ID: 953992668

View in Genome Browser
Species Human (GRCh38)
Location 3:47496236-47496258
Sequence GTTCCCAGTGGAGCAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953992668_953992677 11 Left 953992668 3:47496236-47496258 CCAGGACCTGCTCCACTGGGAAC 0: 1
1: 0
2: 1
3: 22
4: 298
Right 953992677 3:47496270-47496292 TTCTCTGTGCCCTTCAGCTGAGG 0: 1
1: 1
2: 2
3: 46
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953992668 Original CRISPR GTTCCCAGTGGAGCAGGTCC TGG (reversed) Intronic
900003084 1:25778-25800 GTGCCTAGGGGAGCAGGTCTAGG - Intergenic
900022806 1:196303-196325 GTGCCTAGGGGAGCAGGTCTAGG - Intergenic
900129619 1:1081866-1081888 GTTCCCGCTGGCCCAGGTCCCGG + Exonic
900156065 1:1203734-1203756 GCTGCCAGGGGAGCAGGGCCCGG + Exonic
900174307 1:1285078-1285100 GTGCCCAGTGGTGGAGCTCCTGG + Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900473144 1:2864247-2864269 CTTCCCAGTGCACCAGGTCAAGG + Intergenic
902032807 1:13435083-13435105 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
903942677 1:26942488-26942510 GTTCCCAGTGGACCAAGGCTTGG + Intronic
904820988 1:33244184-33244206 ATTCCCAGAGGGGCAGGGCCAGG + Intergenic
905261310 1:36721303-36721325 GTCCCCTGTGGGGCAGGTCTGGG - Intergenic
906344406 1:45006183-45006205 GTTCCCAGTGGAAAATGTTCAGG - Intronic
906460964 1:46034956-46034978 GTTCAGAGTGGGGCAGGTCAAGG - Exonic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
908542899 1:65138335-65138357 GTTACCAGTGGAGGTTGTCCAGG + Intergenic
909013946 1:70363604-70363626 GTTAACAGTGGAGGGGGTCCAGG - Intronic
909498131 1:76302772-76302794 GTTACCAGTGGAGGGTGTCCAGG + Intronic
910428942 1:87142176-87142198 GATCCCGGTGGACCATGTCCTGG + Intronic
910614263 1:89179852-89179874 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
911953353 1:104205086-104205108 GTTCCCCATGGAGCAGTTCTAGG + Intergenic
914678727 1:149923876-149923898 ATGCCCATTGGAGGAGGTCCAGG + Exonic
914937497 1:151993684-151993706 TTTCCCCGGGCAGCAGGTCCGGG + Intronic
916488936 1:165284558-165284580 GTTCCCAGCGGAGGGGGTCTGGG - Intronic
917590383 1:176470167-176470189 GTTCACAGTGGTGAAGGTCCAGG + Intronic
920451264 1:206062771-206062793 GTTCCCACGGGAGCTGTTCCTGG - Intronic
922731165 1:227949377-227949399 TTTCCCAGGGAAGCAGGGCCGGG - Intergenic
923017686 1:230139584-230139606 GTTGTCAGTGGAACAGGTGCTGG - Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924251071 1:242133514-242133536 GTTACCAGTGGAGGGTGTCCAGG - Intronic
1063109302 10:3020729-3020751 GTTCCCAGAGGAGCAGCTGCAGG - Intergenic
1063323063 10:5070278-5070300 GTTACCAGTGGAGGGTGTCCAGG + Intronic
1065089245 10:22213593-22213615 CTCCCCACTGGAGCAGATCCAGG - Intergenic
1065701426 10:28429630-28429652 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1065756837 10:28938389-28938411 GTTACCGGTGGAGGATGTCCAGG - Intergenic
1065819301 10:29510608-29510630 GTACCCAGGAGAGCAGGTGCCGG - Intronic
