ID: 953983544

View in Genome Browser
Species Human (GRCh38)
Location 3:47424918-47424940
Sequence CTCCTCTCTGAACCTTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953983544_953983549 10 Left 953983544 3:47424918-47424940 CCAGACTAAGGTTCAGAGAGGAG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 953983549 3:47424951-47424973 AAAGTAAACATCAGTGAAAAAGG 0: 1
1: 0
2: 6
3: 56
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953983544 Original CRISPR CTCCTCTCTGAACCTTAGTC TGG (reversed) Intronic
900828670 1:4948344-4948366 CTCCTCTGAGAGCCATAGTCTGG + Intergenic
903417865 1:23196738-23196760 CACCTCTCTGAGCATTGGTCGGG - Intergenic
905797424 1:40823511-40823533 CTGCTCCCTGGACCTTAGTTTGG + Intronic
909053943 1:70800591-70800613 CTTCTGTCTGATCCATAGTCTGG + Intergenic
910099228 1:83558943-83558965 CTCCTCTCTGATCTGTAGCCTGG - Intergenic
915741351 1:158120837-158120859 CTCCTTTCTGAACCCAAGCCAGG + Intergenic
916582091 1:166117974-166117996 CTCCAGTCTGAACCTGACTCTGG - Intronic
917004480 1:170397776-170397798 CTCTTCTCTGTCCCTCAGTCTGG + Intergenic
919564070 1:199161798-199161820 CTCCTCTCTGGAGTTTAGTTTGG - Intergenic
919829513 1:201530747-201530769 CTCCTCCCAGAAACTCAGTCTGG + Intergenic
922191710 1:223324592-223324614 CTCCTCTCTCAAGATCAGTCTGG + Intronic
1065107220 10:22402072-22402094 GACCTCTCTAAACCTTAGTTTGG + Intronic
1066458476 10:35592984-35593006 CTCCTCTCTCATCCTAAGTGAGG - Intergenic
1068191922 10:53663659-53663681 TTCCTCTCTGAAGCTTTCTCTGG - Intergenic
1068476633 10:57535436-57535458 ATCTTCTCTGGACCTTAGCCTGG + Intergenic
1069052272 10:63808544-63808566 CTTCTCTCTTTTCCTTAGTCTGG + Intergenic
1069862023 10:71477474-71477496 CTCCTCTTTGAATCTTCCTCAGG + Intronic
1071416846 10:85449442-85449464 CTCCTCCCAGAATCTCAGTCAGG - Intergenic
1072642931 10:97226809-97226831 CTCCTCTTTGAAACTTTCTCTGG - Intronic
1074331764 10:112519275-112519297 CTCCTCTCTGAGCCATAGGTAGG + Intronic
1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG + Intergenic
1085508278 11:77072432-77072454 CTCCTCACTGCCCCTTGGTCAGG + Intronic
1088246483 11:107822817-107822839 CTCCTCTGTGAACCTTCTCCAGG - Intronic
1089170426 11:116507831-116507853 GTCCTCTCTGGATCTAAGTCAGG + Intergenic
1092013952 12:5140824-5140846 CTCTTCTCTGCTCCTGAGTCTGG + Intergenic
1094326079 12:29240628-29240650 CTCCTCTCTGGAATGTAGTCAGG + Intronic
1096878583 12:54648842-54648864 AGCCTCTCTGGACCTTAGTCAGG - Intergenic
1098022261 12:66168734-66168756 CATCACTCTGAACCTTATTCTGG + Intronic
1099599280 12:84712203-84712225 AGCCTGTCTGAAGCTTAGTCAGG - Intergenic
1101148850 12:101866469-101866491 CTCCTTTCTGAAGGTGAGTCTGG - Intergenic
1101549365 12:105747755-105747777 CATTTCTCTGAACCTCAGTCAGG + Intergenic
1101682826 12:106986253-106986275 CACCTCTCTGAGCCTCAGTTTGG + Exonic
1102438247 12:112941967-112941989 CCCCTCTCTCAGCCTCAGTCTGG + Intronic
