ID: 954001745

View in Genome Browser
Species Human (GRCh38)
Location 3:47563062-47563084
Sequence ATGAGGCTATAGAGGCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954001745_954001754 23 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001754 3:47563108-47563130 TGCTGAGCCCGGCCTTCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 190
954001745_954001750 -3 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001750 3:47563082-47563104 CATGTGTTGATGAGCTCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 143
954001745_954001749 -4 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001749 3:47563081-47563103 TCATGTGTTGATGAGCTCTGCGG 0: 1
1: 0
2: 2
3: 47
4: 634
954001745_954001751 -2 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
954001745_954001752 12 Left 954001745 3:47563062-47563084 CCCAGGCGCCTCTATAGCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954001745 Original CRISPR ATGAGGCTATAGAGGCGCCT GGG (reversed) Intronic
902279779 1:15365990-15366012 ATGAGGCTAAAGAGTCGGCCGGG + Intronic
904852959 1:33472884-33472906 AGGAGGCGATAGAGGGCCCTGGG + Intronic
905675108 1:39819346-39819368 AGGAGGCTACAGAGAGGCCTTGG - Intergenic
912149314 1:106837704-106837726 ATGAGGCTATAGAGGTAGATAGG + Intergenic
913120017 1:115731381-115731403 GTGTGGCTAAAGAGGCTCCTGGG - Intronic
913188781 1:116395292-116395314 ATGAAGCCAAGGAGGCGCCTGGG - Intronic
1070509593 10:77148091-77148113 ATGAGGCAAGAGAGAGGCCTGGG - Intronic
1071883162 10:89921356-89921378 ATGAGCCTATAGTGGTGTCTTGG + Intergenic
1075327818 10:121548630-121548652 ATGAGGCTCCAGAGACCCCTGGG - Intronic
1083493893 11:63033747-63033769 AAGAGGCTTTAGAGACACCTTGG - Intergenic
1084386844 11:68848692-68848714 AGGAGGCTATAGACACGTCTTGG - Intergenic
1084935785 11:72585936-72585958 ATGAGGTTATGGAGCCACCTGGG + Intronic
1089735621 11:120548518-120548540 ATGAGGCTACAGAGGCACCTCGG + Intronic
1092083819 12:5739354-5739376 AAGAGGCTACAGATGCGACTGGG - Exonic
1100557179 12:95707245-95707267 ATGAGACTAGAGAGGTGACTGGG - Intronic
1101007924 12:100419688-100419710 GTGATGCTCTAGAGGCTCCTTGG - Intronic
1103186798 12:118965246-118965268 ATAAGGCTATGGTAGCGCCTCGG + Intergenic
1105069834 12:133227727-133227749 ATGAGGCCACTGAGGAGCCTGGG + Intronic
1112361299 13:98721179-98721201 AAGAGGCAAGAGAGGTGCCTTGG - Intronic
1112905800 13:104419763-104419785 CTGAGGCAATAGAGGTGCCTGGG - Intergenic
1114247059 14:20924063-20924085 ATGAGGCTATAGCTCCTCCTTGG - Intergenic
1114434191 14:22690480-22690502 ATCAGGCTAATGAGGCACCTAGG - Intergenic
1117970520 14:61246656-61246678 ATGAGGCTGCAGAGGTACCTGGG - Intronic
1121101062 14:91250650-91250672 ATGATGCTAGAGAGGCCACTGGG + Intronic
1125233931 15:37489883-37489905 ATGAGGTTTTAGAGGCGCAAAGG + Intergenic
1128768961 15:70267609-70267631 ATGAGGCTGGAGAGGAGCCATGG - Intergenic
1128807430 15:70541469-70541491 ATGTGGCTTTAGGGGCTCCTTGG + Intergenic
1129125931 15:73441408-73441430 ATGAGGCTACAGAGGTGAGTTGG - Intergenic
1129708507 15:77808230-77808252 ATGAGGCTGGAGAGGGGCCCGGG - Intronic
1131400914 15:92124942-92124964 ATGAGGATAAAGAGGCACCCAGG + Intronic
1139550176 16:67668449-67668471 AGGAGGCTGGAGAGGAGCCTGGG + Exonic
1139706948 16:68747337-68747359 ATGAGGCTGCAGAGGCAGCTGGG + Intronic
1140062911 16:71587072-71587094 ATGAGGCTAGAGAGACGCAGAGG + Intergenic
1141650933 16:85392820-85392842 CTGAGGCTGGAGAGGCGGCTGGG + Intergenic
1147452977 17:40517608-40517630 AGGAGGCCAGAGAGGCACCTAGG + Intergenic
1148858252 17:50590857-50590879 AGGAGACTAAAGAGGGGCCTGGG - Intronic
1155519704 18:26656484-26656506 AGGGGGCTTTAAAGGCGCCTGGG + Intronic
1163093031 19:15034560-15034582 ATGAGGCTGGAGAGGTGGCTAGG + Intergenic
1164506184 19:28863370-28863392 GTGAGGCAAGAGAGGTGCCTGGG + Intergenic
1164643244 19:29841641-29841663 CTGAGGCTAGATAGGCCCCTGGG - Intergenic
1167515389 19:49920582-49920604 ATGAGGCTGTGGAGGCGGATAGG + Intronic
926109049 2:10170546-10170568 ATGATGCCAAGGAGGCGCCTGGG + Intronic
