ID: 953995048

View in Genome Browser
Species Human (GRCh38)
Location 3:47513280-47513302
Sequence CCGCGCCCGGCCGCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953995033_953995048 21 Left 953995033 3:47513236-47513258 CCCGCCTCGGCCTCCCAAACTGC 0: 951
1: 91332
2: 230776
3: 245435
4: 244350
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
953995036_953995048 17 Left 953995036 3:47513240-47513262 CCTCGGCCTCCCAAACTGCTGGG 0: 1319
1: 123670
2: 273017
3: 222296
4: 230944
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
953995040_953995048 8 Left 953995040 3:47513249-47513271 CCCAAACTGCTGGGATTACAGGG 0: 65
1: 7823
2: 320521
3: 280282
4: 216470
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
953995042_953995048 7 Left 953995042 3:47513250-47513272 CCAAACTGCTGGGATTACAGGGG 0: 43
1: 5254
2: 214550
3: 289257
4: 254556
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
953995038_953995048 11 Left 953995038 3:47513246-47513268 CCTCCCAAACTGCTGGGATTACA 0: 3819
1: 309289
2: 271603
3: 206826
4: 226724
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
953995034_953995048 20 Left 953995034 3:47513237-47513259 CCGCCTCGGCCTCCCAAACTGCT 0: 998
1: 94644
2: 191345
3: 138453
4: 87012
Right 953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953995048 Original CRISPR CCGCGCCCGGCCGCTTCCCA GGG Intronic
900087440 1:905121-905143 CCCCGCCCCACCGCGTCCCAGGG + Intergenic
900353171 1:2246930-2246952 CCGTGCCCGGCCTGTGCCCATGG - Intronic
901400659 1:9013318-9013340 CCGCGCCCGGCCGGCTCTGAAGG + Intronic
901631471 1:10650107-10650129 CCGGGCCCGGCCCCTCCTCAGGG + Intronic
903867914 1:26411838-26411860 CTGCCCCCTGCCCCTTCCCAGGG - Intronic
904204078 1:28841328-28841350 CCCAGCCCGGCCCCTTGCCATGG + Intronic
904563290 1:31413050-31413072 CCCCGACCGGCCCCTTCCCTAGG + Intronic
906751663 1:48268039-48268061 CCGCGCCCGGCCAGGTCTCAGGG + Intergenic
913301276 1:117371910-117371932 CCGCCCCCGTCCCCCTCCCAAGG - Intronic
915538227 1:156550520-156550542 CTGAGCCTGGCCGCGTCCCAGGG - Intronic
920351969 1:205343610-205343632 CGGCGCCCGGGCGCTCCCCAAGG - Exonic
1069500474 10:68948567-68948589 CTGCGCCCGGCCGGTTTCAAAGG + Intergenic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1070605451 10:77895118-77895140 CAGCCCCAGGCTGCTTCCCATGG + Intronic
1070754226 10:78981745-78981767 CCTCTCCCGGGGGCTTCCCAGGG + Intergenic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073053672 10:100685646-100685668 CCTCGCCTGGCCACTTCCAAGGG - Intergenic
1076905086 10:133357532-133357554 CCGGACCCGGCCGCCTCCCCAGG + Intronic
1077506256 11:2931195-2931217 CTGCCCCCGGCCGCTTCTCCTGG - Intergenic
1078594601 11:12675011-12675033 CGGCGCCCGGCCGCTCACCTCGG - Intronic
1078986658 11:16605061-16605083 CCGAGCCCGGCCGCTCCCGCGGG - Intronic
1081696959 11:45119335-45119357 CCGCGCCCGGCCGCCTTACCAGG - Intronic
1084018491 11:66402172-66402194 CCGCGCCTGGCCGATTCCATGGG + Intergenic
1084386203 11:68844008-68844030 CCGCGCCCTGTCTGTTCCCAGGG + Intronic
1084591002 11:70090295-70090317 CCGCGCCTGGCCCCTCCCCAGGG + Intronic
