG - Intergenic
993027507 5:82663646-82663668 AATGGAAGAGGTGAGGCCGTGGG + Intergenic
993158366 5:84256760-84256782 GATGGAGGAGGTTGGGCCGAGGG + Intronic
995022205 5:107379748-107379770 CATTGTGGGGGTGGGGCAGAAGG - Exonic
999200744 5:149814565-149814587 GCTGGAGGAGGTGGGGCGGAGGG - Intronic
999389656 5:151180861-151180883 AATTGTGGATGTGGGGCCTGGGG - Intergenic
999539034 5:152551459-152551481 AATTCAGAATGTGGGGCTGAAGG + Intergenic
999616799 5:153433485-153433507 AAGTGAGGAGGTGGGGTAGAGGG - Intergenic
1000380250 5:160622466-160622488 AATGGAGGAGGTGGTGGAGAGGG + Exonic
1000851169 5:166341619-166341641 AATTGAGAAGTGGGGGCCGGAGG + Intergenic
1001415491 5:171542458-171542480 AATTGAAAAGGAGGGGCAGATGG + Intergenic
1001435566 5:171696524-171696546 AATGGAGAAGGTGGGCCCTAAGG + Intergenic
1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG + Intronic
1002877033 6:1219873-1219895 AACTGAGGAGGGGGTGCCGCTGG + Intergenic
1007067667 6:39008272-39008294 ATTTGAACAGGTGGAGCCGATGG + Intronic
1007318408 6:41008602-41008624 ACTTGAGGTGGTGGGGGTGAGGG - Intergenic
1007378570 6:41472205-41472227 AGTTGGAGAGGTGGGGCCCAGGG - Intergenic
1007901914 6:45421392-45421414 AAATGAGGAGGGGGGGTGGAGGG - Intronic
1013133877 6:107261253-107261275 AATGCAGGAGGTGGGGCTGGTGG + Intronic
1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG + Intronic
1018234123 6:161706099-161706121 AATTGAGGATGTGGGGGGAAAGG - Intronic
1018237487 6:161740538-161740560 ACTGGAGGACGTGGGACCGAGGG - Intronic
1019196581 6:170286765-170286787 GTGTGAGGAGGTGGGGCCGGGGG - Intronic
1021532522 7:21664402-21664424 AATTGCGGGGGCGGGGGCGAGGG - Intronic
1022284832 7:28946579-28946601 ATTTTAGGAGGTGGGGCCTTTGG + Intergenic
1022389688 7:29932732-29932754 AAATAAGGAGGTGGGGTAGAGGG + Intronic
1022453455 7:30537133-30537155 AATTCAGCAGGTGGAGCCAATGG - Intronic
1023217354 7:37877799-37877821 AATTTGAGAGGTGGGGCAGAGGG - Intronic
1025103815 7:56154654-56154676 GATTGATGGGGTGGGGGCGAGGG - Intergenic
1026853454 7:73738566-73738588 AAGGGAGGAGATGGGGCCGTCGG + Intronic
1027566256 7:79798942-79798964 GTGTGAGGAGGTGGGGCCTAAGG - Intergenic
1027916818 7:84334849-84334871 AATTGAGGAGGCAGGGCCAGGGG - Intronic
1028479079 7:91284813-91284835 ATGTCAGGAGGTGGGGCTGATGG - Intergenic
1032392653 7:131566097-131566119 AATGTTGGAGGTGGGGCCTAGGG - Intergenic
1035153864 7:156896547-156896569 AAGTGAGGAAGTGGGGAAGAGGG + Intergenic
1035421102 7:158729605-158729627 AAGTGTGGAGGTGGGGGCGTTGG + Intergenic
1036989374 8:13575427-13575449 TAATTAGGGGGTGGGGCCGAGGG + Intergenic
1037159342 8:15749424-15749446 AATAGAGGGGGTGGGGCTGAAGG - Intronic
1037293933 8:17381265-17381287 AAGTGCGGTGGTGGGGCCCAGGG - Intronic
1037306603 8:17511095-17511117 GGTTGAGGAGTTGGGGGCGAGGG + Intronic
1037539873 8:19860835-19860857 AAATTAGGGGGTGGGGCAGAAGG - Intergenic
1039288711 8:36070610-36070632 TATGGAGGAGTTGGGGCAGAGGG + Intergenic
1039378673 8:37063809-37063831 CATTTAGTAGGTGGGGCCAAGGG - Intergenic
