ID: 953988070

View in Genome Browser
Species Human (GRCh38)
Location 3:47460964-47460986
Sequence ACCTGGGCCCCTTTTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953988066_953988070 -7 Left 953988066 3:47460948-47460970 CCAAGAGATGAGGCTCACCTGGG 0: 1
1: 0
2: 1
3: 29
4: 401
Right 953988070 3:47460964-47460986 ACCTGGGCCCCTTTTCCTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953988070 Original CRISPR ACCTGGGCCCCTTTTCCTTG GGG Intronic
900624200 1:3600738-3600760 GCCTGGGCCCCTGTCCCTTTGGG - Intronic
900975421 1:6013388-6013410 ACCTGGGATGCTGTTCCTTGGGG - Intronic
901292275 1:8133320-8133342 ACCTGGGCCAGTCTGCCTTGAGG + Intergenic
902166208 1:14573682-14573704 ACCTGGACTCATTTTCTTTGGGG - Intergenic
903742740 1:25567682-25567704 CCTTGGGCCCCTTCTCCTGGAGG - Exonic
904450356 1:30607020-30607042 ACAGAGGCCCCTTTTCATTGGGG - Intergenic
904745310 1:32707131-32707153 TCCTGGGCCCCCTTGCCTTCTGG + Intergenic
907377233 1:54053740-54053762 ACCAGGGCTGCTTTTCCTGGTGG + Exonic
907818552 1:57944239-57944261 GCCTGGTACCCTGTTCCTTGAGG + Intronic
908095470 1:60732921-60732943 ACCAGTGCCCCATCTCCTTGTGG + Intergenic
908360964 1:63367910-63367932 TCCTGGCACCCTTGTCCTTGCGG + Intronic
912415715 1:109507298-109507320 ACCTGGGACCAATTCCCTTGAGG + Exonic
915859490 1:159429142-159429164 AGCTGAGCACCTTCTCCTTGAGG - Intergenic
915897607 1:159823891-159823913 ACCCGAAGCCCTTTTCCTTGAGG - Intergenic
916849700 1:168690963-168690985 ACCTGAGCCCCTTTGCCTCTTGG + Intergenic
919847923 1:201653270-201653292 ACTTTGCCCCCTTTTCCTGGAGG - Intronic
919992990 1:202721860-202721882 TCCAGGGCCGCCTTTCCTTGTGG + Intergenic
920263103 1:204703093-204703115 ACCTGTGCCCCTTTCTCTGGAGG + Intergenic
920398707 1:205663917-205663939 ACAGGGGCCCCTCTTCCTGGGGG + Intronic
1063269092 10:4486860-4486882 ACCATGGCCCCTTTTCCATCAGG - Intergenic
1063481508 10:6380596-6380618 ACCTTGGCCCCTTTTAGTTATGG + Intergenic
1065022175 10:21509811-21509833 AGCTGGGCCCCATTTGCCTGGGG + Intergenic
1066080161 10:31922677-31922699 GCCTGGGCCAGTTTTCTTTGTGG - Intronic
1067302953 10:45031236-45031258 ACCTGGGCCCCTTCTCTTGGAGG + Intergenic
1067656390 10:48195108-48195130 TCCTGGGTGTCTTTTCCTTGTGG - Intronic
1069380834 10:67842017-67842039 ACCTGGGCCCCTTTGAGCTGAGG - Intergenic
1073108668 10:101047959-101047981 ACCTGGGCGCCCTTTACCTGAGG - Intergenic
1073677430 10:105663956-105663978 ACCTGAGCATCTTTTCCTTCCGG - Intergenic
1074721797 10:116271320-116271342 GCCTGCGCCACTCTTCCTTGCGG - Intronic
1074858313 10:117489955-117489977 AACTGGGCCACCTTTCCCTGGGG + Intergenic
1075611616 10:123859402-123859424 ACCTCGTCCCCATTTCCCTGTGG + Intronic