1065953547 10:30673806-30673828 GTACCCAGGAGAGCAGGTGCCGG + Intergenic
1067081125 10:43212739-43212761 GTACCCACTGGAAAAGGTCCTGG - Intronic
1067146176 10:43695455-43695477 GCTCCCAGGGGTGCAGGTCCGGG + Intergenic
1069604690 10:69731899-69731921 GCCCCCAGAGGAGCAGGCCCTGG + Intergenic
1071011667 10:80947592-80947614 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1072898623 10:99388286-99388308 GTTCCCACGAGAGCAGGTCAGGG + Exonic
1076836386 10:133023211-133023233 GTGCCCTGTGGGGCTGGTCCAGG + Intergenic
1077410955 11:2403672-2403694 CTTCCCAGTGGGGCTGGTCAGGG + Exonic
1078499645 11:11858224-11858246 GTTACCGGTGGAGCATGTCCAGG - Intronic
1079094602 11:17502351-17502373 GTCTCCACTGGAGCAGGCCCAGG + Intronic
1079602369 11:22325427-22325449 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1082004920 11:47414158-47414180 GTGCCCAGGGGAGCAGGCCCAGG - Intronic
1083309705 11:61777946-61777968 ATTCCCAGGGGCGCAGTTCCGGG - Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084711741 11:70847878-70847900 GTTCCCAGTGGAGGACCACCAGG + Intronic
1085165798 11:74398356-74398378 CTCCCCAGCGGACCAGGTCCGGG + Exonic
1085171392 11:74452677-74452699 GTTCCCCGTGGATCAGGCCAAGG + Intergenic
1085333817 11:75674481-75674503 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1085530552 11:77189750-77189772 GGTCAGAGTGGAGCAGGTCATGG + Intronic
1088714782 11:112539443-112539465 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1089775845 11:120835192-120835214 GCTCCCTGAGGAGCAGGTCGGGG - Intronic
1091140318 11:133228832-133228854 GGGCCAAGAGGAGCAGGTCCAGG + Intronic
1091376504 12:27841-27863 GTGCCTAGGGGAGCAGGTCTAGG - Intergenic
1096131344 12:49161268-49161290 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1099964206 12:89428099-89428121 GTTCCCAGTGAATGAGGTCTAGG - Intronic
1101884226 12:108648010-108648032 GTTGCCGGGAGAGCAGGTCCTGG - Intronic
1102483751 12:113242312-113242334 GTCCCCAGTGGCTCAAGTCCAGG + Intronic
1103717102 12:122951156-122951178 ATTCCCTTTGGAGCAGGCCCTGG + Intronic
1104634717 12:130430543-130430565 GTTACATGTGGAGCAGGTTCTGG + Intronic
1105242272 13:18619338-18619360 CTTCCCAGGGCATCAGGTCCCGG - Intergenic
1110573997 13:77035704-77035726 GTTACCAGTGGAGAGTGTCCAGG + Intergenic
1111742395 13:92220029-92220051 GTTACCAGTGGAGGCTGTCCAGG - Intronic
1112114519 13:96337568-96337590 GTTCCAAGTAGAGAAGGTGCAGG - Intronic
1112967840 13:105220126-105220148 GTTCAAAGTGGATCAGGACCAGG + Intergenic
1114212413 14:20626469-20626491 CTTCCCAGTGAATCAGGTCACGG + Intergenic
1116145930 14:41069161-41069183 GTTCCCAGCGTAGCAGCTCAGGG + Intergenic
1117176659 14:53152912-53152934 GTTCCCCGCGCAGCAGGGCCAGG + Exonic
1118535373 14:66757991-66758013 ATTCCCCGTGTAGCTGGTCCTGG + Intronic
1118571589 14:67200089-67200111 ATGCCCATTGGAGGAGGTCCAGG - Intronic
1119400146 14:74357593-74357615 GTTCACGGTTGAGCAGCTCCAGG - Exonic