1086096855 11:83059230-83059252 CCGTGCCTGGCCTCTTTCCAGGG + Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089610345 11:119665238-119665260 GCGCGCCGGGCCGGTGCCCACGG - Exonic
1090211057 11:124921333-124921355 CCGTGCCCGGCCGCTCGCCGGGG - Exonic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1090780696 11:130003462-130003484 CGGCGCCCGGCCGCTCCCTGGGG - Intergenic
1091562228 12:1623483-1623505 CCGCGCCCGGCCTCTTTGAAGGG + Intronic
1092187451 12:6491411-6491433 CCGCCCCCCTCCGCCTCCCAAGG + Intergenic
1092219173 12:6700971-6700993 CAGCGACCGTCCGCTTCCCTGGG + Intergenic
1096418192 12:51432116-51432138 CCGCGCCTGGCCCATTTCCAAGG - Intronic
1101371934 12:104138261-104138283 CCGCCGCGGGCCGCTTCCCTCGG + Exonic
1103414794 12:120736939-120736961 TCGCCCCCGGCAGCTGCCCATGG + Intronic
1105290126 13:19048240-19048262 CCGAGCCCTGCAGCCTCCCAGGG - Intergenic
1106361953 13:29039081-29039103 CCGCACCTGGCCCCTCCCCAAGG - Intronic
1106665562 13:31847093-31847115 CCACCCCCGCCCGCTTCCCTCGG - Intergenic
1116705582 14:48294654-48294676 CCGCGCCCGGCCCATACCTATGG - Intergenic
1118318895 14:64741998-64742020 CCTGGCCTGGCCCCTTCCCAGGG - Exonic
1118372644 14:65150671-65150693 CCGCGCCCGGCTACTTGCCTTGG + Intergenic
1121050376 14:90816091-90816113 CCGCGCCCGGCCGCGCCTCGGGG + Intronic
1122444693 14:101760778-101760800 CCTCGGCCGGCCCCTTCCCTCGG - Intergenic
1122922323 14:104885167-104885189 CCCCGCCCCTCCCCTTCCCAGGG + Intronic
1123787457 15:23687389-23687411 CCGCCCCCAGCCGCTGGCCAAGG - Intergenic
1123814655 15:23964698-23964720 CCGCCCTCCTCCGCTTCCCAAGG + Intergenic
1124351864 15:28961630-28961652 ACCCGCCCGGCCGCTCCCCCGGG - Intronic
1124799235 15:32813887-32813909 ACGCTCCCTGCTGCTTCCCAAGG + Intronic
1126688367 15:51267543-51267565 CCGTGGCCGGCCACTGCCCAGGG + Intronic
1128099802 15:64989626-64989648 GCACACCCAGCCGCTTCCCAGGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129026158 15:72576213-72576235 CCGCGCCCGGCCCCTATCAAAGG - Intronic
1129082181 15:73051721-73051743 GCGCGGCCGGCCCCCTCCCACGG + Exonic
1129791207 15:78341630-78341652 CCGCGCCCGCCCGGGTCCCTGGG + Intronic
1130380253 15:83365729-83365751 CTGCGTCCGGCCGCTTCTCCAGG + Intergenic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1136278699 16:29194455-29194477 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1137727206 16:50665092-50665114 CCGCGCCACGTCGCTTTCCAGGG - Intergenic
1139472152 16:67184086-67184108 CTGGGCCCGCCCCCTTCCCAAGG + Intergenic
1139868358 16:70082334-70082356 CCGCCCCCCTCGGCTTCCCAAGG - Intergenic
1140936551 16:79675974-79675996 CCGCGCCCGGCCAATTTCTAAGG + Intergenic
1141623926 16:85251580-85251602 CCGGGCCCAGCCCCTGCCCAGGG - Intergenic
1141839933 16:86567891-86567913 CCGCCCCCGGCGGCGTCCAAGGG + Exonic
1142083091 16:88160536-88160558 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1142226240 16:88878981-88879003 CCTGGCCCCACCGCTTCCCAAGG + Intronic
1142757711 17:2025532-2025554 CCGCGCGGCGCCGCCTCCCAAGG + Intergenic
1143669170 17:8384392-8384414 CCGCGCCCGGCCCCTGCAAATGG + Intergenic
1147653103 17:42072966-42072988 CCGCCCCCGGCCGCTACCTCTGG + Intergenic