1075733493 10:124650264-124650286 ACCTGGGCCTCTTTTACCTTTGG - Intronic
1076722500 10:132398870-132398892 GGCTGGCCCCCTTGTCCTTGTGG + Intronic
1077074471 11:694208-694230 CCCTGCCCCCCTTTTCTTTGTGG - Intronic
1078044884 11:7904579-7904601 ACCTGGGCCACTATTCCTGAAGG - Intergenic
1078388895 11:10917891-10917913 ACCTGGGCCCCTTTGAGCTGAGG + Intergenic
1078665108 11:13318030-13318052 GCCTGGGCCCGTCTTCCTTGTGG + Intronic
1079746832 11:24143012-24143034 AACCTGGCCCCATTTCCTTGGGG - Intergenic
1081070457 11:38603977-38603999 AGCTGGGACCCCTTTCTTTGTGG + Intergenic
1081567588 11:44269649-44269671 CCCAGGGCCCCTTTTCCTCCAGG + Intronic
1082619362 11:55401026-55401048 ACCTTGGCCCCTTTTAGTTATGG + Intergenic
1082920849 11:58492109-58492131 ATCTGGACTCCCTTTCCTTGTGG - Intergenic
1083252512 11:61477621-61477643 ACCTGGGCTCCCGCTCCTTGTGG + Intronic
1084145302 11:67261937-67261959 ACCAGGGCCCTTTTTCCCTCAGG + Intergenic
1084497370 11:69512908-69512930 GCCGGGGCCCCTTTGCCTTCAGG + Intergenic
1084569609 11:69951503-69951525 ACCTGGGCCCCCTATCCTCATGG - Intergenic
1086264465 11:84981318-84981340 ACCTGGCACTCATTTCCTTGAGG + Intronic
1087065323 11:94022499-94022521 GCCAGGGCCCCTTGTCTTTGAGG + Intronic
1087690695 11:101317638-101317660 ACCTGGGCCCCTTTTAGCCGTGG + Intergenic
1087762115 11:102111679-102111701 CCCTGGGCCCCTTTCCTTTGCGG + Intronic
1093207046 12:16263741-16263763 ACCTTGGCCCCTTTTAGTTATGG - Intronic
1095365014 12:41392828-41392850 ATCTGGGCTACTTTGCCTTGTGG - Intronic
1096494755 12:52033537-52033559 ACCTTGGCCACTTTCTCTTGGGG + Intronic
1096495334 12:52036697-52036719 ACCTGGGTTCCTTGCCCTTGGGG + Intronic
1101775348 12:107788490-107788512 CACTGGGCCTCATTTCCTTGTGG + Intergenic
1102102339 12:110290002-110290024 ACCTCTGCCCCATTTTCTTGGGG + Intronic
1102282586 12:111630033-111630055 ACCTGGGCTTGTTTTCCTAGAGG + Intergenic
1102585547 12:113920312-113920334 ACGTGGGCCCCTCTTTCTGGTGG - Intronic
1103224819 12:119277680-119277702 ACCTGAAGCGCTTTTCCTTGGGG + Intergenic
1103965877 12:124639068-124639090 ACCTGGGCCCCCTTACTTGGAGG - Intergenic
1106682008 13:32017891-32017913 GCCTGCTCCCCTTTTCCTTCTGG - Intergenic
1107541484 13:41393335-41393357 ACCCTGACCCCTTTTCCTTTGGG - Intergenic
1110328943 13:74249427-74249449 AGCTGGGCCCCGGTGCCTTGGGG + Intergenic
1112848692 13:103676443-103676465 ACCAGGGCCACTTTTCCTGAAGG + Intergenic
1114270550 14:21098058-21098080 ACCTGGCCCCCCCTCCCTTGGGG + Intronic
1116694046 14:48149941-48149963 ACCTTGGCCCCTTTTAGCTGTGG - Intergenic
1117752254 14:58936193-58936215 ACCTTGGCCCCTTTTAGCTGTGG + Intergenic