1121967843 14:98326861-98326883 GTTCCCAGTGGTGCTGAGCCTGG - Intergenic
1122079730 14:99258273-99258295 GTTCCCAGTGTAACTGGTCAGGG - Intronic
1122319410 14:100844901-100844923 GTTCACAGTGCAGTAGGCCCCGG - Intergenic
1122718385 14:103708447-103708469 GGTCCCAGTGGTGCAGGGCAGGG - Intronic
1122977234 14:105175854-105175876 TCTCCCAGTGGAGCGGGCCCTGG + Intronic
1123401998 15:19996367-19996389 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123511338 15:21003031-21003053 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123578172 15:21693802-21693824 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123614797 15:22136284-22136306 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1129413867 15:75364077-75364099 CTTCCCAGTGGCCCAGGCCCTGG - Exonic
1129506562 15:76086430-76086452 GTTACCAGTGGAGTATGTTCAGG + Intronic
1129997987 15:80023265-80023287 CTTACCAGAGAAGCAGGTCCTGG - Intergenic
1132450418 15:101965160-101965182 GTGCCTAGGGGAGCAGGTCTAGG + Intergenic
1202987042 15_KI270727v1_random:428047-428069 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1132645906 16:999171-999193 GCTCCCGGTGGAGCAGCTTCTGG + Intergenic
1132985110 16:2762057-2762079 CTCCCCAGTGGCGTAGGTCCAGG + Exonic
1133916214 16:10112154-10112176 CTACCCAGGTGAGCAGGTCCAGG - Intronic
1134457560 16:14405916-14405938 GTCCCCAGCACAGCAGGTCCGGG + Intergenic
1134750552 16:16621572-16621594 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1134854774 16:17509202-17509224 GTTACCAGTGGAGAGTGTCCAGG - Intergenic
1134994902 16:18732014-18732036 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1135626335 16:23998202-23998224 GGTGCCAATGGAGTAGGTCCTGG - Intronic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1139209370 16:65061823-65061845 ATTTCCAATGGACCAGGTCCTGG + Intronic
1141196622 16:81865787-81865809 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196693 16:81866072-81866094 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196836 16:81866698-81866720 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141442160 16:84036618-84036640 GTTTCCAGTTGAGCAGGACGTGG - Intronic
1141763730 16:86045362-86045384 GTTCCCATTGGAGCAGGGCCAGG + Intergenic
1142639796 17:1279370-1279392 CTGCCCAGAGGAGCAGGCCCTGG + Intergenic
1143851194 17:9813314-9813336 CATCCCAGTGGAGAAGCTCCAGG - Intronic
1145225553 17:21125169-21125191 GTTACCAGTGGAGAGTGTCCAGG + Intronic
1146668769 17:34722557-34722579 GGCCGCAGTGGAGCAGCTCCTGG + Intergenic
1146745191 17:35322410-35322432 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147132130 17:38415729-38415751 GTTCTCAGAGCAGCAGGTGCAGG + Intergenic
1148083640 17:44980994-44981016 CTTCCCTGTCTAGCAGGTCCTGG - Intergenic
1148240448 17:45996615-45996637 GTTCTCAGTGGAGCCGATCTTGG - Exonic
1150605332 17:66685949-66685971 GTTGCCAGTGCCGCCGGTCCAGG + Intronic
