ID: 953985538

View in Genome Browser
Species Human (GRCh38)
Location 3:47439637-47439659
Sequence GCTGCTGCTGGGACATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953985529_953985538 29 Left 953985529 3:47439585-47439607 CCCACTGCTTACCAGGGCAGGTT 0: 1
1: 0
2: 3
3: 3
4: 113
Right 953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 158
953985531_953985538 18 Left 953985531 3:47439596-47439618 CCAGGGCAGGTTCAGATTAACAG 0: 1
1: 0
2: 1
3: 7
4: 108
Right 953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 158
953985534_953985538 -7 Left 953985534 3:47439621-47439643 CCCTCTGTCTTGCTGGGCTGCTG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 158
953985535_953985538 -8 Left 953985535 3:47439622-47439644 CCTCTGTCTTGCTGGGCTGCTGC 0: 1
1: 0
2: 3
3: 25
4: 334
Right 953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 158
953985530_953985538 28 Left 953985530 3:47439586-47439608 CCACTGCTTACCAGGGCAGGTTC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953985538 Original CRISPR GCTGCTGCTGGGACATATCC TGG Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900986068 1:6073338-6073360 GCTCCTGCTGGGACAGAGCGGGG - Intronic
901279811 1:8025792-8025814 GGTGCTGCGGGGACGTATCCCGG + Intronic
901913487 1:12479676-12479698 GCTGCTTCTGGGCCATCTCTCGG + Intronic
902089687 1:13893246-13893268 GCTGGTGCTGGAACACAGCCGGG + Intergenic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
905959651 1:42033007-42033029 GCTCCTGCTTGGACACCTCCAGG - Intronic
906237881 1:44222753-44222775 GATGCTCCTGGGCCATAACCAGG + Intronic
906416738 1:45625702-45625724 GCTGCTGGTGGGTCATACCTTGG - Intergenic
908211282 1:61902961-61902983 GCTGCTCCTTGAACACATCCAGG - Intronic
912726463 1:112063334-112063356 GCAGATGCTGGGGCAAATCCTGG + Intergenic
914851199 1:151315618-151315640 GTTGCTGCTGAGACTTATGCTGG + Exonic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
1062959429 10:1561650-1561672 GCAGCTGCTGGGCCTGATCCTGG + Intronic
1062990039 10:1806655-1806677 GTTGCTGATGGGATATTTCCAGG + Intergenic
1063094143 10:2894414-2894436 GCTGCTTCTGGGACTTCTCTAGG + Intergenic
1065719473 10:28612460-28612482 GATTCTGCTGGGACAAATACAGG - Intronic
1066617224 10:37307710-37307732 GGTGCTGCAGGGACAGATGCTGG + Intronic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1069621961 10:69842867-69842889 GCTGCTGCTGGGTCACTGCCGGG - Intronic
1074211524 10:111339792-111339814 GCTGCTGCTCTGACGTAGCCAGG + Intergenic
1075511902 10:123079243-123079265 GCTGCCGCTGGGAATTTTCCAGG - Intergenic
1076910964 10:133389346-133389368 GCTGCTGCTGTCACAGCTCCCGG + Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1085238042 11:75030435-75030457 GCCAATGCTGGGACATCTCCAGG - Intergenic
1088416112 11:109590754-109590776 GCTGTTGATGGCTCATATCCAGG + Intergenic
1089219927 11:116862255-116862277 GCTGCTGCTGGGTCTTCTCCAGG + Exonic
1089603279 11:119627707-119627729 GCTGGAGCAGGGACACATCCTGG + Intronic
1089831961 11:121336816-121336838 GATGCAGCTGGGTCATCTCCGGG - Intergenic
1094045187 12:26159209-26159231 GACCCTGCTGGGACATGTCCTGG + Intronic
1094439027 12:30454490-30454512 GCTGGTGCTGGGAGAGATTCTGG - Intergenic
1095891044 12:47235431-47235453 CCTGCCTCTGGGACATCTCCAGG + Exonic