1148603091 17:48908708-48908730 CCGCCCTCAGCCGCTGCCCACGG + Exonic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1150268809 17:63849369-63849391 CCTCGCCGGGCCGCTCCTCACGG - Intergenic
1151137066 17:71957043-71957065 CCACGCCCTGCCGCTTACGAGGG + Intergenic
1151953955 17:77371520-77371542 CCGGACCCGGCATCTTCCCAGGG + Intronic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152357256 17:79813302-79813324 CCGCCCCCGCCCGCTCCCCCGGG + Intergenic
1152389684 17:79995493-79995515 CCGCGCCCGGCCGATCCTGAAGG - Intronic
1152654990 17:81515114-81515136 GCCCGCCCGCCCGCATCCCAGGG - Intronic
1152697327 17:81803783-81803805 GCGCGCCCCTCCGCGTCCCAGGG + Intergenic
1153805492 18:8705935-8705957 CCGCGCCCGGCCGCCTCTCTCGG + Intronic
1154274338 18:12947089-12947111 CTGAGCCAGGCCTCTTCCCAGGG + Intergenic
1160321514 18:77900315-77900337 CCGCGCGTGGCCGCCTCCCGCGG - Intergenic
1160452971 18:78978548-78978570 CCGCGCCAGGCCGGGTCCGATGG + Intergenic
1160499402 18:79394762-79394784 CAGCGCCCGACCGCCTCCCCCGG + Intergenic
1160502734 18:79410434-79410456 CCCCGCCCTGCCGCTCCCCACGG + Exonic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160777275 19:862051-862073 ACGCGCCCCGCCCCTTCCCTGGG - Intronic
1160793458 19:933369-933391 CCCCGCCCGGCCACTTCCTCTGG - Intronic
1160864055 19:1249475-1249497 CCGCTCCCGGCCGCTCCCTTGGG + Intronic
1161097622 19:2402100-2402122 CCGCGCCCAGCCTCGTTCCAGGG - Intronic
1161309597 19:3586370-3586392 CCACGCCCTGCCCTTTCCCATGG + Intronic
1161770185 19:6226804-6226826 CTGCGCACTGCCGCTTCCCTAGG - Intronic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1164159710 19:22618225-22618247 CTGGCCCCGGCCGCGTCCCAGGG + Intergenic
1165355184 19:35299915-35299937 CCGCCTCCGGCCGCATCCCCAGG - Intronic
1165542803 19:36506222-36506244 CCGCGCCCAGCCACTTACAAGGG - Intergenic
1167074396 19:47239935-47239957 GCGCGCCCGGCAGCTCCCCGGGG - Intergenic
1167620377 19:50556931-50556953 CCGCCCCCGGCCCATTGCCACGG - Intronic
1168145185 19:54416384-54416406 CCGAGCCGGGCCCCTTCCCCAGG - Intronic
925068909 2:951015-951037 CCGCCCCCGGCCGCCTCCCGCGG + Exonic
927982154 2:27380813-27380835 CCCGCCGCGGCCGCTTCCCACGG - Intergenic
928093819 2:28392363-28392385 CCGCCCCGAGCCCCTTCCCAGGG + Intergenic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
936403160 2:112181660-112181682 CTGCTCCCGGCCCCTACCCAAGG + Intronic
938087583 2:128411597-128411619 CCATGCACGGCAGCTTCCCAGGG - Intergenic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
938857987 2:135335399-135335421 CAGCGCCCAGCCTCTTCCAATGG - Intronic
940318471 2:152349123-152349145 CCGCGCCCGGCCACTTCTAAGGG + Intronic
947188140 2:227472689-227472711 CCGCCCCCGACCGCCTCCCACGG - Intronic
948595370 2:239076216-239076238 CCACGCCCCTCGGCTTCCCAGGG + Intronic
1168795390 20:607623-607645 CTGGGCCTGGCCGCTTCCCTGGG - Intronic
1170231061 20:14047154-14047176 CCGCGCCCAGCCCATTTCCATGG - Intronic
1172702838 20:36863406-36863428 CCGCGCCGGGTCCCTCCCCAGGG - Exonic
1173531795 20:43775344-43775366 CGGTGCCTGGCCTCTTCCCATGG - Intergenic
