ID: 953990142

View in Genome Browser
Species Human (GRCh38)
Location 3:47477141-47477163
Sequence CATTGTGACAATAGTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953990142_953990153 25 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990153 3:47477189-47477211 TTGGCCCAAAGTGACTTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
953990142_953990145 -10 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990145 3:47477154-47477176 TGTCACAATGAAAGTAACAATGG 0: 1
1: 0
2: 1
3: 32
4: 332
953990142_953990147 -8 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990147 3:47477156-47477178 TCACAATGAAAGTAACAATGGGG 0: 1
1: 0
2: 0
3: 17
4: 272
953990142_953990152 24 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990152 3:47477188-47477210 CTTGGCCCAAAGTGACTTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 131
953990142_953990150 6 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990150 3:47477170-47477192 ACAATGGGGACAGTGGGCCTTGG 0: 1
1: 0
2: 3
3: 38
4: 272
953990142_953990149 0 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990149 3:47477164-47477186 AAAGTAACAATGGGGACAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 278
953990142_953990148 -1 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990148 3:47477163-47477185 GAAAGTAACAATGGGGACAGTGG 0: 1
1: 0
2: 4
3: 31
4: 334
953990142_953990146 -9 Left 953990142 3:47477141-47477163 CCCACCACACTATTGTCACAATG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 953990146 3:47477155-47477177 GTCACAATGAAAGTAACAATGGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953990142 Original CRISPR CATTGTGACAATAGTGTGGT GGG (reversed) Intergenic
910233973 1:85015678-85015700 TAATTTGAAAATAGTGTGGTGGG + Intronic
913564687 1:120061540-120061562 CATGATGATAATATTGTGGTTGG - Intronic
913633444 1:120732023-120732045 CATGATGATAATATTGTGGTTGG + Intergenic
914285276 1:146220890-146220912 CATGATGATAATATTGTGGTTGG - Intronic
914546307 1:148671645-148671667 CATGATGATAATATTGTGGTTGG - Intronic
914620258 1:149399025-149399047 CATGATGATAATATTGTGGTTGG + Intergenic
915852096 1:159335292-159335314 AATTATTACAATAGTATGGTAGG + Intergenic
916956356 1:169840260-169840282 AATGGTGTCAATAGTTTGGTAGG + Intronic
917055067 1:170972052-170972074 AATTTTGGTAATAGTGTGGTTGG + Intronic
918378600 1:183933166-183933188 AATGGGGAAAATAGTGTGGTAGG - Intronic
918639410 1:186820891-186820913 CATTGTTATATTAGGGTGGTGGG + Intergenic
920410221 1:205753391-205753413 CATTCTGACAATAGTGGGGATGG - Intergenic
923885659 1:238152375-238152397 CAGTGTGAGGATACTGTGGTGGG + Intergenic
924646930 1:245886814-245886836 CATTGTTAGAACAGTGAGGTTGG - Intronic
1063555137 10:7071671-7071693 CATTTTGAGAATAGGGTGGTTGG - Intergenic
1063775480 10:9258924-9258946 CATAGTGACAATATTGTGCTTGG - Intergenic
1066465599 10:35647370-35647392 CAATGTGACAATTCAGTGGTGGG - Intergenic
1068274176 10:54771077-54771099 GAGTGTGTCAATAGTGTGGTAGG - Intronic
1068912239 10:62390643-62390665 CATTCTGAGAAATGTGTGGTTGG + Intronic
1076228224 10:128798029-128798051 AATTGTGACAATAGTGTCACTGG - Intergenic
1077917041 11:6618198-6618220 CAGTGTGACACTAGTGTGCATGG - Intronic
1078074518 11:8146106-8146128 TGCTGTGACAATAGTGTAGTAGG + Intronic