1118745205 14:68768359-68768381 ACCTGGGCCACGTTTTCATGTGG - Intergenic
1119380213 14:74223766-74223788 CCCTGAGCCCCTATTACTTGGGG + Intergenic
1119446775 14:74671246-74671268 TCATGGTTCCCTTTTCCTTGGGG + Intronic
1119892443 14:78193020-78193042 ACCTGGACCTCTTTGCCTTCTGG - Intergenic
1119936114 14:78593876-78593898 GCCTGGGCCCCTCTCCATTGGGG - Intronic
1120457762 14:84754418-84754440 ACCTTGGCCCCTTTTAGTTATGG - Intergenic
1122129626 14:99597557-99597579 ACCTGGGCCACTCTTGCTTGTGG + Intronic
1202921456 14_KI270723v1_random:33132-33154 ACCTGAGCACATTTTCCTAGGGG - Intergenic
1202928364 14_KI270725v1_random:15066-15088 GCCTGGATCCCTTTTCTTTGTGG + Intergenic
1123432007 15:20225980-20226002 ACCAGGGCTCCTTTGCCTTCTGG + Intergenic
1125357110 15:38827965-38827987 CCCTGGGCCCCTTTTGGATGTGG - Intergenic
1125407025 15:39363315-39363337 TCCTGGGATCCTATTCCTTGGGG + Intergenic
1125794517 15:42394468-42394490 ACCTGTGCCCCTCTTCTCTGCGG - Intronic
1126900385 15:53308635-53308657 ACCTGCGCCTCCTTGCCTTGTGG - Intergenic
1128763825 15:70238497-70238519 AACTGGGCCCCTCTGCCATGTGG - Intergenic
1133392243 16:5419915-5419937 ACATGGGCTGCTTTTCCTTGTGG - Intergenic
1133738598 16:8634201-8634223 ACCTGGGCCACTGTTCTCTGAGG - Intronic
1134215219 16:12311944-12311966 ACCTGGGCCCCGGTTCCTCATGG - Intronic
1134242882 16:12518670-12518692 AGCTGGGATCCTTTTCCTCGAGG - Intronic
1136852631 16:33625159-33625181 ACCAGGGCTCCTTTGCCTTCTGG - Intergenic
1137543009 16:49377646-49377668 ACCTGGGAGCCTTCTCCTTGGGG + Intronic
1138263468 16:55642979-55643001 GCCATTGCCCCTTTTCCTTGGGG + Intergenic
1138581135 16:57941007-57941029 ACCTGGGCCCCCTTTTCCAGCGG - Intronic
1138584208 16:57960030-57960052 GCTTGGGCCCCATTTCCTGGGGG + Exonic
1139378456 16:66515417-66515439 GCCTGTGCCCCTTTTCCCTTGGG - Intronic
1140665182 16:77221014-77221036 ACCTGGGCTCCTTGACCCTGGGG + Intergenic
1141733674 16:85838804-85838826 GCCTGGGGTCCTTTTCCTGGGGG + Intergenic
1142008924 16:87704052-87704074 AGCTCGGCTCCTTTTCCTTCCGG + Intronic
1142280456 16:89145193-89145215 ACCAGAGCCCCTTTTCCTCAGGG + Intronic
1142280469 16:89145246-89145268 ACCAGAGCCCCTTTTCCTCAGGG + Exonic
1203114235 16_KI270728v1_random:1473627-1473649 ACCAGGGCTCCTTTGCCTTCTGG - Intergenic
1142697995 17:1644038-1644060 CCCAGCGCCCCTTTTCCTTGAGG - Intronic
1143563847 17:7709805-7709827 CCCTGGATCCTTTTTCCTTGGGG + Exonic
1146531412 17:33610487-33610509 ACCTGGGCTCCTTTCCCTAATGG + Intronic
1147142258 17:38466399-38466421 ACCTGGACAACTCTTCCTTGGGG + Exonic
1147314993 17:39615812-39615834 TCCTGGGCCCTCTTTCCTTAGGG + Intergenic
1147834428 17:43319889-43319911 ACCTTGGCCCCTTTTAGCTGTGG + Intergenic