1110382784 13:74873729-74873751 CGCCTCTCAGAACCTTAGAAGGG + Intergenic
1110640821 13:77821775-77821797 CTCCTCTCTGATCCCTTGGCTGG + Intergenic
1111677732 13:91407346-91407368 CTCCTTTCTAAACCTTTGTCTGG - Intronic
1112047064 13:95608606-95608628 TTCCTCTCTCAACCCTACTCTGG + Intronic
1118615693 14:67573099-67573121 GTCCTCTCTGAACCATAGCAGGG + Intronic
1119401995 14:74369078-74369100 CTCCTGTCTCATCCCTAGTCTGG - Intergenic
1119427852 14:74547384-74547406 CCCCTCTCGGAACCTTCCTCTGG - Intronic
1121490995 14:94361261-94361283 CTCCTCTTTGACCCTTAGGGTGG + Intergenic
1127806352 15:62524518-62524540 CTCCTTTCTGAACCTTGGATAGG + Intronic
1128338219 15:66802238-66802260 ATCCTCTCTGGGCCTCAGTCTGG + Intergenic
1131431016 15:92389126-92389148 CACTTCTCTTAACCTTAGTTTGG - Intergenic
1132800178 16:1748156-1748178 CTGCCCTCGGAACCTGAGTCTGG - Intronic
1134010950 16:10852303-10852325 TTCCTTTTTGAACCCTAGTCTGG + Intergenic
1135640083 16:24111996-24112018 CTCATCTCATAACCTTAGACAGG - Intronic
1138272129 16:55702860-55702882 CTCATGTCTGAACCTCAGCCTGG + Intronic
1139389718 16:66599537-66599559 CTCCTCACTGCACTCTAGTCTGG - Intergenic
1140404201 16:74697186-74697208 CTCTTCTCTGAACATGAGTGAGG + Intronic
1143573989 17:7779114-7779136 CTCCTCCCTGCCCCCTAGTCTGG + Intronic
1147907430 17:43832479-43832501 CTCCTCTCTGCACTCCAGTCTGG - Intronic
1148557671 17:48588171-48588193 GTCCTGTCTGAACCCCAGTCAGG - Intronic
1152784642 17:82241426-82241448 TTGTTCTCTGAACCTGAGTCTGG - Intronic
1156069361 18:33187512-33187534 GTCCTCCCTGAACTTGAGTCTGG - Intronic
1157296572 18:46449228-46449250 CTCCTCTCTGACTCATAGCCAGG + Intronic
1159853726 18:73559167-73559189 CTCCCCTCTGAACCTTTATTGGG + Intergenic
1165638538 19:37364325-37364347 CTCCTCACTGCAGCTGAGTCTGG - Exonic
925069657 2:956332-956354 CTCCTCTCTGCAGCTCAGTCCGG + Intronic
927384833 2:22521004-22521026 CTCCTCCCTGAAACTTGCTCTGG + Intergenic
931468330 2:62512564-62512586 CACAGCTTTGAACCTTAGTCAGG - Intergenic
931789012 2:65646860-65646882 CTCCCCTTTGAACCTGGGTCAGG + Intergenic
932921124 2:75916534-75916556 CTCCTCTCTGGACCTAGGGCAGG + Intergenic
933967731 2:87443570-87443592 CTCCTCTCAGGCCCTCAGTCAGG + Intergenic
934857215 2:97736891-97736913 GTCCTCTCTGCCCCTGAGTCAGG - Intronic
936326068 2:111506926-111506948 CTCCTCTCAGGCCCTCAGTCAGG - Intergenic
937984329 2:127631815-127631837 GTCCTCTCTGAGCCTCGGTCTGG - Intronic
938140558 2:128791434-128791456 CTCCTCACTGGGCCTTTGTCAGG + Intergenic
943464501 2:188212109-188212131 CTCTTCTCTGAGGTTTAGTCAGG + Intergenic
944105268 2:196072819-196072841 GTCTTCTCTGAACCTAAGTCTGG - Intergenic
944220087 2:197294636-197294658 GTTCTCTCTGAAGCTAAGTCTGG - Intronic
946098460 2:217296981-217297003 CCCCTCTCTGTACCTCAGTTTGG - Intronic
946736126 2:222756406-222756428 GTCCTCTCTGCACCTTGCTCTGG + Intergenic
