ID: 954001744

View in Genome Browser
Species Human (GRCh38)
Location 3:47563056-47563078
Sequence CTATAGAGGCGCCTGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001744_954001749 2 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001749 3:47563081-47563103 TCATGTGTTGATGAGCTCTGCGG 0: 1
1: 0
2: 2
3: 47
4: 634
954001744_954001751 4 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001744_954001750 3 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001750 3:47563082-47563104 CATGTGTTGATGAGCTCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 143
954001744_954001752 18 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 291
954001744_954001754 29 Left 954001744 3:47563056-47563078 CCTTGGCCCAGGCGCCTCTATAG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 954001754 3:47563108-47563130 TGCTGAGCCCGGCCTTCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001744 Original CRISPR CTATAGAGGCGCCTGGGCCA AGG (reversed) Intronic
901737201 1:11320087-11320109 CTCTAGGGGCGAGTGGGCCAGGG - Intergenic
903969191 1:27107961-27107983 CCATAGAGGAGCTTGGGACATGG - Intronic
904498470 1:30900867-30900889 CTCTAGGGTCGCCTGGGCCAAGG + Intronic
904927681 1:34061438-34061460 CTAGAGAGGAGCCAGGGGCATGG - Intronic
905024902 1:34843319-34843341 TTATAGGGGAGCCTGGGCTAGGG - Intronic
906709982 1:47922287-47922309 CTCTTGTGGAGCCTGGGCCAAGG - Intronic
908280622 1:62530926-62530948 TTATTGAGGCCCCAGGGCCATGG - Intronic
908646683 1:66286114-66286136 CTATGGAGACTCATGGGCCAAGG - Intronic
910895724 1:92067168-92067190 CTCTAGGGGTGCCTGGGACAGGG + Intergenic
917969929 1:180199902-180199924 CTGGAGAGGAGCCTGGCCCAAGG - Exonic
1063664053 10:8051360-8051382 CTAGAGAGGAGCCGGGGCCCGGG - Intergenic
1069879716 10:71584245-71584267 CTAAAGTGGCTCCTGGGGCAAGG + Intronic
1075645109 10:124092103-124092125 GGATAGAGGCGCCGGGGCGAAGG - Intronic
1076733937 10:132450514-132450536 CTGAGGAGGCTCCTGGGCCATGG + Intergenic
1076868523 10:133181391-133181413 CTATCGGGGCTCCTGGCCCAAGG + Intronic
1079336882 11:19577764-19577786 CAATAGTGGGGCCTGGTCCATGG - Intronic
1083899503 11:65636755-65636777 GTCTAGAGGCGCCTGGGGGAGGG - Exonic
1084155388 11:67310221-67310243 CGAAAGAAGAGCCTGGGCCACGG + Exonic
1084758001 11:71251512-71251534 CGGTGGAGGCGCCTGGGCCGCGG + Intronic
1086375860 11:86200168-86200190 CTGTCCAGGGGCCTGGGCCAGGG + Intergenic
1089500544 11:118929206-118929228 CAATAGAGGAGCAGGGGCCAGGG + Intronic
1091699242 12:2649259-2649281 TTTTGGAGGCGGCTGGGCCAAGG - Intronic
1091792841 12:3281395-3281417 CTATAGGGGAGGCTGGGCCCGGG + Intronic
1098798131 12:74919746-74919768 CTTTAGAGGTCCCTGGGACAGGG + Intergenic
1102407036 12:112682547-112682569 CTATAAATGCACCTGGTCCATGG + Intronic
1104154059 12:126113926-126113948 CTATAGAGTCACCTTGGACACGG - Intergenic
1117674493 14:58141709-58141731 TTATTGAGGCCCCAGGGCCATGG - Intronic
1119086009 14:71739486-71739508 GAATAGAGGCGGATGGGCCAGGG - Exonic
1119088487 14:71758906-71758928 CTCCAGAGGGGCCTGGGGCAAGG - Intergenic
1122996221 14:105266318-105266340 CGAGAGAGTCGCCTGAGCCAGGG + Intronic
1128905186 15:71461246-71461268 CTATAGAGGTGCATGTGGCAGGG - Intronic
1129155257 15:73713672-73713694 CTGCAGAGGAGGCTGGGCCAGGG - Exonic
1130512896 15:84603971-84603993 CTCTTGAGGCACCTGGACCAAGG - Exonic
1133737265 16:8625647-8625669 CTAAGGTGGAGCCTGGGCCATGG + Exonic
1136016626 16:27404902-27404924 CTAGGGAGGTGCCTGGGCCATGG - Intronic
