ID: 954000799

View in Genome Browser
Species Human (GRCh38)
Location 3:47555162-47555184
Sequence TGCGAGCACATGTGTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954000799_954000804 26 Left 954000799 3:47555162-47555184 CCACCTTCACACATGTGCTCGCA No data
Right 954000804 3:47555211-47555233 GTGGTGTTGCGTCTTCCTCCTGG No data
954000799_954000802 7 Left 954000799 3:47555162-47555184 CCACCTTCACACATGTGCTCGCA No data
Right 954000802 3:47555192-47555214 TGTCTTTCTTCCTGCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954000799 Original CRISPR TGCGAGCACATGTGTGAAGG TGG (reversed) Intergenic