1147931542 17:43984277-43984299 TCCTGGCCTCCTTTTCCTTGTGG + Intronic
1148587640 17:48792086-48792108 CCTTGGGTGCCTTTTCCTTGTGG - Intronic
1148777165 17:50102231-50102253 GCCTGGGCCCCTTGCCCTGGAGG + Intronic
1149442972 17:56690733-56690755 CCCTGGGCCCCTATTCCTTGTGG - Intergenic
1149658138 17:58320794-58320816 TCCTGGTCCCCTTTGCCTTCTGG - Intronic
1150222772 17:63506590-63506612 TCCTCGGCCACTTTTCCCTGGGG - Intronic
1150687366 17:67331560-67331582 ACCTTGGCCCCTTTTCATGATGG - Intergenic
1151415606 17:73960710-73960732 ACCTGGGCCCCTTTGAGCTGAGG - Intergenic
1152336937 17:79703920-79703942 ACCTGCGCCCCTTTTGTGTGTGG - Intergenic
1153440828 18:5117459-5117481 ATATGGGGCCCTTTTACTTGTGG - Intergenic
1160558424 18:79740928-79740950 ACCTGGGCGCCTGTTCTTTTCGG - Intronic
1160866895 19:1260171-1260193 ACCTGTGCCCCTTCCCCTGGGGG - Intronic
1161018137 19:1993510-1993532 TCTTGGGCACCTTTTCCATGAGG + Intronic
1162982192 19:14247547-14247569 CCCTGGCCCCCTCTTCCTAGAGG + Intergenic
1163154140 19:15430997-15431019 ACCTGGGCCACTCACCCTTGAGG + Intronic
1164678578 19:30119276-30119298 ACCTGGACCCCGTTTCTTTCTGG + Intergenic
1164897634 19:31891047-31891069 GCCTGGGCCCCCTGCCCTTGCGG - Intergenic
1166053915 19:40277491-40277513 ACCTGTGTCCCTTCTCTTTGGGG + Intronic
1166072505 19:40395291-40395313 ACCTGGGCCCCTTGAACTTGAGG + Exonic
1166843505 19:45712736-45712758 GCCCGGGCCGCTCTTCCTTGCGG + Exonic
1167393439 19:49211581-49211603 ACCTGGTGGCCTTGTCCTTGAGG + Exonic
1168502425 19:56904633-56904655 ACCTCAGCCTCTTTTCCTTTAGG + Intergenic
1168721976 19:58559156-58559178 ACGTGGGCCGCTTTTGCTCGCGG + Intergenic
925780845 2:7380366-7380388 GCCTCGGCCTATTTTCCTTGGGG - Intergenic
926461088 2:13130499-13130521 ACCTTGGCCCCTTTTACTCATGG - Intergenic
927205754 2:20609325-20609347 ACCAGGACCCCTTTGGCTTGGGG - Intronic
927571335 2:24163379-24163401 ACATGGGCTCATTGTCCTTGAGG + Intronic
927803853 2:26127213-26127235 ACCTGTTCTCCTTTTCCTTTAGG - Exonic
928094283 2:28394225-28394247 TCCTGGGACCCTATTCCTTCAGG + Intronic
929057351 2:37889887-37889909 ACTTTGGCCCATTTTCCTTCTGG + Intergenic
929572718 2:43032802-43032824 CTCTGGGCTTCTTTTCCTTGTGG + Intergenic
930122201 2:47769405-47769427 ACATGGGCCCTGTTTTCTTGGGG + Intronic
930379596 2:50611467-50611489 AGCTGGGTTCCATTTCCTTGGGG + Intronic
935831047 2:107000727-107000749 CCCTGGCCCCCTGCTCCTTGTGG - Intergenic
937142457 2:119613583-119613605 ACCTTGGCCCCTTTTAGTTATGG + Intronic
941847388 2:170147131-170147153 ACCTGGGCCCCGTCTCTGTGTGG + Intergenic
944470337 2:200045980-200046002 ACCTTGGCCCCTTTTAGCTGTGG + Intergenic
946812242 2:223538230-223538252 ACCTTGGCCCCTGTTTCATGGGG + Intergenic