1136186788 16:28593100-28593122 CTGCAGTGGGGCCTGGGCCAGGG + Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1142693430 17:1620622-1620644 CAACAGAGGCGCCTGGGGCCGGG + Intronic
1152229570 17:79107720-79107742 CTGTAGAGGCCCTTGGGCCTGGG - Intronic
1153309917 18:3667821-3667843 TTCTAGAGGAACCTGGGCCAAGG - Intronic
1157501526 18:48194098-48194120 CAACAGTGGGGCCTGGGCCAAGG + Intronic
1162796083 19:13088365-13088387 CCCCAGAGGGGCCTGGGCCAGGG - Intronic
1163442502 19:17328895-17328917 CTGTACCGGCGCCTGGGCCGCGG - Exonic
1163660662 19:18575190-18575212 TTATTGAGGCTCCAGGGCCACGG - Exonic
1163729193 19:18940073-18940095 CCACAGAGGCCGCTGGGCCAGGG - Intronic
1168643785 19:58047014-58047036 CTCCAGAGGCGGCTGGGCCAAGG + Intronic
925254628 2:2472567-2472589 CTAAAGAGCCACGTGGGCCATGG + Intergenic
930022899 2:47012162-47012184 CTATGGGGGCTCTTGGGCCACGG + Intronic
933337896 2:80983729-80983751 CTATAAAGACACCTTGGCCAAGG - Intergenic
936061986 2:109300892-109300914 CTTTGGAGGCAGCTGGGCCATGG + Intronic
937095576 2:119233172-119233194 TTTTGGAGGCTCCTGGGCCAGGG - Intronic
937683186 2:124666588-124666610 CTCTAGAGTCCCCTTGGCCAAGG + Intronic
937992820 2:127673892-127673914 CTGCAGAGGGGCCTGGGCCAAGG + Intronic
1169244893 20:4017332-4017354 CTCTAGAGCTGCCTGTGCCAGGG + Intergenic
1169740440 20:8888000-8888022 CTATGGAGAAGCCTGGGCCTGGG + Intronic
1170612953 20:17929178-17929200 CAATAGAGGCCCCTGGGCGCTGG + Intergenic
1172791375 20:37507747-37507769 CCAGAGAGGTGCCTGGGACATGG - Intronic
1176257491 20:64159845-64159867 CTACAGCCGCGCCAGGGCCAGGG - Intronic
1181483733 22:23217930-23217952 CAATGTAGGAGCCTGGGCCACGG - Intronic
1183026856 22:35071781-35071803 CTCCAGAGGCGCCTGACCCAGGG - Intronic
1184188300 22:42878847-42878869 CTGGAGATGCCCCTGGGCCACGG + Intronic
954001744 3:47563056-47563078 CTATAGAGGCGCCTGGGCCAAGG - Intronic
968649916 4:1756445-1756467 GGATAGAGGCGCCTGGGCATGGG + Intergenic
977582826 4:98744176-98744198 CTGGAGAGGCATCTGGGCCATGG - Intergenic
979106854 4:116700608-116700630 CTATAGTGGCACCTGGGTCTTGG + Intergenic
982257551 4:153465936-153465958 TTGTCGAGGCGCTTGGGCCACGG - Intergenic
984701613 4:182822159-182822181 CCTTTGAGGCGCCTGGTCCACGG + Intergenic
985494302 5:196049-196071 CTGAAGAGCCGCCTGGACCAGGG + Intergenic
986167414 5:5287224-5287246 CAATAGATGCTGCTGGGCCAGGG - Intronic
998215856 5:140238248-140238270 CTGTTGTGGAGCCTGGGCCAAGG + Intronic
1001329547 5:170752573-170752595 CTAGAGTGGTGCCTGGGGCAGGG - Intergenic
1002987307 6:2202938-2202960 CAATAAAGGCGCCTGGGTCTGGG + Intronic
1019072834 6:169363713-169363735 CTCTAGAGGCGACTGGGTCACGG - Intergenic
1021942264 7:25689518-25689540 TTATTGAGGCCCCAGGGCCATGG + Intergenic
1024213690 7:47228651-47228673 CAATAAAGGGGCCTGGGCAACGG + Intergenic
1032545379 7:132737556-132737578 GGATAGAGGGGCCTGGGGCAGGG + Intergenic
1036212409 8:6853116-6853138 CTATGGAGGTGCTTGGACCATGG - Intergenic
1039485276 8:37904850-37904872 CTACCAAGGTGCCTGGGCCATGG - Intergenic
1051898444 9:22012578-22012600 TTATTGAGGCTCCAGGGCCATGG - Intronic
1061613202 9:131762430-131762452 CTAGCCAGGCGCCGGGGCCAGGG - Intergenic
1062523308 9:136968560-136968582 CTCTGGAGGGCCCTGGGCCAAGG - Intergenic
1187015319 X:15321578-15321600 CAATAGATGCCACTGGGCCACGG - Exonic
1188668987 X:32859901-32859923 CTACAGGGTCGCCTGGCCCAAGG - Intronic
1189885832 X:45543558-45543580 CTAGAGAGAAGCCTTGGCCAAGG + Intergenic
1190216106 X:48480470-48480492 CTATAGGGCCTCGTGGGCCATGG + Intronic
1196989618 X:121313698-121313720 CTTTAGAGGCCCGTGTGCCAAGG - Intergenic