1151422455 17:74007401-74007423 GGTCACAGTGGAGCTGCTCCTGG + Intergenic
1152088863 17:78236203-78236225 TGACCCAGTAGAGCAGGTCCTGG - Intronic
1152700045 17:81814178-81814200 GTGCCCATCTGAGCAGGTCCTGG + Intergenic
1152855239 17:82661953-82661975 GTTCCCAGAGGAGGCGGCCCTGG + Intronic
1153018177 18:603152-603174 GATGCCAGTGTAGCTGGTCCTGG - Intronic
1153968281 18:10201628-10201650 GTTCCCCTTGGTGCAGGCCCTGG - Intergenic
1154138487 18:11801833-11801855 GCTGCAGGTGGAGCAGGTCCCGG + Intronic
1154446677 18:14440540-14440562 CTTCCCAGGGCATCAGGTCCCGG + Intergenic
1155328040 18:24685728-24685750 GTTCCAAGTGGGGCAGGGCAAGG + Intergenic
1155495292 18:26436552-26436574 GTTCCCTGTGGGGCAGGGCCAGG - Intergenic
1157887586 18:51383725-51383747 GTTCCCAGTGAATAAGGTACAGG - Intergenic
1158548128 18:58413153-58413175 CTTCCCAGAGGTTCAGGTCCAGG + Intergenic
1158847633 18:61461588-61461610 GTTACCAGTGGAGGGTGTCCAGG + Intronic
1159604055 18:70456849-70456871 GTTATCAGTGGAGGATGTCCAGG - Intergenic
1160634835 19:67386-67408 GTGCCTAGGGGAGCAGGTCTAGG - Intergenic
1160707457 19:536174-536196 GCTCCCAGTGCCCCAGGTCCCGG - Intronic
1161190149 19:2950181-2950203 GTTCCCAAGGAAACAGGTCCCGG + Intergenic
1162095059 19:8305316-8305338 GTTCAGAGTGTAGCAGTTCCTGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163667719 19:18610955-18610977 GTTCCCGGGGGAGCCGGTCCAGG - Intronic
1164119960 19:22257191-22257213 CTTCCCAGTGGACTAGGCCCAGG + Intergenic
1164983091 19:32628647-32628669 GCGCACAGTGGAGAAGGTCCAGG + Intronic
1165443566 19:35844427-35844449 GTTCCTGGGGGAGCAGGTGCTGG - Exonic
1166343123 19:42150456-42150478 GTTCGGAGGGGAGCAGGACCAGG + Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167557509 19:50205394-50205416 GTTCCCAGCCGGGCAGGTGCTGG + Intronic
1167593168 19:50415180-50415202 GTTCCCAGAGGAGGAGGGGCTGG - Intronic
1167987053 19:53327501-53327523 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1168636275 19:57999767-57999789 GTTCCCAGAGGATGATGTCCAGG - Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925813037 2:7719897-7719919 GTTACCAGTGGAGAATGTCCAGG - Intergenic
925863577 2:8203475-8203497 GTTTCCTGGGGAGCAGATCCTGG - Intergenic
926125246 2:10267876-10267898 GTTCCCTGAGGAGCAGGTGGAGG - Intergenic
926211682 2:10875569-10875591 TTTCACTGGGGAGCAGGTCCAGG + Intergenic
926865611 2:17354495-17354517 GTTTCCAATGGAGTAGGTCTGGG + Intergenic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
929111305 2:38407386-38407408 CTTCCAACTGGAGCAGTTCCTGG - Intergenic
930653031 2:53981209-53981231 GTTACCAGTGGAGGGTGTCCAGG + Intronic
930753944 2:54957587-54957609 GTTTCCAGAGCAGCAGGTGCTGG - Intronic
934141262 2:89050166-89050188 GATCCCGGGGGAGGAGGTCCTGG - Intergenic
934227978 2:90150378-90150400 GATCCCAGGGGAGGAGGTCCTGG + Intergenic
934523864 2:95036444-95036466 GTCCCCACTGGAGCAGTTCTGGG - Intronic
936566642 2:113587641-113587663 GTGCCTAGGGGAGCAGGTCTAGG + Intergenic