947527329 2:230886639-230886661 TCCTGGGGCCCTGTTCCCTGTGG + Intergenic
1169165076 20:3415866-3415888 ACCTGGGCCCCTTTTAGTTGTGG + Intergenic
1170964185 20:21052008-21052030 ACCTGAGGCCCTTTTCCCAGAGG - Intergenic
1171230382 20:23479556-23479578 ACCTGTGCCCCTTGTCCTGGTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172835479 20:37870411-37870433 ACCTGTGCCCCCAGTCCTTGCGG + Intronic
1173172635 20:40739889-40739911 ACCTGTGACCCTTTGCCTAGAGG - Intergenic
1173454434 20:43191166-43191188 AACTGGGCCACTTTACCTAGTGG - Intergenic
1173993026 20:47317497-47317519 AGCTGCGGCCCTTTCCCTTGAGG - Intronic
1175871597 20:62211883-62211905 GCCTGGGCCCCTATTTCCTGAGG + Intergenic
1176590390 21:8643709-8643731 GCCTGGATCCCTTTTCTTTGTGG + Intergenic
1177586228 21:23100055-23100077 AAGTGGGTACCTTTTCCTTGGGG + Intergenic
1178224510 21:30699819-30699841 ACCTTGGCCCCTTTTAGCTGTGG + Intergenic
1178268939 21:31171861-31171883 AGCTGGGCCTCCTCTCCTTGGGG - Intronic
1180001288 21:44996677-44996699 CCCTGGTCCCCTGTTCCCTGTGG + Intergenic
1180109737 21:45642461-45642483 GCCTGGGCCCCGTTTCCCCGCGG - Intergenic
1180273220 22:10620742-10620764 GCCTGGATCCCTTTTCTTTGTGG + Intergenic
1181470248 22:23134351-23134373 ACCTTGGCCCCTTGTTCTTCTGG + Intronic
1184616314 22:45640711-45640733 AGCTGGGCCCTTTGTCTTTGTGG + Intergenic
949136888 3:577966-577988 GCCTGGATCCCTTTTCTTTGTGG - Intergenic
949635985 3:5981812-5981834 ACCTTGGCCCCTTTTAGTCGTGG + Intergenic
949695435 3:6688862-6688884 ACCTGTGCCCCTTCCCCTTTTGG - Intergenic
950179282 3:10899870-10899892 AGCTGAGCCCATTTTCCATGGGG - Intronic
952596811 3:35028184-35028206 ACCTTGGCCCCTTTAAGTTGTGG + Intergenic
953209088 3:40858488-40858510 AACTGGCTCCCCTTTCCTTGAGG - Intergenic
953988070 3:47460964-47460986 ACCTGGGCCCCTTTTCCTTGGGG + Intronic
958975642 3:100665509-100665531 ACTTGGGCACCTTTTTCTAGTGG + Intronic
959039390 3:101403485-101403507 ACCTGGGCCTGTTATCTTTGGGG + Intronic
961059111 3:123813444-123813466 ACCTGGGCCACTTCTCCATCAGG + Intronic
961532046 3:127545924-127545946 ACCTGGGCCACCTCTGCTTGAGG + Intergenic
961669822 3:128520858-128520880 ACCTGGGTCCATGTTCATTGTGG + Intergenic
963416436 3:145001050-145001072 ACCTGGGACCCTTTTAGCTGTGG + Intergenic
965244427 3:166249105-166249127 ACCTTGGCCCCTTTTAATTATGG - Intergenic
966963380 3:184964848-184964870 ACCTGGGCTGCTTTACCTTTTGG + Intronic
969719409 4:8885096-8885118 CCCTTGGCCCCTTCTCCCTGTGG + Intergenic
970665713 4:18333933-18333955 ACCTGGGCCCCTTTTAACTGAGG + Intergenic
972264028 4:37441402-37441424 CCCTAGGGCCCTTTTCCTTGTGG + Intronic
