ID: 953996272

View in Genome Browser
Species Human (GRCh38)
Location 3:47522437-47522459
Sequence GGCTCCAGAGAGATGAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953996272_953996274 -5 Left 953996272 3:47522437-47522459 CCTTAGCTCATCTCTCTGGAGCC No data
Right 953996274 3:47522455-47522477 GAGCCCAGTGGTAGTCTTCATGG No data
953996272_953996280 27 Left 953996272 3:47522437-47522459 CCTTAGCTCATCTCTCTGGAGCC No data
Right 953996280 3:47522487-47522509 CTTCAGGCTGTCCTGACTTAAGG No data
953996272_953996278 11 Left 953996272 3:47522437-47522459 CCTTAGCTCATCTCTCTGGAGCC No data
Right 953996278 3:47522471-47522493 TTCATGGGCTCTCCTGCTTCAGG No data
953996272_953996275 -4 Left 953996272 3:47522437-47522459 CCTTAGCTCATCTCTCTGGAGCC No data
Right 953996275 3:47522456-47522478 AGCCCAGTGGTAGTCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953996272 Original CRISPR GGCTCCAGAGAGATGAGCTA AGG (reversed) Intergenic
No off target data available for this crispr