1079444094 11:20544186-20544208 CATTTTTATAATAGAGTGGTAGG - Intergenic
1081103043 11:39028925-39028947 CATTGTATCATTTGTGTGGTAGG + Intergenic
1083699118 11:64462942-64462964 CAGTGTAATAATAGTGAGGTAGG - Intergenic
1087137669 11:94737158-94737180 CATTGTGAGAACAGTTTGGCAGG + Intronic
1089861061 11:121590326-121590348 CATTTTGAAATAAGTGTGGTTGG + Intronic
1097904865 12:64909308-64909330 CATGATTACAGTAGTGTGGTGGG + Intergenic
1099538862 12:83879900-83879922 CATTGTGATAACAGTGAGATTGG + Intergenic
1101663833 12:106791376-106791398 TACTGTTACAATAGTGTGATTGG + Intronic
1105373518 13:19821625-19821647 CATTGTAAAATTAATGTGGTCGG - Intergenic
1107327822 13:39263980-39264002 CAGTATTAAAATAGTGTGGTGGG - Intergenic
1110200079 13:72839760-72839782 CATTGTAACATAAATGTGGTTGG + Intronic
1111950445 13:94705296-94705318 AATTGTGACAAAAGTGGGGGGGG - Intergenic
1116213647 14:41981315-41981337 CATTGTGAAAATAATGTAGCTGG - Intergenic
1116862529 14:50006160-50006182 CAGTGTTACAAGAGTGGGGTTGG + Exonic
1117551196 14:56838276-56838298 CATAGTTACCATTGTGTGGTGGG - Intergenic
1120281982 14:82450812-82450834 CATTGGAGCAATAATGTGGTGGG - Intergenic
1124499490 15:30214341-30214363 CATCGTGGAAATACTGTGGTTGG + Intergenic
1124744089 15:32324321-32324343 CATCGTGGAAATACTGTGGTTGG - Intergenic
1126421466 15:48477843-48477865 CTTTGTGACAAAGGTTTGGTGGG - Intronic
1140744326 16:77967950-77967972 AATTGTGACACAATTGTGGTTGG - Intronic
1143412395 17:6718174-6718196 CAATCTGACAATAGTGTAGCCGG - Intergenic
1146582293 17:34049476-34049498 CAATGTGAGAGCAGTGTGGTGGG - Intronic
1147040373 17:37713726-37713748 CATTGTCACAGCAGTGTGATGGG + Intronic
1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG + Intergenic
1160807119 19:996827-996849 CACTGTGAAAATAGTCTGGCAGG + Intronic
1167961881 19:53112568-53112590 CATAGTGAGAGTAGTGTGGAGGG + Intronic
929691919 2:44082082-44082104 CTTTTTGGCAATAGTGTGGAGGG - Intergenic
933713521 2:85344351-85344373 GCATGTGACAAGAGTGTGGTGGG + Intronic
935232213 2:101108856-101108878 TATTGTTACATTATTGTGGTAGG - Intronic
935304807 2:101727110-101727132 CAATGTGGCAATATTGAGGTGGG - Intronic
936168098 2:110141669-110141691 CATTTTGAAAACAGTTTGGTAGG + Intronic
936684263 2:114809564-114809586 CTTTGTGACAATCGTGTGAAAGG + Intronic
938985899 2:136575954-136575976 CATTGTGGCAGTATTGAGGTGGG - Intergenic
943770638 2:191712777-191712799 CATTGTGACTATATTTTGTTGGG - Intergenic
944596480 2:201265924-201265946 GGTTGTGACCAGAGTGTGGTAGG - Intronic
1172647385 20:36479461-36479483 GTTTGTAAAAATAGTGTGGTGGG + Intronic
1173907530 20:46639763-46639785 CATTGACAAAATAGTGGGGTTGG - Intronic
1175072907 20:56349696-56349718 CATTCTGAGAAGAGTGTGGAAGG - Intergenic
1177726251 21:24971896-24971918 CCTTGAGACAATAGTGGGTTTGG - Intergenic
1178846413 21:36177546-36177568 CAATTTGACAATATTGGGGTTGG + Intronic
1179637989 21:42725902-42725924 CATTCTGAAAACAGTCTGGTAGG - Intronic
952469035 3:33625079-33625101 CATTGTTACAAAAGTGTGTAAGG + Intronic
953990142 3:47477141-47477163 CATTGTGACAATAGTGTGGTGGG - Intergenic
959958035 3:112261829-112261851 CTTTGTGAAAGTAGTGTGCTAGG + Intronic
962243177 3:133768453-133768475 TATTGTGACAATGTTGGGGTGGG + Intronic
962280227 3:134046461-134046483 CATTGTGGCACTGGAGTGGTTGG - Intronic
964254085 3:154755049-154755071 CATTGTGTGAAGAATGTGGTAGG - Intergenic