1095952637 12:47790110-47790132 GCTGGTGCTGGGACTTAAGCTGG - Intronic
1096047196 12:48572763-48572785 GATGCTGTGGGGAAATATCCAGG + Intergenic
1098077625 12:66749809-66749831 GCTGCTGCTCTGACATCTCCGGG - Intronic
1101765552 12:107695416-107695438 GCTGCTTCTGGAATAGATCCTGG - Intronic
1105785101 13:23740605-23740627 GCTGCTTCAGGTACAAATCCTGG - Intronic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107387978 13:39933181-39933203 GCTGATACTAGGATATATCCAGG + Intergenic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1119898812 14:78243070-78243092 GTCGCTGCTGGGACAGAGCCCGG - Intronic
1119956511 14:78803953-78803975 GCTGCTGTTGGGTTTTATCCTGG - Intronic
1121301814 14:92877909-92877931 GCTGGTGCTGGTATAAATCCAGG - Intergenic
1125087667 15:35749476-35749498 GCTGTTGCTTGCACATATCTGGG - Intergenic
1125931021 15:43600243-43600265 ACTGCTGCGGGGACAGATCCAGG - Exonic
1125944185 15:43700059-43700081 ACTGCTGCGGGGACAGATCCAGG - Intergenic
1128801817 15:70501859-70501881 GCTTATGCTGGGACATTTCATGG - Intergenic
1132085681 15:98906609-98906631 GCGCCAGCTGGGCCATATCCTGG + Intronic
1132463486 16:66999-67021 GCTGTGGCTGGGCCGTATCCAGG - Intronic
1132504631 16:301394-301416 CCTGTTGCTGGGACAGAGCCAGG + Intronic
1132604258 16:787161-787183 GCAGCTGCGGGGGCACATCCAGG - Exonic
1132769683 16:1554457-1554479 GCTGCTCCTGGGACCTGGCCAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1135424275 16:22324610-22324632 GCTGCCGCTGGACCACATCCGGG - Exonic
1136251666 16:29009468-29009490 GCTGCTGCTGAGAGATAACGCGG + Intergenic
1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG + Intergenic
1140245521 16:73244774-73244796 CCTGCTGCTGGGAGATCTCCTGG - Intergenic
1141526284 16:84614095-84614117 GCTGCTGCTAGGACTTCCCCTGG + Intronic
1141633798 16:85303278-85303300 ACTGGGGCTGGGGCATATCCTGG - Intergenic
1142715684 17:1745689-1745711 GCTCCTGCAGGGACAGATCAGGG - Exonic
1144737445 17:17563090-17563112 CCTGCTGCTGAGACAGATCTTGG - Intronic
1145241633 17:21243727-21243749 GCTGCTGCTGGGACTTAGCTGGG - Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147543682 17:41381961-41381983 CCTGCTGCTGGGACCGCTCCTGG + Exonic
1149712597 17:58756429-58756451 GCTGCTGCAGGCACAGGTCCAGG - Exonic
1151999678 17:77637470-77637492 GCTGTTGCTGGGAAATGTCTGGG + Intergenic
1152004804 17:77673523-77673545 GGTGCTGCTGGGGCAAGTCCTGG - Intergenic
1152514702 17:80816541-80816563 GCTGCCGCTGGAGCAGATCCTGG + Intronic
1153073392 18:1132708-1132730 GCTGCTGCGGGTGCAGATCCTGG - Intergenic
1155854813 18:30819962-30819984 GCTGCAGCAGGGACATGTCCAGG + Intergenic
1156135106 18:34028328-34028350 ACTGCTGATGGCACATTTCCAGG + Intronic
1157632382 18:49111736-49111758 TCTGCTGCTGGGAAAGATCAAGG - Intronic
1159953618 18:74504026-74504048 ACTGCTGCTGGGACAAATGATGG + Intronic
1161066938 19:2243313-2243335 GCTGCTGCTGGGACCTCCCTGGG - Intronic
1162100124 19:8334271-8334293 GCTTCTGCCGGGACATAGACTGG - Intronic
1162895676 19:13763571-13763593 GCTGCATCTGGCACACATCCTGG - Intergenic
1163799545 19:19356325-19356347 GCTGCTGCAGGGACTGATGCTGG - Exonic
1168098236 19:54127591-54127613 GTTGCAGCGGGGACAGATCCTGG - Intronic
1168260150 19:55188835-55188857 GCTGCTGCTTGTTCATTTCCTGG + Intronic
929947184 2:46380424-46380446 GCTGCTGCTGAAACTTGTCCAGG - Exonic