1174646077 20:52086766-52086788 CCGCGCCCGGCCCTTTCACAAGG + Intronic
1176019664 20:62956213-62956235 CTGCGCCTAGACGCTTCCCACGG - Intronic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176062393 20:63178181-63178203 GCGCACCCGGCCGCCTCCCGCGG - Intergenic
1176162095 20:63653239-63653261 CCGCTGCCGGCCGCTGCCCCAGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179986758 21:44926514-44926536 CCACGCCGGGCTGCTTCCCAGGG + Intronic
1179988114 21:44932369-44932391 CCGAGCCTGGCCGCCTCCCTGGG + Intergenic
1180960102 22:19758680-19758702 CTGCGCCCGGCCGGTGCGCAGGG + Intronic
1183657740 22:39198993-39199015 CCGCGCCCGGCCAATTCCTTGGG - Intergenic
1183702435 22:39457820-39457842 CAGCGCCCGACCCCCTCCCACGG + Intronic
1184106301 22:42369221-42369243 CCGCGGCCGGCCGCTGGCCACGG + Intergenic
1184200740 22:42967596-42967618 CCGCGCCCGGCCCATTTGCAGGG - Intronic
952827778 3:37538342-37538364 CTGCCCCCGGCTGCTTCCCGAGG - Intronic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
955480514 3:59385090-59385112 CCACCCCCGGCCGGTGCCCACGG + Intergenic
956994275 3:74806120-74806142 CCGCACCCGGCCATTGCCCAAGG + Intergenic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
961545281 3:127629073-127629095 CCCCGCCCGGCCGCGTGCCGCGG - Intergenic
963160749 3:142149120-142149142 ACGCGCCCGGCCGGGTCCAAAGG + Intronic
964124797 3:153225133-153225155 CTGCGCCCGGCCAGTTCTCAAGG - Intergenic
966856384 3:184196706-184196728 CCTCTCCAAGCCGCTTCCCAAGG - Intronic
971065410 4:23026723-23026745 CCGCGCCCGGCCATTTTCCTTGG - Intergenic
973360262 4:49158725-49158747 CTGCGCCCGGCCTCTACCCTAGG + Intergenic
973399824 4:49629184-49629206 CTGCGCCCGGCCTCTACCCTAGG - Intergenic
974991381 4:69094436-69094458 CCGCGCCCGGCCGGTTTCTAAGG + Intronic
975975364 4:80089537-80089559 CCTCCCCCAGCCGCATCCCAGGG + Intronic
978646992 4:110945838-110945860 TGGCGCCCGGCCGCGGCCCAAGG + Intergenic
985802154 5:2011681-2011703 CCCCGCCCTGCCCCTCCCCAAGG - Intergenic
986402485 5:7395045-7395067 CCGCGCCCAGCCGCTCTCCCCGG + Intergenic
988564878 5:32312846-32312868 CCGCGCGTCGCTGCTTCCCAGGG - Exonic
991362738 5:65837770-65837792 CCGCGCCCGGCCTGTTGCCCAGG + Intronic
996900755 5:128538841-128538863 CCTCGCCCGGCCGCGGACCAGGG + Intronic
997463358 5:134070981-134071003 CCATCCCCAGCCGCTTCCCAGGG + Intergenic
998228708 5:140345954-140345976 CCGGTCCCGGCCGCCTCCTAGGG + Exonic
1000220415 5:159209171-159209193 CGCCCCCCGGCCGCTTCCCACGG - Intronic
1001682341 5:173567606-173567628 CTGTGCCCGGCCGCATCCTAGGG - Intergenic
1005672823 6:28124574-28124596 CGGCGCCCGGCCGCTTCAGCCGG - Exonic
1006096699 6:31660727-31660749 CGGCTCCCGGCGGCTCCCCAAGG - Exonic
1006636970 6:35468142-35468164 CCGAACCCAGCCGCTTCCCTAGG + Intergenic
1008545179 6:52577280-52577302 CCGCGCCCGGCCGCATTCTCGGG + Intergenic
1010021490 6:71165015-71165037 AGGCGCCCCGCCGCTGCCCAAGG - Intergenic
1015402129 6:132798642-132798664 CCGCCCCCGGCCTCCTCCCGGGG - Intergenic
1016937259 6:149456619-149456641 CCCCGCCCCGCCGCCCCCCAGGG + Intronic
1018856478 6:167678776-167678798 CCGCCCCCGGCCGCTTTCCAGGG + Intergenic
