ID: 953987379

View in Genome Browser
Species Human (GRCh38)
Location 3:47454969-47454991
Sequence ACATAGGTATACAACTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6075
Summary {0: 1, 1: 1, 2: 10, 3: 231, 4: 5832}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953987379 Original CRISPR ACATAGGTATACAACTGGAA AGG Intronic
Too many off-targets to display for this crispr