930449023 2:51510872-51510894 TCTCCTGCTGGGATATATTCTGG - Intergenic
934179895 2:89611183-89611205 GCCGCTACTGGGCCATCTCCAGG - Intergenic
934678540 2:96266365-96266387 GGTGCTGCTGGGCCGTGTCCCGG + Exonic
938062184 2:128262635-128262657 GCTGCTGCTGCTACATGTCAGGG + Intronic
943792554 2:191950389-191950411 GTTGCTTCTGGGGCATTTCCTGG + Exonic
943847416 2:192669692-192669714 GCTGCTGCTTGGCCAGCTCCCGG - Intergenic
947653987 2:231810660-231810682 GCTGCTGCTGGGTCCAGTCCTGG + Intergenic
947821957 2:233078418-233078440 CCAGCTGCTGGGGCAAATCCAGG + Intronic
1168948555 20:1781101-1781123 CCTGCTTCTGGGATATAACCTGG + Intergenic
1170899957 20:20452947-20452969 GCTGCTGCTGGTTCAGGTCCTGG + Intronic
1171035208 20:21708291-21708313 GCTGCTGCTGAGTCAAAGCCTGG - Intronic
1171218246 20:23369354-23369376 CCTGCTGCAGGCACATGTCCTGG + Intronic
1171391185 20:24802668-24802690 GATGCCCCTGGGACATGTCCTGG - Intergenic
1172527041 20:35606187-35606209 GCTGCTGCAGGGAGATCACCAGG + Intergenic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1172701701 20:36857222-36857244 TCTGTCTCTGGGACATATCCGGG + Intronic
1174289620 20:49498712-49498734 GCTGTTGCTGAGACAGGTCCTGG - Intergenic
1176261209 20:64181725-64181747 GCTGTTCCTGGGACCTTTCCTGG - Intronic
1177483799 21:21728787-21728809 GCTGCTGCTGCAAAATATCCAGG - Intergenic
1179103412 21:38376766-38376788 CCAGCTGCTGGGCCATAACCTGG - Intergenic
1179415526 21:41195356-41195378 GCTGCAGATGGGAGATGTCCAGG + Intronic
1180207787 21:46272811-46272833 GGTGCTGCTGCGTGATATCCTGG + Exonic
1180610966 22:17097730-17097752 CCTGCTGCTGGGGCATCTCAGGG + Intronic
1181104628 22:20566625-20566647 GCAGCTGCTGGGGCAGAGCCTGG - Exonic
1181405563 22:22682069-22682091 AGTTCTGCTGGGACACATCCTGG + Intergenic
1183243606 22:36676411-36676433 GATGCAGCTGGCACATAGCCCGG + Intronic
1184912483 22:47545561-47545583 GCTGGTACTGGGACATCTCAGGG - Intergenic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954218246 3:49136258-49136280 TCTTCTGCTGGGTCAGATCCAGG - Intergenic
955009746 3:55002480-55002502 GTTGATTCTGTGACATATCCCGG + Intronic
955672565 3:61417356-61417378 GCCTTTGCTGGGACATCTCCGGG + Intergenic
960025877 3:113008784-113008806 GCTGCAGATGGGACCTGTCCTGG - Intronic
961862484 3:129927709-129927731 GCTCCTGCTCGCACATCTCCAGG - Intergenic
962854013 3:139328403-139328425 GCTGCTGGAGGGACCTGTCCAGG + Intronic
967437468 3:189466065-189466087 GCTGATGCTGTGACAGATGCTGG - Intergenic
968941813 4:3642995-3643017 TCTCCTGCTGGGACATGTGCAGG + Intergenic
969213458 4:5705999-5706021 CCTGATGCTGGGACATCTCTTGG - Intronic
969244042 4:5921098-5921120 ACTGCTCCTGGGACATTGCCTGG - Intronic
969859719 4:10026125-10026147 GATGCTGCTGTGTCCTATCCTGG - Intronic
975182170 4:71358666-71358688 GCTGCTGATGGGAAATATTTTGG + Intronic
977167017 4:93711755-93711777 GCTGCTGCTGGGGCATGGGCGGG + Intronic
980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG + Intergenic
985949504 5:3212686-3212708 CGTGCAGCTGGGACACATCCAGG - Intergenic
985975344 5:3415822-3415844 GCTCCTACTTGGACCTATCCAGG + Intergenic
997298603 5:132785654-132785676 GCTGCTGCTGGGAGGAATCCAGG + Intronic
997381014 5:133438389-133438411 TCTGCTGCATGGATATATCCTGG - Intronic
997952288 5:138252160-138252182 GCTGGAGCTGGGACAGATCCCGG + Intergenic
999621695 5:153480650-153480672 GCTGCTGGTGGGACTTCCCCTGG + Intergenic
1002572083 5:180145814-180145836 GCTGCTGCTGGGACCTCTGCAGG + Intronic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1002865297 6:1116390-1116412 GCTGCTGCTTGGACCAATCAGGG + Intergenic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1004508800 6:16267852-16267874 GCTGCTGCGGGCAGATCTCCGGG + Intronic
1005609836 6:27513293-27513315 GCAGATGTTGGGACATTTCCTGG + Intergenic
1005678976 6:28185819-28185841 ACTGCTTCTAGGACATTTCCTGG + Intergenic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006310049 6:33250924-33250946 GCTGCGGCTGGGACAGCACCCGG + Exonic
1011541718 6:88437546-88437568 GCTGCTGCTGTGGCATCTGCTGG - Intergenic
1014067282 6:117142272-117142294 GCTGCTGCTTTGACATCTGCAGG - Intergenic
1015803604 6:137086430-137086452 GCCACTCCTGGGAAATATCCAGG - Intergenic
1016817873 6:148320306-148320328 GCTGCTGCTAGAAAATATCAAGG + Intronic
1017410192 6:154159917-154159939 GCTGCTGCTGATAGATGTCCTGG + Exonic
1017885069 6:158592164-158592186 GCAGCTGCTGGGCCCTATGCTGG - Intronic
1018073611 6:160189649-160189671 GTTGCTGCTGGCACATAGCAAGG - Intronic
1019420029 7:946480-946502 GGTGCTGCTGGGAGGGATCCAGG - Intronic
1019662163 7:2230675-2230697 GGGGCTGCTGGGACAAGTCCTGG + Exonic
1023026645 7:36056678-36056700 GCTGCAGCTGGGACCTATCAGGG + Intergenic
1024063638 7:45716184-45716206 GCTGCTACTGGGACATCCACAGG + Exonic
1025261835 7:57425253-57425275 GCTGCTGCTGGTACCAATCACGG - Intergenic
1025739157 7:64182470-64182492 GCTGCTGCTGGTACCAATCGCGG - Intronic
1027197467 7:76040469-76040491 TGTTCTGCTGGGACCTATCCTGG + Intronic
1028505452 7:91565753-91565775 GCTGCTGCTGAGACATAGACTGG - Intergenic
1035718227 8:1770252-1770274 GCAGCTGCTGGGCCCTCTCCTGG - Intronic
1037581807 8:20249814-20249836 GCTGCTGCAGGGCCTTCTCCAGG + Exonic
1048386909 8:133920550-133920572 TCATCTGCTGGGATATATCCAGG + Intergenic
1049279137 8:141735348-141735370 GCTGCCGCTGGGAAATACCCAGG + Intergenic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1052782397 9:32794881-32794903 GCTGCTGCTTGGGCATAGCTGGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053294582 9:36903546-36903568 GAGGCTGCTGGGGCATGTCCAGG + Intronic
1053913292 9:42926601-42926623 TCTGCTTCTGGGACATCTCAGGG - Intergenic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1061541306 9:131278981-131279003 GGTGCTGCTGTGAGATGTCCTGG - Intergenic
1061837768 9:133340830-133340852 GCTGCTGCTCGGACAACTGCTGG + Exonic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1062068113 9:134539860-134539882 GCTTCTTCTGGGACCTCTCCTGG + Intergenic
1062380369 9:136284098-136284120 CCTCCTGCTGGGACATTTCCTGG - Intronic
1186402195 X:9270283-9270305 GCTTCTGCTTGGACTTTTCCAGG - Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1191714853 X:64187271-64187293 GCTTCTGCAGCCACATATCCTGG + Exonic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1198619197 X:138487998-138488020 GCAGCTGCTGGGCCATGTCCTGG + Intergenic
1198890857 X:141394779-141394801 AATGCAGCTGGGACATATCGAGG - Intergenic
1199164049 X:144648762-144648784 GCTGCTGCTGCCACATATGGGGG + Intergenic
1199404793 X:147444270-147444292 GTTACTGGTGGAACATATCCTGG - Intergenic
1200061532 X:153486001-153486023 GCTGCTCCTGGATCATAACCAGG + Exonic