1045137550 8:99237638-99237660 AATTGAGGAGGTGATGGTGAGGG + Intronic
1046045384 8:108957663-108957685 TTTTGAGGAGGTGGTGCAGAGGG + Intergenic
1049409809 8:142467500-142467522 AGTTGAGGAAGTGGGGCTGGGGG + Intronic
1049729082 8:144166739-144166761 CAGTGAGGAGGTGGGGTCGAGGG + Intronic
1051403741 9:16711258-16711280 AATTGTGGAGGTGGGGAAGGGGG + Intronic
1052446992 9:28575546-28575568 AAGAGAGGAGGTGGGGGCAAGGG + Intronic
1055516330 9:77037175-77037197 GAATGAGGAGGTGGGCGCGATGG - Intergenic
1056746661 9:89309718-89309740 AAGTTAGGAGGTGGGGCCTTCGG + Intergenic
1059123656 9:111663376-111663398 AAAGGTGGAGGTGGGGCCGGAGG + Intronic
1059372350 9:113852660-113852682 AAGTGAGGAGGGAGGGCCAATGG - Intergenic
1060062146 9:120470327-120470349 AATGGGGGAGGTGGGGCGGAAGG + Intronic
1062060530 9:134493045-134493067 CAGGGAGGAGGTGGGGCCGGGGG + Intergenic
1062269847 9:135703380-135703402 AAATGAGGAGGTAGGGCGGATGG + Intronic
1062406955 9:136401215-136401237 CATGGAGCAGGTGGGGCCCAGGG - Intergenic
1203755647 Un_GL000218v1:123219-123241 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1203715024 Un_KI270742v1:135884-135906 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1185677039 X:1857542-1857564 ATATGAGGAGGTGGGGCCCTTGG - Intergenic
1186441871 X:9593720-9593742 AAATGGGGAAGTGGGGCGGAAGG - Intronic
1187187949 X:17005453-17005475 AAGGGAGGAGGTGGGGCACATGG - Intronic
1188269291 X:28118867-28118889 AAAGGAGGAGGGGGGGCTGAGGG - Intergenic
1188566076 X:31527959-31527981 AATAGAGGAGGTGGCCCTGAAGG - Intronic
1189607698 X:42697565-42697587 AATGGAGGGGGTGGGGGCGGTGG - Intergenic
1189671208 X:43411283-43411305 AATAGAGGAGGAGGGGGAGAGGG - Intergenic
1194077589 X:89415927-89415949 ACTTGAGGAGGTAGGGAGGAAGG + Intergenic
1196261148 X:113583102-113583124 AATGTTGGAGGTGGGGCCTAGGG - Intergenic
1196664270 X:118299813-118299835 AATTCAGCAGGTGGAGCCGACGG + Intergenic
1198278330 X:135118096-135118118 AATTGGGGAGGAGGGGAAGAGGG + Intergenic
1198292632 X:135254420-135254442 AATTGGGGAGGAGGGGAAGAGGG - Intronic
1198369201 X:135974254-135974276 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369213 X:135974278-135974300 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369225 X:135974302-135974324 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369301 X:135974473-135974495 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369312 X:135974496-135974518 GCGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198551493 X:137749790-137749812 AATTGAGAAGGTGGTGGGGAGGG + Intergenic
1199241972 X:145557397-145557419 AATTTTGGAGGTGGGGCCTTGGG + Intergenic
1199440500 X:147862777-147862799 ATTTCTGGAGGTGGGGCCCAGGG + Intergenic
1200430238 Y:3071471-3071493 ACTTGAGGAGGTAGGGAGGAAGG + Intergenic
1200714372 Y:6520665-6520687 AATGGCGGAGGTGGGGGTGATGG + Intergenic
1201019451 Y:9640491-9640513 AATGGCGGAGGTGGGGGTGATGG - Intergenic
1201169256 Y:11240824-11240846 AATTCAGCAGGTGGAGCCAACGG + Intergenic
1201569776 Y:15401293-15401315 AATTCAGCAGGTGGAGCGGATGG - Intergenic