ID: 954000151

View in Genome Browser
Species Human (GRCh38)
Location 3:47550124-47550146
Sequence ATGAAGAAGAAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954000151_954000158 8 Left 954000151 3:47550124-47550146 CCCTTCTCCTTCTTCTTCTTCAT No data
Right 954000158 3:47550155-47550177 TCTTGCTCTGTTGCCAAGGATGG No data
954000151_954000159 18 Left 954000151 3:47550124-47550146 CCCTTCTCCTTCTTCTTCTTCAT No data
Right 954000159 3:47550165-47550187 TTGCCAAGGATGGAGTGCAGTGG 0: 11
1: 1614
2: 76907
3: 189117
4: 235445
954000151_954000157 4 Left 954000151 3:47550124-47550146 CCCTTCTCCTTCTTCTTCTTCAT No data
Right 954000157 3:47550151-47550173 CGGGTCTTGCTCTGTTGCCAAGG 0: 2
1: 92
2: 5359
3: 36042
4: 96527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954000151 Original CRISPR ATGAAGAAGAAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr