ID: 953980572

View in Genome Browser
Species Human (GRCh38)
Location 3:47411012-47411034
Sequence GTGGACTGGCCAGCAGACGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953980572_953980585 19 Left 953980572 3:47411012-47411034 CCCTCGTCTGCTGGCCAGTCCAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 953980585 3:47411054-47411076 CCTTCACCTGCCCCATCTCCAGG 0: 1
1: 0
2: 3
3: 52
4: 542
953980572_953980575 -6 Left 953980572 3:47411012-47411034 CCCTCGTCTGCTGGCCAGTCCAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 953980575 3:47411029-47411051 GTCCACCCCTAGTCCCCACCTGG 0: 1
1: 0
2: 2
3: 7
4: 144
953980572_953980591 30 Left 953980572 3:47411012-47411034 CCCTCGTCTGCTGGCCAGTCCAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 953980591 3:47411065-47411087 CCCATCTCCAGGGCCTGGTCCGG 0: 1
1: 0
2: 3
3: 31
4: 322
953980572_953980588 25 Left 953980572 3:47411012-47411034 CCCTCGTCTGCTGGCCAGTCCAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 953980588 3:47411060-47411082 CCTGCCCCATCTCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 90
4: 688
953980572_953980586 20 Left 953980572 3:47411012-47411034 CCCTCGTCTGCTGGCCAGTCCAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 953980586 3:47411055-47411077 CTTCACCTGCCCCATCTCCAGGG 0: 1
1: 0
2: 6
3: 40
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953980572 Original CRISPR GTGGACTGGCCAGCAGACGA GGG (reversed) Exonic
900567098 1:3338867-3338889 GAGGACAGGCCAGCAGAGAAAGG + Intronic
901758592 1:11456178-11456200 GTGGACTGGCCTGCATATGGAGG + Intergenic
907327829 1:53652419-53652441 CTGGAGTGGCCAGCAGATGAGGG - Intronic
913606908 1:120475432-120475454 GGGGTCTGGCCAGGAGACTAAGG - Intergenic
915595355 1:156893754-156893776 GAGGACTGGACAGCCGAGGACGG - Exonic
916817271 1:168366221-168366243 GTGGAGTGGCCGGCAGGGGAAGG + Intergenic
917979076 1:180258343-180258365 GTGGACTGGGCAGTGGAGGAGGG + Intronic
919743533 1:200994680-200994702 GTGAGCTGGCCAGGACACGATGG + Intronic
922384892 1:225073032-225073054 GTGGACTCCCCAGCACAGGATGG - Intronic
922679465 1:227579747-227579769 CAGGACAGGCCAGCAGACCAAGG + Intronic
924634015 1:245767679-245767701 CTGGTCCGGCCAGCAGAGGAGGG + Intronic
1073454663 10:103629293-103629315 GGGGACTGGGCAGCAGCCGCTGG + Intronic
1077029789 11:459994-460016 CCTGACTGGCCAGCAGACGCAGG + Intronic
1084736309 11:71107920-71107942 TTGGCCTGGCCAGCAGTAGAAGG - Intronic
1084758449 11:71253047-71253069 GTGGCCTGGGCAGCAGACGCCGG - Intergenic
1085463777 11:76710643-76710665 GTGTACAGGCCAGGTGACGATGG + Intergenic
1087597567 11:100273092-100273114 GGGGAGAGGCCAGCAGACTAAGG - Intronic
1088877454 11:113947771-113947793 GGGGAGTGGGCAGCAGACAAAGG + Intergenic
1089681346 11:120120620-120120642 GTGAAGCGGCCAGGAGACGAGGG + Exonic
1094734869 12:33223049-33223071 CTGGAGAGGCCAGCAGACCAAGG + Intergenic
1103564195 12:121807244-121807266 GTGGACTGGACAGAAAAAGAGGG - Intronic
1107317549 13:39150070-39150092 GTGGAGTGGCCAGAAGCCCACGG + Intergenic