937116253 2:119407027-119407049 TTGTCCAGTGGTGCAGGTCCTGG - Intergenic
939964862 2:148600198-148600220 GGTCCAAGTAGAGCAGCTCCAGG + Intergenic
940009399 2:149038585-149038607 TTTCCCAGCGGAGCCGGGCCCGG + Exonic
940504481 2:154535423-154535445 GATACCAGTGGAGCGTGTCCGGG - Intergenic
941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG + Intergenic
943741137 2:191410399-191410421 GTGGCCAGAGGAGCAGGGCCAGG - Intronic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
945972425 2:216243675-216243697 GTTTGCAGAGGAGCAGTTCCAGG - Intergenic
946108476 2:217392929-217392951 TTTACCAGTGGAACAGCTCCAGG + Intronic
947406403 2:229781856-229781878 TTCCCCAGTGAAGCAGCTCCTGG + Intronic
947539986 2:230969758-230969780 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
948154853 2:235773002-235773024 GTTCCTGGTGGAGGGGGTCCAGG + Intronic
948717181 2:239872342-239872364 CTCCCCAGTGGAGGAGGTTCTGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948831763 2:240601787-240601809 CAGCCCAGTGCAGCAGGTCCTGG - Intronic
948844704 2:240677494-240677516 GTTCCCAGGAGGGCAGGCCCAGG + Intronic
948849156 2:240697385-240697407 GTTCCCAGGAGGGCAGGCCCAGG - Intronic
1169339795 20:4787653-4787675 GTTCCTAATGGAGAAGGACCAGG - Exonic
1172891911 20:38271554-38271576 CTTCCCAGGGGAGGTGGTCCTGG - Intronic
1173147290 20:40535663-40535685 ATTCCCACTGGGGCAGGTGCAGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173336127 20:42113622-42113644 GTTCCCTGTGGATCAGCTCTAGG + Intronic
1174532579 20:51225693-51225715 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1175292921 20:57890290-57890312 GTGCCCAGTGTAGCAGCTCGGGG + Intergenic
1175545970 20:59778073-59778095 GTTCCCCTTGGAGCAGTTCGCGG + Intronic
1175688100 20:61045977-61045999 GACCCCAGTGCAGCAGATCCAGG - Intergenic
1175688115 20:61046052-61046074 GACCCCAGTGCAGCAGATCCAGG - Intergenic
1175688132 20:61046127-61046149 GACCCCAGTGCAGCAGATCCAGG - Intergenic
1175688149 20:61046202-61046224 GACCCCAGTGCAGCAGATCCAGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1175994821 20:62807348-62807370 GTTCCCAGTGGGGCAGATTTGGG - Intronic
1179969917 21:44830064-44830086 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1180099255 21:45576787-45576809 GTTCCCCCTGGGGCAGGGCCAGG + Intergenic
1180953565 22:19731432-19731454 GGGCCCCGTGGAGGAGGTCCTGG + Intergenic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1183442969 22:37833741-37833763 GTTTCCAGTGCAGCTGCTCCTGG - Exonic
1183931615 22:41238780-41238802 CCTCGCAGTGGCGCAGGTCCAGG + Exonic
1184606017 22:45575334-45575356 GTGCCCAGTGGAGCAGGACATGG + Intronic
1184645436 22:45892397-45892419 GTTCCCAGTAAAGCAGCTCCAGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184823341 22:46929863-46929885 GTTCCCAGCACACCAGGTCCAGG - Intronic
1185013787 22:48331895-48331917 GTCCCCAGGGGAGCAGTGCCAGG + Intergenic