932469695 2:71945719-71945741 CTGAGGCTGGAGAGGCGGCTGGG + Intergenic
940060276 2:149558314-149558336 ATGAGGCTAGAAAGACACCTTGG - Intergenic
949023371 2:241753633-241753655 CTGAGGCTACAGCGGGGCCTGGG - Intronic
1173016057 20:39226735-39226757 ATGAGGGCATAGAGTCCCCTGGG + Intergenic
1177049437 21:16213722-16213744 ATGAGTCTGTAGAGGAGTCTTGG + Intergenic
1177049442 21:16213759-16213781 ATGAGTCTGTAGAGGTGTCTTGG + Intergenic
1178484173 21:33006706-33006728 ATGAGGAAATTGAGGTGCCTAGG + Intergenic
1182033692 22:27181110-27181132 ATGAGGAAATGGAGGCCCCTGGG + Intergenic
1183209000 22:36438661-36438683 ATTAGGCTCTAGAGGCTCCAGGG - Intergenic
1184373713 22:44098542-44098564 ATGAGGCGGGAGAGGGGCCTTGG + Intronic
1185315404 22:50176820-50176842 AGGAGGCTGGAGAGGCTCCTGGG + Intronic
954001745 3:47563062-47563084 ATGAGGCTATAGAGGCGCCTGGG - Intronic
954092974 3:48300268-48300290 ATGAGGCTAGAGAGGTACGTGGG - Intronic
955664374 3:61334955-61334977 ATGAGGCTATAGCTCCTCCTGGG - Intergenic
962086402 3:132196373-132196395 TTGAGGCTATAGGGGTGACTGGG - Intronic
962394303 3:135001407-135001429 ATGAGGCTATAGAACAGCCCTGG - Intronic
968810068 4:2795784-2795806 GTGAGGGTATGGAGGGGCCTGGG + Intronic
968817288 4:2828656-2828678 GTGAGGCTAGAGATGGGCCTGGG + Intronic
969453551 4:7288338-7288360 TGGAGGCTATAGAGGCCCATAGG + Intronic
970169738 4:13277791-13277813 ATGAGGCTGCAGAGGAGCCCAGG + Intergenic
971333854 4:25704745-25704767 GTGAGGCAAGAGAGGCACCTAGG - Intergenic
975599580 4:76085400-76085422 GTGTGGCTATTGAGGTGCCTAGG + Intronic
979106852 4:116700602-116700624 ATGAGCCTATAGTGGCACCTGGG + Intergenic
988514970 5:31896279-31896301 ATGAGGCAATAAAGTCACCTAGG - Intronic
989609064 5:43274110-43274132 GTGAGGCCATTGAGGCACCTAGG + Intronic
992199362 5:74368642-74368664 CTGAGGCCAGAGAGGTGCCTAGG - Intergenic
993106409 5:83605695-83605717 ATGAGGACATAGAGGCCCCTAGG + Intergenic
995372729 5:111437797-111437819 ATGAGGCTGGAGAGGAGCATAGG + Intronic
996692289 5:126353055-126353077 TTGGGGTTATAGAGGCTCCTTGG - Intergenic
997608582 5:135194136-135194158 ATGAGGCTATAGTGGCACTTTGG + Intronic
997671686 5:135679750-135679772 ATGGAGCTATAGAGGCTCTTGGG + Intergenic
1000022344 5:157328843-157328865 ATCAAGCTTTAGAGGCTCCTTGG + Intronic
1000365693 5:160488774-160488796 ATGCTGCTAGAGAGGTGCCTTGG + Intergenic
1002987305 6:2202932-2202954 ATCAAGCAATAAAGGCGCCTGGG + Intronic
1004629980 6:17411928-17411950 AAAGGGCTATAGAGGGGCCTGGG + Intronic
1007234186 6:40378621-40378643 AAGAGGCTAAAGAGGGTCCTCGG - Intergenic
1011551339 6:88533682-88533704 ATGAGGCTAGGGAGGGGGCTGGG - Intergenic
1019639916 7:2097787-2097809 TTGAGGCTGCAGAGGCGTCTGGG + Intronic
1021260558 7:18451678-18451700 ATGTGGATATAGAGGTGCTTCGG + Intronic
1021956015 7:25825188-25825210 ATGAGGTTATAGATGGGGCTAGG + Intergenic
1025205869 7:56993113-56993135 ATGAGGCAAGAGAGCCGCCTTGG + Intergenic
1025666071 7:63583825-63583847 ATGAGGCAAGAGAGCCGCCTTGG - Intergenic
1030145214 7:106346090-106346112 ATCAGCCTATAGAAGCTCCTTGG - Intergenic
1034300691 7:150012862-150012884 ATGAGGCTGGAAAGGCGGCTTGG + Intergenic
1034805359 7:154084438-154084460 ATGAGGCTGGAAAGGCGGCTTGG - Intronic
1037415928 8:18649630-18649652 ATGAGATTTTAGAGGCGCCAGGG + Intronic
1043620592 8:82187244-82187266 ATGAGGCCAAAGAGGGCCCTTGG + Intergenic
1048982243 8:139708911-139708933 ATGAGGCTATAGAGAGGAGTGGG + Intergenic
1053783019 9:41630371-41630393 ATGAGGAAATAGAGGAGCATAGG + Intergenic
1054170972 9:61840513-61840535 ATGAGGAAATAGAGGAGCATAGG + Intergenic
1054666563 9:67740299-67740321 ATGAGGGAATAGAGGAGCATAGG - Intergenic
1057814932 9:98287294-98287316 ATGAGGCTAGAAAGGAGCATGGG + Intergenic
1190870394 X:54420178-54420200 ATGAGGCTAGAGAGGTGGCAAGG + Intergenic
1191257090 X:58284245-58284267 ATGAGGCCAAAGAGGAGGCTCGG - Intergenic
1192449729 X:71236535-71236557 GTGAGGCAATTGAGGCACCTAGG - Intergenic
1197868937 X:131047391-131047413 CTGACGCTATAGAGGCTCCCTGG + Intergenic