1112158847 13:96848083-96848105 GTGGAATGGGCAGCAGGCCAGGG - Intergenic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1114174302 14:20305931-20305953 GTGGAGTGGCCGGGAGATGATGG - Exonic
1118540073 14:66813807-66813829 CAGGACAGGCCAGCAGACCAAGG - Intronic
1121271087 14:92638791-92638813 GGGGACCGGCCAGCTGACGTTGG - Intronic
1121649625 14:95548278-95548300 GTGGACTGCCCAGCAGCCCTAGG + Intergenic
1123110064 14:105863075-105863097 GCGGACTGGCCAGGAGGGGATGG - Intergenic
1124360475 15:29033221-29033243 GAGGGCTGGGCAGCAGACGTGGG - Intronic
1125685689 15:41561932-41561954 GTGGCCTGGCCAGCAGGGGGAGG + Intronic
1129523211 15:76198625-76198647 CTGGACTGGACAGAAGACTATGG - Intronic
1131261311 15:90889471-90889493 GTGGACAGGCCAGCAGCCCTGGG - Intronic
1132299556 15:100767555-100767577 GCGGACTGGCCAGCCGACACGGG - Intergenic
1133209797 16:4257144-4257166 GTGGGCTGGCCTGAAGACCAGGG - Intergenic
1133421514 16:5650820-5650842 GAGGACGGGGCAGCAGGCGACGG + Intergenic
1136073694 16:27804279-27804301 GTGGAATAGCCAGGAGACCAGGG - Intronic
1141001048 16:80308209-80308231 GTGCTCTGGGCAGCAGAAGAAGG - Intergenic
1148103181 17:45105130-45105152 CTGGTCTGGCCAGCAGAGGGAGG - Intronic
1161276572 19:3421506-3421528 CTGGGCTGGACAGCAGCCGAGGG - Intronic
1162345493 19:10115868-10115890 GAGGGCTGGGCAGCACACGAGGG - Intronic
1166565860 19:43765171-43765193 GTGGGCTGGCCTCCAGAGGAAGG + Intergenic
1167632292 19:50632569-50632591 GTGGGCCGCCCAGCAGAGGATGG + Exonic
927225964 2:20766870-20766892 GGGGACCGGCCAGCAGTGGAGGG + Intronic
927555610 2:24029219-24029241 CTGGACTGTCCACCAGAAGAAGG + Intronic
927653168 2:24924425-24924447 GCGGACTGGGCAGGAAACGAGGG + Intergenic
933589715 2:84218705-84218727 GGGTAGTGGGCAGCAGACGACGG + Intergenic
936184491 2:110292369-110292391 GAAGGCTGGCCAGCTGACGAAGG + Intergenic
937670258 2:124530801-124530823 GTGGTTTGGCCTGCAGAAGAGGG - Intronic
941581487 2:167301853-167301875 TTGGACTGGGCAGGAGACTATGG - Intergenic
947494983 2:230628512-230628534 GCGGTCTGGCCAGCTGACGTGGG - Intergenic
1170251471 20:14288481-14288503 TGGGGCTGGCCAGCAGAGGAGGG - Intronic
1170556080 20:17515947-17515969 GTGGACTGGCCATGAGATGTAGG + Intronic
1173219998 20:41124844-41124866 GTGTACTGGCCAGAAGCAGAAGG + Intergenic
1180192594 21:46173213-46173235 CAGGAGAGGCCAGCAGACGAAGG - Intronic
1184782602 22:46656655-46656677 GGGGTCTGGCCAGCAGCCCAAGG - Intronic
1185099093 22:48828133-48828155 CTGGACTCGCCAGCAGACATCGG + Intronic
953040690 3:39252728-39252750 GGGGGCTGGCCAGCAGTCCATGG - Intergenic
953980572 3:47411012-47411034 GTGGACTGGCCAGCAGACGAGGG - Exonic
954238678 3:49276731-49276753 GTGCACAGGCCAGCAGAGGCTGG - Exonic
954626075 3:52022580-52022602 GTCTACTGCCCAGCAGAGGAAGG - Intergenic
957544610 3:81621611-81621633 GTGGACAGGACAGCCGAAGAAGG - Intronic
961510129 3:127395789-127395811 GTGGTCAGGCCAGCAGGGGATGG - Intergenic
963893357 3:150660083-150660105 TTAAACTGGCCAGCAGAAGAAGG + Exonic
967523677 3:190466704-190466726 TTGGAGAGGCCAGCAGACTAAGG - Intergenic
968891479 4:3371704-3371726 GGGTCCTGGCCAGCAGACGAGGG + Intronic
973785979 4:54332996-54333018 GTGGGCTGGGTAGCAGAAGAAGG + Intergenic
974603805 4:64122868-64122890 CTGGAGAGGCCAGCAGACCAAGG + Intergenic