973015753 4:45135050-45135072 AGCTTGTCCCCTTTTCTTTGTGG + Intergenic
975214535 4:71738267-71738289 ACCTTGGCCCCTTTTAGTTATGG - Intergenic
981107632 4:140899255-140899277 TCCTGGGCCACATTTCCTTATGG - Intronic
981432269 4:144674912-144674934 AACTGGGCCCCTTTGCCTGTAGG + Intronic
982234307 4:153238068-153238090 TCCTGGGCCCTTTTTCTTGGAGG - Intronic
982379112 4:154729495-154729517 CACTGGGCCCCATTACCTTGTGG + Intronic
984820352 4:183876349-183876371 GCCTGGGCTCCTTTCCTTTGGGG + Intronic
986175882 5:5351528-5351550 CCGTTGGCCCCTTTTCCCTGTGG - Intergenic
987709057 5:21486105-21486127 ACCTTGGCCCCTTTTACCTATGG + Intergenic
988750555 5:34188048-34188070 ACCTTGGCCCCTTTTACCTGTGG - Intergenic
988904144 5:35768643-35768665 ACATTGTACCCTTTTCCTTGTGG + Intronic
988925098 5:35981958-35981980 ACCTGGGCCTCTTTTAGCTGTGG - Intronic
991049250 5:62254994-62255016 ACCAGGGCTCCTTTGCCTTCTGG + Intergenic
991585431 5:68196892-68196914 AACTCTGCACCTTTTCCTTGTGG - Intronic
991738821 5:69651246-69651268 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991787959 5:70212937-70212959 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991790396 5:70230987-70231009 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991812187 5:70485601-70485623 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991815145 5:70506078-70506100 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991818281 5:70527363-70527385 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991838604 5:70780247-70780269 ACCTTGGCCCCTTTTACCTATGG + Intergenic
991880405 5:71213301-71213323 ACCTTGGCCCCTTTTACCTATGG - Intergenic
991882844 5:71231327-71231349 ACCTTGGCCCCTTTTACCTATGG - Intergenic
993656994 5:90590272-90590294 AGCTGGGCTCTTCTTCCTTGGGG + Intronic
994421183 5:99527448-99527470 ACCTTGGCCCCTTTTACCTATGG + Intergenic
994485860 5:100386866-100386888 ACCTTGGCCCCTTTTACCTATGG - Intergenic
995117714 5:108500512-108500534 ACCTGGGCCCCTTTGAGCTGAGG - Intergenic
1000334368 5:160231143-160231165 ACCAGGGCCCTTGTGCCTTGGGG + Intronic
1000751395 5:165100010-165100032 ACCTTGGCCCCTTTTACCTATGG + Intergenic
1002310398 5:178310399-178310421 ACTTGGGACCCTTTTCCTCCAGG + Intronic
1002401825 5:178995209-178995231 AGCTTGGCCCCTCTTCCTCGGGG + Intronic
1002709522 5:181186239-181186261 ACCAGAGGCCCCTTTCCTTGAGG - Intergenic
1003395364 6:5748228-5748250 ACCTGGAGCCCCTTTCTTTGTGG + Intronic
1003452000 6:6243515-6243537 ATCTGGGCTCCATTCCCTTGGGG + Intronic
1003979525 6:11376942-11376964 ACCTGGGCCCCTTTGAGCTGAGG - Intronic
1005548627 6:26894353-26894375 ACCTTGGCCCCTTTTACCTATGG - Intergenic