950122272 3:10489690-10489712 GTTCCCAGGAGAGCAGGGCATGG - Intronic
950132592 3:10557545-10557567 GTTCCTAGAGGAGCAGGCACTGG + Intronic
950418020 3:12879687-12879709 CTCCCCAGTGGAGCAGGGCCTGG - Intergenic
950483502 3:13259213-13259235 GTTTCCACTGGAGCAGGACCTGG + Intergenic
951188446 3:19741413-19741435 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
951262172 3:20523331-20523353 GCCCCCACTGGAGCAGGTGCTGG - Intergenic
951857406 3:27213247-27213269 GTTACCAGTGGAGGGAGTCCAGG - Intronic
952383563 3:32822266-32822288 GTTCCCAGTTAGGCAGGTCTGGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
956613198 3:71145071-71145093 ATGCCCAGTGAAGCATGTCCAGG + Intronic
957465609 3:80586336-80586358 GTTCCCAGTGGAGAGGGAACAGG - Intergenic
957719227 3:83972139-83972161 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
957956605 3:87196204-87196226 GTCCCCACTGGGGCAGGGCCTGG + Intergenic
960756520 3:121019531-121019553 ATCTCCACTGGAGCAGGTCCTGG + Intronic
960998817 3:123358648-123358670 GGTCCGAGTGGACAAGGTCCAGG + Intronic
961454330 3:127016739-127016761 GTGCCCAGTGGAAGAGCTCCTGG - Intronic
961536400 3:127573442-127573464 GTCCCCAGGGGAGGAGGACCAGG - Exonic
962245553 3:133788532-133788554 GTTACCAGTGGAGGGTGTCCAGG - Intronic
965444900 3:168763409-168763431 GTTCCCATGGAAGCAGGCCCTGG - Intergenic
968291233 3:197541292-197541314 GATTCCAGTGCAACAGGTCCTGG + Intronic
968435691 4:587700-587722 GCTACCAGAGGAGCAGCTCCAGG - Intergenic
968744603 4:2353178-2353200 GTTCCCACCGCAGCAGGGCCAGG + Intronic
969799481 4:9551612-9551634 GTGCTCAGTGGAACAGGTGCTGG + Intergenic
970428452 4:15966289-15966311 ATTTCCAGTGGAACAAGTCCAGG + Intronic
971213268 4:24640232-24640254 GTTTCCAGTGGAGGGTGTCCGGG + Intergenic
971860959 4:32104773-32104795 GTTACCAGTGGAGGTTGTCCAGG - Intergenic
972836742 4:42880256-42880278 ATTCACAGTGGAGCAGCCCCAGG + Intergenic
975336835 4:73187750-73187772 GTTAACAGTGGAGGATGTCCAGG - Intronic
976259583 4:83133311-83133333 GTTACCAGTGGAGGGTGTCCAGG + Intronic
978588990 4:110303703-110303725 GTTACCAGTGGAGAGTGTCCAGG - Intergenic
980267833 4:130542953-130542975 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
983484719 4:168319828-168319850 GTTCCCTGTGGAGCAGTGCCTGG - Intergenic
985218126 4:187674685-187674707 GTTTCAAGTGGCTCAGGTCCTGG + Intergenic
985690765 5:1310921-1310943 GTTACCAGTGGAGGTTGTCCAGG + Intergenic
987137659 5:14914764-14914786 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
988929604 5:36024169-36024191 GTCTCCACTGGAGCAGGTGCTGG + Intergenic
989735201 5:44695279-44695301 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
991004355 5:61813096-61813118 GTGCCCAGAGGAGCAGCTCAGGG + Intergenic
995809218 5:116085906-116085928 GTTACCAGTGGAGGGTGTCCAGG + Intronic
996109638 5:119550103-119550125 GTTACCAGTGGAGGGTGTCCAGG - Intronic
