ID: 954001743

View in Genome Browser
Species Human (GRCh38)
Location 3:47563055-47563077
Sequence TATAGAGGCGCCTGGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001743_954001754 30 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001754 3:47563108-47563130 TGCTGAGCCCGGCCTTCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 190
954001743_954001750 4 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001750 3:47563082-47563104 CATGTGTTGATGAGCTCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 143
954001743_954001749 3 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001749 3:47563081-47563103 TCATGTGTTGATGAGCTCTGCGG 0: 1
1: 0
2: 2
3: 47
4: 634
954001743_954001752 19 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 291
954001743_954001751 5 Left 954001743 3:47563055-47563077 CCCTTGGCCCAGGCGCCTCTATA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001743 Original CRISPR TATAGAGGCGCCTGGGCCAA GGG (reversed) Intronic
902658920 1:17887849-17887871 TCCAGAGTCGCCTGGGCCCAGGG - Intergenic
902679858 1:18035607-18035629 TACAGAGGAGACTGGGGCAAAGG - Intergenic
905024901 1:34843318-34843340 TATAGGGGAGCCTGGGCTAGGGG - Intronic
908280621 1:62530925-62530947 TATTGAGGCCCCAGGGCCATGGG - Intronic
911172282 1:94782539-94782561 AAGTGAGGAGCCTGGGCCAAAGG + Intergenic
922095288 1:222438324-222438346 AATAGAGAGGGCTGGGCCAATGG - Intergenic
1069315646 10:67097452-67097474 TATAGGGACACCTGGGCCACAGG + Intronic
1069879717 10:71584246-71584268 TAAAGTGGCTCCTGGGGCAAGGG + Intronic
1075645108 10:124092102-124092124 GATAGAGGCGCCGGGGCGAAGGG - Intronic
1081853736 11:46291020-46291042 GAAAGAGGCCCCTGGGGCAATGG + Intronic
1083660580 11:64250218-64250240 TCTAGAGGCTCCTGGGCCTCAGG + Intergenic
1083899502 11:65636754-65636776 TCTAGAGGCGCCTGGGGGAGGGG - Exonic
1085391228 11:76183326-76183348 TGTAGAGGCCCCCAGGCCAATGG - Intergenic
1098229093 12:68354573-68354595 TATAGAGGCTGCTGAGCAAATGG + Intergenic
1101023767 12:100580104-100580126 AATAGATGCCACTGGGCCAAGGG + Intronic
1102521732 12:113481528-113481550 GATAGAGGTGCATGGTCCAAAGG - Intergenic
1103941942 12:124506002-124506024 TAGAGAGGCTCCTCGGCCACTGG + Intronic
1105918039 13:24935436-24935458 TGTAGAGGCCACTGGGCTAAAGG + Intergenic
1107323388 13:39213165-39213187 TATAGTGACGCCTGGGCTATTGG - Intergenic
1117674492 14:58141708-58141730 TATTGAGGCCCCAGGGCCATGGG - Intronic
1119086008 14:71739485-71739507 AATAGAGGCGGATGGGCCAGGGG - Exonic
1132090873 15:98947106-98947128 TTTAGAGAGGCCTGGGCCCAGGG - Intronic
1132323272 15:100943086-100943108 TATAAAGACTCCTGGGCCTAAGG + Intronic
1134911253 16:18028699-18028721 GATAGTGGTGCCTGGGTCAAAGG + Intergenic
1143459786 17:7094880-7094902 TATAGAGTCGCCTCGGCTCACGG + Intergenic
1147135842 17:38433866-38433888 CAGAGAGGAGCCTGGGCCACTGG + Intronic
1150589465 17:66549444-66549466 TTTAGAGAGGCCTGGGCCACAGG - Intronic
1151257000 17:72885697-72885719 TAAAAAGGTGGCTGGGCCAATGG - Intronic
1156899460 18:42284365-42284387 TGTAGATGCCCTTGGGCCAAAGG - Intergenic
1157160627 18:45310941-45310963 CCTAGAGGGGCCTGGGACAATGG + Intronic
1163660661 19:18575189-18575211 TATTGAGGCTCCAGGGCCACGGG - Exonic
933337895 2:80983728-80983750 TATAAAGACACCTTGGCCAAGGG - Intergenic
937683187 2:124666589-124666611 TCTAGAGTCCCCTTGGCCAAGGG + Intronic
948110120 2:235448237-235448259 TGTAGAGGCCCCAAGGCCAATGG + Intergenic
1181755843 22:25024127-25024149 TGTAGAGGAGCGTGGACCAAGGG + Intronic
1181778837 22:25178532-25178554 CACGGAGGCGCCTGGGCCAGAGG + Intronic
952581324 3:34836943-34836965 GATACAGAGGCCTGGGCCAATGG - Intergenic
954001743 3:47563055-47563077 TATAGAGGCGCCTGGGCCAAGGG - Intronic
958907862 3:99961639-99961661 AAAAGAGGCACCAGGGCCAAAGG - Intronic
962285965 3:134085740-134085762 GGTAGAGGAGCCTGAGCCAATGG - Intronic
974169245 4:58245217-58245239 TAGAGTGGCGCCTTTGCCAAGGG - Intergenic
975885177 4:78956737-78956759 TATAGAGGGGACTGGCACAATGG - Intergenic
977759975 4:100722265-100722287 TGGAGAGGAGCCTGGGACAAAGG + Intronic
991950559 5:71943433-71943455 TCCAGAGTCACCTGGGCCAAAGG - Intergenic
996620519 5:125496614-125496636 GATAGAGGGGCAGGGGCCAAGGG - Intergenic
1001639603 5:173235282-173235304 CATCGAGGCCCCTGGCCCAATGG - Exonic
1002041810 5:176520271-176520293 TATAAGGGCACCTGGGCCCAGGG + Intergenic
1003307579 6:4943608-4943630 TATAGATGCTCCTAGACCAATGG - Exonic
1013154537 6:107480935-107480957 TATGGAGGAGCCTGGGCAGAAGG - Intergenic
1021698412 7:23295287-23295309 TACAGAGCAGGCTGGGCCAAAGG - Intergenic
1021942265 7:25689519-25689541 TATTGAGGCCCCAGGGCCATGGG + Intergenic
1029708562 7:102287572-102287594 GAAAGGGGGGCCTGGGCCAAAGG - Intronic
1033770003 7:144539858-144539880 TATAAAGGGGCCTGGGCAAATGG + Intronic
1037723907 8:21467576-21467598 AGTAGAGGTGCCTGTGCCAAGGG + Intergenic
1051898443 9:22012577-22012599 TATTGAGGCTCCAGGGCCATGGG - Intronic
1057443336 9:95097413-95097435 GATGGAGGAGCCTGGGTCAAAGG - Intergenic
1062523307 9:136968559-136968581 TCTGGAGGGCCCTGGGCCAAGGG - Intergenic
1189050331 X:37638305-37638327 TATAAAGGCACCTGGTCAAAAGG + Intronic