1006249564 6:32770190-32770212 ATCTGGACCTCTTTTCCTGGTGG - Intergenic
1007610601 6:43146476-43146498 GCCTGGGCCCCTTTCCCAGGGGG - Intronic
1009019382 6:57935460-57935482 ACCTTGGCCCCTTTTACCTATGG - Intergenic
1011228292 6:85131856-85131878 AACTGGAGCCCTTTTACTTGAGG + Intergenic
1011262881 6:85486950-85486972 TCCTGGGCCCCTTTCCCATCTGG - Intronic
1011666956 6:89643662-89643684 ATCTGGGCACCTGTGCCTTGAGG - Exonic
1015483503 6:133742144-133742166 ACCTGGCCCGCTGGTCCTTGGGG + Intergenic
1016923267 6:149317224-149317246 GCCTGGGCCCCCCATCCTTGGGG - Intronic
1016996656 6:149965901-149965923 ACCTTGTCCCCTTTTGCCTGAGG + Intronic
1017002144 6:150004346-150004368 ACCTTGTCCCCTTTTGCCTGAGG - Intergenic
1017829015 6:158108035-158108057 ACATAGGTCCCTATTCCTTGAGG + Intergenic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1019521015 7:1460500-1460522 CCCTGGCCCCGTTATCCTTGGGG + Intergenic
1020140660 7:5609743-5609765 AGCTGGGCCCCATTTCCTCCAGG + Intergenic
1021223513 7:18001135-18001157 ACCTGGGCCCAGTCTCCTTGAGG - Intergenic
1022452667 7:30529405-30529427 AACTGAGCCACTTTTCCTGGAGG + Intronic
1022842612 7:34179204-34179226 CACTGGGCTCCTTTTCCTTCTGG + Intergenic
1023273468 7:38492382-38492404 ACTTGGGCCCCTCATACTTGTGG + Intronic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1026817689 7:73524853-73524875 ATCTCGGTTCCTTTTCCTTGAGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1028291859 7:89075385-89075407 ACCTGGGCCCCTTTTAGTCATGG - Intronic
1030072796 7:105712107-105712129 ACCTTGGCCCCTTTTAGCTGTGG + Intronic
1032476001 7:132211864-132211886 CACTGGGCCCCTTTTTCCTGGGG + Intronic
1034195130 7:149240295-149240317 GCCTGGGCTGCTTCTCCTTGGGG + Intronic
1034455051 7:151165566-151165588 CCCTGGGCCCTTTTATCTTGTGG + Intronic
1035774163 8:2174416-2174438 CCCTGGGCCCCTCTTCCAGGAGG - Intergenic
1036125768 8:6060938-6060960 ATTAGGGCCCCTTTCCCTTGGGG - Intergenic
1037919727 8:22797345-22797367 ACCTCGGCCCCTTTTCTTGGTGG - Intronic
1038420478 8:27431062-27431084 TCCTGGCCCCCTTTTCCGAGAGG - Intronic
1038867410 8:31454923-31454945 ACCTTGATCCCTTTTCCTGGGGG - Intergenic
1040012935 8:42677294-42677316 ACCTGGATCCCCTTTCTTTGGGG + Intergenic
1041850580 8:62387245-62387267 ACATGGGCCCTTTTACCATGTGG - Intronic
1042215974 8:66429848-66429870 CCCGGGGCACCTTCTCCTTGGGG - Exonic
1042615292 8:70642450-70642472 ACCTAGTCCCTTTTTCCTTTTGG + Intronic
1042732400 8:71951751-71951773 ATTTGGGCCCATTCTCCTTGAGG - Intronic
1045490276 8:102662980-102663002 GCCTGGGCTCCTCTGCCTTGTGG - Intergenic
1047834305 8:128671429-128671451 ACCTGGCCCTCTTTTCTGTGGGG - Intergenic
1048427142 8:134333194-134333216 GCCTGGGCCCCTTGACTTTGTGG - Intergenic