1170399896 20:15970561-15970583 CTCCTCTCTGTACCACAGCCTGG - Intronic
1172355785 20:34278696-34278718 CTCCTCTCAGAGCCTCAGACAGG + Intergenic
1178017770 21:28370439-28370461 CTTCTCTCTTTATCTTAGTCTGG + Intergenic
1183786860 22:40034348-40034370 CTCCTCACTCAACCTTGGACTGG - Exonic
1184358034 22:43995714-43995736 CTCCTCTCTGAAAATGGGTCTGG + Intronic
1185371733 22:50464145-50464167 CTCCTCTCTTGACCTCAGTGAGG - Intronic
950641587 3:14351835-14351857 CTCCTCTCTGAAGCTGTCTCTGG - Intergenic
952195003 3:31065905-31065927 TTCCTCTCTGAACCTTCTGCTGG - Intergenic
953983544 3:47424918-47424940 CTCCTCTCTGAACCTTAGTCTGG - Intronic
954105504 3:48407706-48407728 CTCCTCTGTCAACCTGAGTCAGG + Intronic
954709151 3:52496395-52496417 CCCCGCTCTGGACTTTAGTCTGG - Intronic
956048311 3:65220258-65220280 CTCCTCTTTGAATCTCAGACAGG + Intergenic
960435926 3:117626548-117626570 CTCCTCTCTAATCCTAAGTGTGG + Intergenic
962099757 3:132329431-132329453 CTCCTCTATGAAATATAGTCAGG - Intronic
962432472 3:135332550-135332572 CACCTCTCTGCACCATAGTAGGG + Intergenic
963603058 3:147393573-147393595 CTCCTCTCCGACCCTGAGCCGGG + Intronic
963853127 3:150227320-150227342 CACCTCTCTAAGCCTTAGTTGGG + Intergenic
968939994 4:3632773-3632795 CTCCTCTCTGTGTCTGAGTCTGG - Intergenic
972518708 4:39833423-39833445 CTCCTCACTGCACCCTAGCCTGG - Intronic
974764412 4:66323790-66323812 CTCCTGTCTCAACTTTATTCTGG - Intergenic
975272114 4:72448126-72448148 CCCCTCTCTGAGCCTTAGTTTGG - Intronic
975969804 4:80019776-80019798 CTCTTCTTTGTACCTTTGTCGGG - Intronic
976997277 4:91450585-91450607 CTTCTCTCTGAACTTCAGCCTGG - Intronic
978242244 4:106529837-106529859 CTCCTCACTGCACTTCAGTCTGG + Intergenic
984168135 4:176327573-176327595 CTCCTTTCTGAGCGTGAGTCGGG + Intronic
986659573 5:10046887-10046909 CTCCTCTCAGAATCTGACTCAGG + Intergenic
987250434 5:16095339-16095361 CTCCTCGCTGAAGCTTAGAGGGG - Intronic
987402418 5:17491789-17491811 CTCCTCTCTGAGGCTGAGCCTGG + Intergenic
987642075 5:20625684-20625706 CACCTCACTAAACCTTAGTTTGG - Intergenic
988929070 5:36017797-36017819 CTCCTCTCTGCACAGCAGTCTGG - Intergenic
997697689 5:135874360-135874382 GCCCTCTCTGAACCTCTGTCAGG - Intronic
998266095 5:140668940-140668962 CTGCTCTCAGAACCTCAGTCTGG + Exonic
1001813457 5:174648157-174648179 CTCCTCTCTGCCACTTAGTATGG - Intergenic
1003533825 6:6958808-6958830 CTCCTCTCTGCACCTTATCCTGG + Intergenic
1003676547 6:8209917-8209939 CATCTCTCTGAACCTCAGTTGGG + Intergenic
1008362581 6:50638942-50638964 ATCCTGTCTGTACCTCAGTCAGG - Intergenic
1009362481 6:62831690-62831712 CTCATCTATGAACCATAGTAGGG + Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1015695409 6:135974913-135974935 CTCCTCTCTGGAGCTTCTTCTGG + Intronic
1017189265 6:151634619-151634641 CTTCTATCTGATGCTTAGTCTGG + Intergenic
1017549166 6:155486369-155486391 GTCCTCTCAGATCCTTATTCTGG + Intergenic
1017873176 6:158503113-158503135 GTCCTCTCTGATGCTGAGTCAGG + Exonic
