ID: 954000691

View in Genome Browser
Species Human (GRCh38)
Location 3:47554475-47554497
Sequence TTGTGTCAGGGCAGGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954000682_954000691 5 Left 954000682 3:47554447-47554469 CCTCCCTCAGTGGTGGCCGGCTT No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data
954000684_954000691 1 Left 954000684 3:47554451-47554473 CCTCAGTGGTGGCCGGCTTCTGC No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data
954000683_954000691 2 Left 954000683 3:47554450-47554472 CCCTCAGTGGTGGCCGGCTTCTG No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data
954000680_954000691 7 Left 954000680 3:47554445-47554467 CCCCTCCCTCAGTGGTGGCCGGC No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data
954000678_954000691 10 Left 954000678 3:47554442-47554464 CCGCCCCTCCCTCAGTGGTGGCC No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data
954000681_954000691 6 Left 954000681 3:47554446-47554468 CCCTCCCTCAGTGGTGGCCGGCT No data
Right 954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954000691 Original CRISPR TTGTGTCAGGGCAGGGTTCT GGG Intergenic
No off target data available for this crispr