999362522 5:150997965-150997987 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1001573229 5:172744417-172744439 GTTCCCAGGTGGGCAGGTCATGG + Intergenic
1003422107 6:5967929-5967951 CTTCCCAGTGGTGCTGGCCCAGG - Intergenic
1003982705 6:11404433-11404455 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1005086316 6:22010476-22010498 TTGCCCGGTGGAGCAGGTCCTGG - Intergenic
1007696081 6:43735036-43735058 ATTCCCAGTGAAGCAGGTCGGGG + Intergenic
1012850909 6:104446134-104446156 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1013596864 6:111668556-111668578 GTTCTCAGGGGTGCAGTTCCGGG - Intronic
1013807434 6:114011170-114011192 GTTACCAGTGGAGGGTGTCCAGG + Intronic
1017003006 6:150008776-150008798 GTCCCCAGTGGCACAGGTGCTGG + Intergenic
1017012571 6:150072442-150072464 GTCCCCAGTGGCACAGGTGCTGG + Intergenic
1017032947 6:150240293-150240315 GTTACCAGTGGAGAATGTCCAGG + Intronic
1017668326 6:156743621-156743643 GTTCCCCTTGGAGAAAGTCCTGG - Intergenic
1019987731 7:4670013-4670035 GTTCCCAGTTGAGCAGCTTTTGG + Intergenic
1020162082 7:5780895-5780917 GCTCCCGGTGGAACAGGACCAGG - Intronic
1021500473 7:21327881-21327903 GTTACTAGTGGAGGATGTCCAGG + Intergenic
1023547206 7:41330608-41330630 ATTCCCAGTGGATGAGGTTCTGG - Intergenic
1023931628 7:44709687-44709709 GTGCCAAGTGGAGTGGGTCCTGG + Intergenic
1024709129 7:51995756-51995778 GATCACAGTGGAGCTGTTCCAGG + Intergenic
1025614448 7:63106099-63106121 GTTCCCTATGGAGTAGTTCCTGG + Intergenic
1026023290 7:66727264-66727286 TTTGCCAGTGGAGCTGGCCCTGG + Intronic
1026184702 7:68073490-68073512 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1028712341 7:93923522-93923544 GTTCCCAGTACAGCAAGTGCTGG + Intronic
1029281629 7:99439228-99439250 GATCACAGAGGAGCGGGTCCCGG - Intronic
1029545579 7:101208801-101208823 CTTCCCAGAGGAGGAGGTGCAGG - Intronic
1029610179 7:101622561-101622583 ATTCCCAGGGGATCAGGGCCTGG + Intronic
1030973445 7:116090501-116090523 GTTACCAGTGGAGGGTGTCCGGG - Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1031689804 7:124773522-124773544 GTTCCAATTGGAGGAGTTCCAGG - Intergenic
1032453081 7:132051496-132051518 GAGCACAGTGGGGCAGGTCCAGG + Intergenic
1033849838 7:145481948-145481970 GTTACCGGTGGAGGATGTCCAGG + Intergenic
1033983758 7:147197449-147197471 GTTACCAGTGGAGGATGTACAGG - Intronic
1034139403 7:148802177-148802199 GTCCCCAGGAGAGGAGGTCCTGG + Intergenic
1034383582 7:150720117-150720139 GTTCCCAGTGGCGCTCTTCCCGG - Exonic
1034405667 7:150901035-150901057 GGTCCCAGAGGTGTAGGTCCTGG - Intergenic
1035282798 7:157787951-157787973 GTTCCCAGGGGACCCGGTGCTGG - Intronic
1036600997 8:10259997-10260019 ATTCTCAGTGACGCAGGTCCAGG - Intronic
1037682770 8:21111289-21111311 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1038840172 8:31177509-31177531 GTTACCAGTGGAGGGTGTCCAGG - Intergenic
1039760161 8:40565892-40565914 CTTCACAGTGGTGAAGGTCCTGG - Intronic
1039878829 8:41610614-41610636 GGTCCCAGGTGAGCAGGTCTTGG + Intronic
1040593660 8:48818473-48818495 CTTCCCAGTGGAGCCTGGCCAGG + Intergenic
1041119147 8:54569113-54569135 GTTCCCAGGAGAGCAAGTCCTGG + Intergenic
1042844126 8:73153561-73153583 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1045295625 8:100869679-100869701 GTGCCCAGTGGACAAGCTCCAGG - Intergenic
1045347053 8:101302904-101302926 CTTCCCAGAGGGGCAGGACCAGG - Intergenic
1045429137 8:102096897-102096919 GTTACCAGTGGAGGGTGTCCAGG - Intronic
1048878242 8:138853249-138853271 GGCCCCATTGGAGCAGGTTCAGG + Intronic
1049392869 8:142381147-142381169 ATTCCCAGGGGAGCAGCTTCTGG - Intronic
1049476886 8:142801034-142801056 GTGCCCAGTGGGGCAGGGCTAGG + Intergenic
1049667447 8:143852557-143852579 GCAGCCAGTGGAGCAGGGCCAGG + Intergenic
1049885888 9:25891-25913 GTGCCTAGGGGAGCAGGTCTAGG - Intergenic
1050182017 9:2933234-2933256 GTTCTCAGGGCAGCAGGTTCCGG - Intergenic
1051139800 9:13966073-13966095 CTTCCCAGTGGAGTAGGTTTTGG - Intergenic
1056239582 9:84631159-84631181 GTTTTCAGTGAAGCAGGTGCTGG + Intergenic
1057144471 9:92748961-92748983 GTTCCCAGAGGAGATGGTACAGG + Intronic
1057883302 9:98808947-98808969 GTTCCCATTGGAGCTGGTGGTGG + Intronic
1059434569 9:114268193-114268215 GTTTCCACTGGAGCAGGGCTGGG + Intronic
1059434594 9:114268327-114268349 GTTTCCACTGGAGCAGGGCTGGG + Intronic
1061019395 9:128004323-128004345 GTTCTCAGAGGAGCAGGTGTGGG - Intergenic
1062126766 9:134868161-134868183 GGACCCAGCGGAGCAGATCCAGG + Intergenic
1062462836 9:136669044-136669066 GTGCCCAGTGGAGTGGGACCAGG - Intronic
1062484162 9:136766109-136766131 GTTACCAGTGGAGGGTGTCCAGG - Intronic
1185820292 X:3196407-3196429 GTTCCCAGTGAAGCAGAGGCTGG - Intergenic
1187479386 X:19641135-19641157 GTTACCAGTGGAGGGTGTCCAGG - Intronic
1187648596 X:21375322-21375344 GCGACCAGGGGAGCAGGTCCTGG - Intronic
1188263430 X:28042588-28042610 GTTCCCAGGGCAGCAGTTCCTGG + Intergenic
1189291497 X:39889076-39889098 GTTCCCAGTTTCCCAGGTCCAGG - Intergenic
1191780901 X:64863998-64864020 TCTCCCGGTGGACCAGGTCCTGG - Intergenic
1192570702 X:72201803-72201825 GTTAACAGTGGAGGATGTCCAGG + Intronic
1194278181 X:91913320-91913342 TTTCCCAGTGGAGTAGCTCATGG + Intronic
1195162269 X:102182340-102182362 GATCCCAGAGGAGGAGGTTCAGG - Intergenic
1195166305 X:102223940-102223962 GATCCCAGAGGAGGAGGTTCAGG - Exonic
1195192555 X:102463148-102463170 GATCCCAGAGGAGGAGGTTCAGG + Exonic
1195326860 X:103765241-103765263 GTTCCTGGTGGAGGTGGTCCTGG + Intergenic
1195589896 X:106612193-106612215 GTTCCCAAGGGCCCAGGTCCTGG + Exonic
1196392151 X:115218914-115218936 GTTGCCAGTGGAGGGTGTCCAGG - Intronic
1196774906 X:119329441-119329463 GTTACCAGTGGAGGATATCCAGG + Intergenic
1196778771 X:119363304-119363326 GTTACCAGTGGAGGGTGTCCAGG + Intergenic
1199708259 X:150449794-150449816 GTTCCCAGTGGAGGAAGCCTGGG - Intronic
1200595518 Y:5135395-5135417 TTTCCCAGTGGAGTAGCTCATGG + Intronic