975647823 4:76563029-76563051 GTGGTCTGGCCATCATACCACGG + Intronic
985694206 5:1330882-1330904 TTGGAGTGGCCAGCAGACAGTGG - Intronic
990840827 5:60077543-60077565 CTGGAGAGGCCAGCAGACCAAGG + Intronic
995299255 5:110558565-110558587 GGGGAGAGGCCAGCAGACAAGGG + Intronic
997609806 5:135207880-135207902 GAAGTCTGGCCAGGAGACGAAGG + Intronic
1001231393 5:169991577-169991599 ATGGGCTGGCCAGCAGCCCATGG - Intronic
1002501656 5:179651087-179651109 GAGCACTGGCCAGCAGATGAGGG - Intergenic
1004959673 6:20772835-20772857 GTGGACTGGGGAGGAGGCGAAGG - Intronic
1007851806 6:44810288-44810310 ATGGACTGGCTAACAGAAGACGG + Intronic
1009655406 6:66538853-66538875 GTGGACTAGCCAGCATCTGATGG + Intergenic
1019460525 7:1156154-1156176 GTGGACTGCCCAGCAGCTGAAGG + Intronic
1019460541 7:1156217-1156239 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019460558 7:1156280-1156302 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019460575 7:1156343-1156365 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019460592 7:1156406-1156428 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019460609 7:1156469-1156491 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019460626 7:1156532-1156554 GTGGACCGCCCAGCAGCTGAAGG + Intronic
1019632567 7:2057602-2057624 GTGGACTGGCCAGCTGAAAAGGG - Intronic
1028480318 7:91297442-91297464 ATGGACTGGAGAGCAGAGGAGGG - Intergenic
1029991616 7:104967570-104967592 GTGGACTGTCCAATAGAGGAAGG + Intergenic
1034089785 7:148352966-148352988 CAGGACTGGCCAGATGACGATGG + Intronic
1034414509 7:150957520-150957542 GTGGTCAGGCCAGCAGCCCAGGG + Intronic
1037490862 8:19395907-19395929 GTGGACTGGGCAGCAGTGAATGG - Exonic
1037718753 8:21422817-21422839 TTGGACTGGCAGGCAGAGGAGGG - Intergenic
1038371888 8:27002302-27002324 GTGGAATGGGCAGCAGAGGAAGG - Intergenic
1040850879 8:51899240-51899262 CTTGACAGGCCAGAAGACGATGG + Intergenic
1045046331 8:98282405-98282427 ATGGACTGGCAAGGAGACCAGGG + Intronic
1047381798 8:124371790-124371812 GTGGGCTGGCGAGAAGAGGAGGG + Intronic
1048449814 8:134523432-134523454 GTGGCCTGGCCAGGAGGCGTGGG - Intronic
1053897421 9:42756730-42756752 GTGAAATGGCCAGCAGACCCAGG + Intergenic
1056112278 9:83407804-83407826 CTGGTCTGGCCAGCAGAGGAGGG + Intronic
1056121611 9:83493862-83493884 GTGGCCTGGCCAGGAGGGGATGG - Intronic
1062038634 9:134393938-134393960 GAGGACTGGCCAGCGGCAGAAGG - Intronic
1062077687 9:134600809-134600831 CTGGCCTGGCCAGCAGAACAGGG - Intergenic
1189847318 X:45149428-45149450 GTGGACTGGCCAGCAAGCTTGGG - Exonic
1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG + Exonic
1192195690 X:69026389-69026411 GGGGACTGGCCAGTAGATGGAGG + Intergenic
1194018504 X:88657314-88657336 CTGGACAGGCCAGCAGACATGGG - Intergenic
1194323588 X:92481580-92481602 TGGGACAGGCCAGCAGACCAAGG + Intronic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1199270140 X:145873200-145873222 CTGGAGTGGCAAGCAGACCAAGG + Intergenic
1200631689 Y:5594742-5594764 TGGGACAGGCCAGCAGACCAAGG + Intronic
1201945101 Y:19502808-19502830 GAGGGCTGGCCCGCAGACCAGGG - Intergenic