1049204001 8:141354967-141354989 CGCTGGGCCCCTCTGCCTTGTGG + Intergenic
1051304698 9:15697065-15697087 ATCTGGGCTCCTTTACCTTCTGG + Intronic
1051920678 9:22260201-22260223 ACCTGGGCCCCTTTGAGATGAGG - Intergenic
1053571930 9:39318724-39318746 ACCTTGGCCCCTTTTAACTGTGG - Intergenic
1053882675 9:42611622-42611644 ACCTTGGCCCCTTTTAACTGTGG + Intergenic
1053889994 9:42682680-42682702 ACCTTGGCCCCTTTTAACTGTGG - Intergenic
1054093484 9:60877435-60877457 ACCTTGGCCCCTTTTAACTGTGG - Intergenic
1054114967 9:61153355-61153377 ACCTTGGCCCCTTTTAACTGTGG - Intergenic
1054125215 9:61300287-61300309 ACCTTGGCCCCTTTTAACTGTGG + Intergenic
1054221702 9:62419090-62419112 ACCTTGGCCCCTTTTAACTGTGG + Intergenic
1054229012 9:62490083-62490105 ACCTTGGCCCCTTTTAACTGTGG - Intergenic
1054592789 9:67029179-67029201 ACCTTGGCCCCTTTTAACTGTGG + Intergenic
1055791200 9:79924973-79924995 AACTGGGCAAGTTTTCCTTGTGG + Intergenic
1057566920 9:96173009-96173031 GCCTGGGGCCCTTTGCTTTGTGG - Intergenic
1057809519 9:98246974-98246996 AGCTGGGCCCTGTTTCCATGGGG + Intronic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1059398988 9:114057007-114057029 TCCTGTGCCCCTTTACCTAGTGG + Intergenic
1061562963 9:131418272-131418294 CCCTGGCCCCCTCTTCCTTCTGG + Intronic
1203620399 Un_KI270749v1:122374-122396 GCCTGGATCCCTTTTCTTTGTGG + Intergenic
1187304282 X:18081253-18081275 ACGTGGGTCCCTATTCATTGGGG + Intergenic
1187561949 X:20411664-20411686 ACCTGGGCATATTTTCCTGGTGG + Intergenic
1187667413 X:21628645-21628667 ACCTTGGCCCCTTTTAGTTATGG + Intronic
1188962387 X:36508141-36508163 ACCTGGGCCCCTTTTAGTCATGG + Intergenic
1189257523 X:39652067-39652089 GCAAGGGCCCCTCTTCCTTGTGG + Intergenic
1191673352 X:63769693-63769715 ACCTTGGCCCCTTTTATTTATGG - Intronic
1191711066 X:64150437-64150459 ACCTTGGCCCCTTTTAGCTGTGG + Intergenic
1193813753 X:86082086-86082108 ACCTTGGCCCCTTTTCGTCATGG + Intergenic
1194288290 X:92038214-92038236 CCCTGGACCCCTTTGTCTTGGGG - Intronic
1194321104 X:92447427-92447449 ACCTTGGCCCCATTTATTTGTGG - Intronic
1195682753 X:107561083-107561105 ATCTTGGCCCCTTTGCTTTGAGG - Intronic
1196482705 X:116168421-116168443 ACAAGGTCCCCTGTTCCTTGTGG + Intergenic
1196767180 X:119257277-119257299 ACGAGGGCTCTTTTTCCTTGGGG + Intergenic
1196783988 X:119406483-119406505 ACCTGGGCCACATTTCCCAGTGG + Exonic
1197074769 X:122341180-122341202 ACCTTGGCCCCTTTTAGTTATGG + Intergenic
1199980270 X:152916908-152916930 ACCTGGGGCACTTTTCCTGGGGG + Intronic
1200605813 Y:5262779-5262801 CCCTGGACCCCTTTGTCTTGGGG - Intronic
1200629222 Y:5560574-5560596 ACCTTGGCCCCATTTACTTGTGG - Intronic