966761279 3:183421123-183421145 CATTTTTACAATAATGTGTTTGG + Intronic
971518307 4:27516454-27516476 CATTGGGAAAAGAGTTTGGTTGG + Intergenic
971816733 4:31500544-31500566 CAAAGTGACAATAATATGGTTGG + Intergenic
972919596 4:43921662-43921684 CACTGTGGAAATAGTGTGGGTGG + Intergenic
975013916 4:69387313-69387335 CATTGTGTCAACAGTGAGGCAGG - Intronic
978919826 4:114169973-114169995 CATTGTATGAATAGTGTGGCAGG - Intergenic
979536044 4:121822290-121822312 CATTTTGACTATAGTGAGTTAGG - Intronic
979944626 4:126813435-126813457 AATTGTGACATTAGTGTGTCCGG - Intergenic
982875649 4:160646257-160646279 CATTGAGAGAAAAGTGTGGGAGG - Intergenic
983068848 4:163245314-163245336 CATTGTGACAATAGTCTATTTGG - Intergenic
984331845 4:178331124-178331146 TTTTGTGACAATTGTGTGGTTGG - Intergenic
987232129 5:15905874-15905896 CATTGTGACATGGGTGGGGTTGG - Intronic
989448457 5:41558950-41558972 CATTCTGACCATATGGTGGTGGG - Intergenic
993579138 5:89637598-89637620 CATTTTTTAAATAGTGTGGTAGG + Intergenic
994260921 5:97657618-97657640 CAGTGGGCAAATAGTGTGGTTGG + Intergenic
994357718 5:98812729-98812751 CATAGTGAACATAGTGTTGTTGG - Intergenic
996888055 5:128382805-128382827 AATTATGACAATAGTGATGTAGG - Intronic
1001707988 5:173755803-173755825 CACTGTGAAAATAGTGAGTTTGG + Intergenic
1005263890 6:24091076-24091098 CATTGTCACAATGGTCTGGGAGG + Intergenic
1007250700 6:40492897-40492919 CATTCTAGCAGTAGTGTGGTTGG + Intronic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1012900551 6:105000344-105000366 AATGGTCACAGTAGTGTGGTGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017353681 6:153476399-153476421 CATTCTGAGAAATGTGTGGTCGG + Intergenic
1020822743 7:12990447-12990469 CATTTTGACAATAATGTGTCCGG - Intergenic
1023073136 7:36457633-36457655 AACTGGGACAATAGTTTGGTGGG + Intergenic
1027633878 7:80644885-80644907 CATTTTGTCAATAATGGGGTTGG - Intronic
1032503420 7:132417287-132417309 CATGGTGACAATAATGTGGCGGG - Intronic
1034309148 7:150071677-150071699 CAGTGTGAGGATGGTGTGGTCGG + Intergenic
1034797707 7:154028959-154028981 CAGTGTGAGGATGGTGTGGTCGG - Intronic
1039513376 8:38109787-38109809 TATGGTGTCAATAATGTGGTTGG - Intronic
1045553988 8:103197377-103197399 CATTGTCACAACAATGTTGTAGG - Intronic
1046084464 8:109415304-109415326 CATTTTGAAAATAGTGTTGGGGG - Intronic
1047215694 8:122874264-122874286 GATTGTAACAATGCTGTGGTAGG - Intronic
1048759377 8:137775722-137775744 CATAAAGACTATAGTGTGGTAGG - Intergenic
1050803917 9:9650178-9650200 CATGGTGACAGGAGAGTGGTTGG - Intronic
1055664270 9:78537985-78538007 CATTGTCACCATTGTTTGGTTGG + Intergenic
1056725793 9:89114998-89115020 CCCTGTGACAGTAGTGTTGTTGG - Intronic
1057310039 9:93936977-93936999 CAATGTGTCAATGATGTGGTTGG + Intergenic
1058203220 9:102069436-102069458 CATTTTTAGAATATTGTGGTAGG + Intergenic
1060022866 9:120147228-120147250 CATTGGGAAATTAGTGTGGCTGG - Intergenic
1185745356 X:2568392-2568414 CATGGTGAGACTAGGGTGGTTGG - Intergenic
1187081826 X:15998121-15998143 CATGGTGACAATACTGTGCCTGG - Intergenic
1187397715 X:18932645-18932667 CAATAGGACAATAGTGTGGAAGG + Intronic
1191899837 X:66029324-66029346 AATTCTGACAACAGTGTGGTAGG + Intronic
1199845102 X:151687094-151687116 CCCTGGGACAAAAGTGTGGTTGG - Intergenic
1202130840 Y:21607448-21607470 CATTGGAACACTAGTTTGGTTGG - Intergenic