1019517105 7:1444937-1444959 CCTCGCCCGGCCACACCCCAGGG - Exonic
1019710758 7:2517170-2517192 CCACCCCCGCCCGCTTCCCCAGG - Intronic
1022459388 7:30590566-30590588 CCGCGCCCGGCCGATTCCTTAGG - Intergenic
1024344048 7:48294734-48294756 CCGCGCCCGGCCCGTTTCTATGG + Intronic
1025007132 7:55363576-55363598 CCGCACCCGGCGGCTTCCCCAGG + Intergenic
1025143266 7:56483365-56483387 CCTCGCCCCGCCCCTTCCCTCGG - Intergenic
1029125153 7:98290483-98290505 CCGCGCCCGGCCATCTCTCAAGG + Intronic
1030656634 7:112175151-112175173 CCGCGCCCAGCCCCGTCCCCTGG + Intronic
1031982495 7:128136676-128136698 CCGCGCCCGGCCGGTTAACAGGG - Intergenic
1033253183 7:139777786-139777808 GCGCGCCCGGCCCCCTCCCCCGG - Intronic
1033361386 7:140640877-140640899 GGGCGCCCGGCCGGTTGCCACGG + Intronic
1033661976 7:143408670-143408692 CCGCGCCCCGCCCCTTCCCGGGG - Intronic
1034399827 7:150854888-150854910 CCTGGCCCAGCCTCTTCCCAGGG - Intronic
1034799183 7:154042045-154042067 CGGCGCCTGGCCTCTTCTCATGG + Intronic
1035517609 8:249793-249815 CCGTGCCCGGCCTGTACCCAGGG - Intergenic
1037273697 8:17156402-17156424 CGCCGCCCGGCCGCCTCCCCTGG - Exonic
1039662236 8:39480087-39480109 CCGCTCCCGGCCGATTCAAAAGG + Intergenic
1040539866 8:48342853-48342875 CCCCCCCCGACCGCTCCCCAGGG + Intergenic
1041068145 8:54101862-54101884 GGGCGCCCGGCCGCGGCCCAAGG + Exonic
1045547446 8:103141082-103141104 CCTCGCCCGCCCGCTACCCCGGG + Intronic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1049439723 8:142603794-142603816 CCCCACCCTGCCTCTTCCCAAGG - Intergenic
1049762620 8:144337967-144337989 CCGCGCCCGGACGCTCCCCGGGG - Intergenic
1050542358 9:6681395-6681417 ACCCGCCTGGCCGCTTCCCTCGG + Intergenic
1053250814 9:36572790-36572812 CCGTGCGCGTCCGCTTCCCTGGG + Intergenic
1057804751 9:98212085-98212107 CCGCACCTGGCCCCTTCTCAGGG + Intronic
1061108783 9:128552496-128552518 CAGCGCCGGGGCGCTTCCCCCGG + Intergenic
1061108966 9:128553094-128553116 CCGCCCCCGGTCCCTTCCCTCGG + Intronic
1061327078 9:129870319-129870341 CCGTGCCCGGCTGCTTCTCTGGG + Intronic
1061693549 9:132354762-132354784 GCGGGCTCGGCCGCTTCCCTCGG - Intronic
1061943098 9:133893478-133893500 CCCCGCACGGCCGCCTACCAGGG + Intronic
1062482598 9:136759418-136759440 CTGCCCCCTGCCCCTTCCCAGGG + Intergenic
1062551034 9:137086597-137086619 CCCCGCCCGGGCGCCTCCCCGGG + Intergenic
1062558798 9:137130005-137130027 CGGCGCCCGGGCGCCTCCCCGGG - Intergenic
1062658964 9:137618578-137618600 CCGCGCCAGGCCGCGGCCCAGGG + Exonic
1185836023 X:3346519-3346541 CCGTGTGCGGCGGCTTCCCAAGG - Exonic
1185895783 X:3857770-3857792 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185900902 X:3896194-3896216 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185906017 X:3934633-3934655 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1187339775 X:18410884-18410906 CCGCGCCCGGCCAGTTCAAAGGG - Intergenic
1189753838 X:44250946-44250968 CCGCGCCCGGCCAGTTCTTAAGG - Intronic
1190156237 X:47995039-47995061 CCGCGCCCGGCCTCTTCTGCTGG - Intronic
1196265988 X:113647107-113647129 CCGCGCCCGGCCTGTCCACAAGG + Intergenic
1201240651 Y:11954291-11954313 CCGTGTGCGGCGGCTTCCCAAGG + Intergenic