ID: 954001188

View in Genome Browser
Species Human (GRCh38)
Location 3:47558410-47558432
Sequence GGTCCAAGTGGCCCAAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001188_954001194 10 Left 954001188 3:47558410-47558432 CCAGCGTTTGGGCCACTTGGACC No data
Right 954001194 3:47558443-47558465 TGCCCATTTAGCAGAGGTGATGG No data
954001188_954001197 19 Left 954001188 3:47558410-47558432 CCAGCGTTTGGGCCACTTGGACC No data
Right 954001197 3:47558452-47558474 AGCAGAGGTGATGGAGAGAATGG No data
954001188_954001193 4 Left 954001188 3:47558410-47558432 CCAGCGTTTGGGCCACTTGGACC No data
Right 954001193 3:47558437-47558459 GGCAACTGCCCATTTAGCAGAGG No data
954001188_954001198 20 Left 954001188 3:47558410-47558432 CCAGCGTTTGGGCCACTTGGACC No data
Right 954001198 3:47558453-47558475 GCAGAGGTGATGGAGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001188 Original CRISPR GGTCCAAGTGGCCCAAACGC TGG (reversed) Intergenic
No off target data available for this crispr