1018351303 6:162962100-162962122 CTCTTCTCTGAACCCTTTTCTGG + Intronic
1019083427 6:169452487-169452509 CTCCTCTCTGACCCCACGTCCGG - Intergenic
1022418044 7:30195164-30195186 CCCCTCTCTGAGTCTCAGTCTGG + Intergenic
1022478252 7:30726146-30726168 CTCCTCTCTGAGCCTCTTTCAGG + Intronic
1023284264 7:38603011-38603033 CTCATCTCTGGACCTGATTCAGG - Intronic
1023831195 7:44039813-44039835 CTCCTCCCTGATCCCTAGTGGGG - Intergenic
1028337253 7:89673189-89673211 CTCATTTATGAAGCTTAGTCTGG + Intergenic
1028770468 7:94614651-94614673 CTCCTCTATAAACCTTTTTCAGG + Intronic
1029741523 7:102494119-102494141 CTCCTCCCTGATCCCTAGTGGGG - Intronic
1029759515 7:102593288-102593310 CTCCTCCCTGATCCCTAGTGGGG - Intronic
1029776882 7:102689198-102689220 CTCCTCCCTGATCCCTAGTGGGG - Intergenic
1030965755 7:115991123-115991145 CTCCTTTATGAAGCTTAGTTTGG - Intronic
1031613565 7:123855448-123855470 CTTCTCTTTGAAGCTTAGTTGGG + Intronic
1032862902 7:135898479-135898501 CTTCTCTCTGGACCTCAGACTGG - Intergenic
1034990199 7:155543136-155543158 CTCCTTTCTGGACCTCAGTCAGG - Intergenic
1039165555 8:34675649-34675671 CTCTTCTCTGAACCATTATCAGG + Intergenic
1041430303 8:57773946-57773968 CCCTTCCCTGCACCTTAGTCTGG - Intergenic
1041613854 8:59882648-59882670 CTGCTCTCTGAACTTTCCTCTGG - Intergenic
1043649305 8:82568723-82568745 CTTCTCTCTGCACTATAGTCTGG - Intergenic
1044367428 8:91365534-91365556 CTCTTGTCTGAACATTAGTTTGG + Intronic
1044490770 8:92811608-92811630 CTCTTCTCTGAATCTGTGTCTGG - Intergenic
1045324533 8:101108569-101108591 CTCCTCCCTGAAGCTTGATCAGG - Intergenic
1045908442 8:107376438-107376460 CTCCTCCCTGAACACTAATCAGG - Intronic
1047310160 8:123685207-123685229 CTCATCTCTGAACCTTTTCCAGG + Intronic
1048220662 8:132538329-132538351 CTCATCTCTGTAGCTTTGTCTGG + Intergenic
1050404682 9:5294906-5294928 CTCCTTTATGAAGCTTAGTTTGG - Intergenic
1050459443 9:5864768-5864790 CTCCATTCTGAACTTTAGTTAGG + Intergenic
1053735952 9:41102695-41102717 CTCTTCACTGAACCTTCGTAAGG + Intergenic
1054450759 9:65402505-65402527 CTCCTCTCTGTGTCTGAGTCTGG + Intergenic
1054692421 9:68328704-68328726 CTCTTCACTGAACCTTCGTAAGG - Intronic
1055328834 9:75161038-75161060 CTCCTCAGTGTAGCTTAGTCAGG + Intergenic
1059142644 9:111868836-111868858 TTCCACTCTTAACCTTACTCTGG + Intergenic
1059418435 9:114176136-114176158 TTCCTCTCTGAACCTCTCTCTGG + Intronic
1061565700 9:131438328-131438350 CTCTTCTCTGAGCCTCAGTGGGG + Intronic
1189141101 X:38606943-38606965 CTCCTCTCTGAGTCTTGGTGTGG + Intronic
1193761944 X:85477660-85477682 TTCCTCTTGGATCCTTAGTCTGG - Intergenic
1195334423 X:103836143-103836165 CTGCACTCTAAACCTAAGTCTGG - Intergenic
1195702783 X:107717176-107717198 CCCCTCCCTGAACCTTAGGCTGG + Intronic
1197288029 X:124619037-124619059 CTCATCACTGAACTCTAGTCTGG + Intronic
1199082617 X:143593509-143593531 CTCCCCTCTGACCTTTATTCGGG + Intergenic